Enterococcus faecalis SH01 and application thereof
By isolating Enterococcus faecalis SH01 from livestock and poultry manure and optimizing its culture conditions, the problem of the difficulty in degrading tetracycline pollutants was solved, achieving efficient degradation and reduction of its toxicity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-25
- Publication Date
- 2026-03-24
AI Technical Summary
In existing technologies, tetracycline pollutants are difficult to degrade efficiently, and their degradation products pose potential threats to the environment and health. There is a lack of effective biodegradable strains.
A strain of Enterococcus faecalis SH01 was isolated and identified from livestock and poultry manure. Its culture and application conditions were optimized for degradation of tetracycline pollutants in wastewater, with a degradation rate of up to 86.04%.
This method achieves efficient degradation of tetracycline pollutants, reduces their residual toxicity in the environment, and provides an environmentally friendly pollution control method.
Smart Images

Figure CN119662479B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a tetracycline-degrading bacterium, Enterococcus faecalis SH01, and its applications, belonging to the field of microbial technology. Background Technology
[0002] Tetracycline (TC) is widely used in livestock and aquaculture. Because TC cannot be completely absorbed by animals or humans, ingested TC is excreted in feces as parent organisms or secondary metabolites, entering the environment. TC pollution not only disrupts the ecological balance but also exerts selective pressure on microorganisms, inducing the development of drug-resistant bacteria and the horizontal transfer of resistance genes, seriously endangering human health. Therefore, it is necessary to adopt appropriate technical means to control environmental TC pollution.
[0003] Microbial degradation is a promising pollutant treatment technology due to its environmental friendliness and low application cost. This method, through targeted screening of degrading bacteria, can achieve efficient degradation of pollutants and is currently a research hotspot in TC pollution remediation. Wastewater, soil, and livestock manure can all be used as separation media for TC-degrading bacteria. The screened TC-degrading bacteria are mainly *Pseudomonas*, *Klebsiella*, *Bacillus*, and *Sphingomonas*, whose TC degradation rates typically reach over 70%. *Enterococcus faecalis* is a group of Gram-positive bacteria widely found in the animal intestines, with strong adaptability and resistance to the environment and harmless to humans and animals. For environmental TC pollution, this invention, for the first time, isolates a strain of *Enterococcus faecalis* capable of efficiently degrading TC from livestock manure. This bacterium can reduce the antibacterial activity of TC degradation products, showing promising application prospects for TC pollution remediation. Summary of the Invention
[0004] The purpose of this invention is to provide a bacterial strain capable of degrading tetracycline (TC) and its optimal conditions for TC degradation. This strain was isolated from livestock and poultry manure, identified as *Enterococcus faecalis*, and named SH01. This strain can degrade tetracycline.
[0005] Therefore, the present invention provides a strain of Enterococcus faecalis, with the preservation number GDMCC NO: 65588.
[0006] The present invention provides a method for culturing the aforementioned Enterococcus faecalis by inoculating it into LB medium for culture.
[0007] Specifically, the culture conditions are as follows: culture medium pH 6.5-7.5, culture temperature 24-26℃, and constant temperature shaker speed 120-180 rpm.
[0008] This invention provides the application of the aforementioned Enterococcus faecalis in the degradation of tetracycline.
[0009] Specifically, the application is for degrading tetracycline contaminants in wastewater.
[0010] The present invention provides a method for degrading tetracycline pollutants in wastewater, wherein the Enterococcus faecalis is added to the wastewater to be treated to degrade the tetracycline pollutants.
[0011] Specifically, the treatment temperature is 28-31℃, the pH value is 6.5-8.0, the inoculum amount is 0.5-1.5% (v / v) based on the ratio of inoculum volume to degradation system volume, and the tetracycline pollutant in the wastewater is adjusted to 25-45 mg·L⁻¹. -1 .
[0012] Preferably, the treatment temperature is 29-30℃, the pH value is 7.0-7.5, the inoculum amount is 0.8-1.2% (v / v) based on the ratio of inoculum volume to degradation system volume, and the tetracycline pollutant in the wastewater is adjusted to 38-41 mg·L⁻¹. -1 .
[0013] The inoculum solution is obtained according to the culture method described above.
[0014] The strain SH01 of this invention can be cultured in LB medium under the following optimal conditions: pH 7, culture temperature 25°C, and shaking speed of a constant temperature shaker at 150 rpm. The optimal conditions for strain SH01 to degrade TC are: temperature 29.67°C, pH 7.21, inoculum size 1.01% (v / v, inoculum volume / degradation system volume), and initial TC concentration 39.18 mg·L⁻¹. -1 The degradation rate was as high as 86.04%. Therefore, the strain SH01 of this invention has high practical value.
[0015] Preservation information:
[0016] Strain SH01 was deposited on December 6, 2024, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, China, Guangdong Institute of Microbiology), with accession number GDMCC NO: 65588 and classification name Enterococcus faecalis. Attached Figure Description
[0017] Figure 1 The colony morphology of strain SH01.
[0018] Figure 2 This is a scanning electron microscope image of strain SH01.
[0019] Figure 3Phylogenetic tree of strain SH01.
[0020] Figure 4 The effect of temperature on the degradation of TC by SH01.
[0021] Figure 5 The effect of pH on the degradation of TC by SH01.
[0022] Figure 6 The effect of inoculum amount on TC degradation by SH01.
[0023] Figure 7 The effect of initial TC concentration on TC degradation by SH01.
[0024] Figure 8 Three-dimensional surface plot (a) and contour plot (b) of the response to the interaction of temperature and pH; three-dimensional surface plot (c) and contour plot (d) of the response to the interaction of inoculum amount and TC concentration.
[0025] Figure 9 The diameter of the inhibition zone of TC degradation products on Escherichia coli. Detailed Implementation
[0026] The following description of the research and development process and specific implementation methods of this invention does not constitute a limitation of this invention.
[0027] Test materials and reagents
[0028] Tetracycline (TC) was purchased from Aladdin Reagents Ltd. (Shanghai, China). All other chemicals, including peptone, yeast extract, NaCl, K2HPO4, KH2PO4, MgSO4·7H2O, agar powder, and PBS buffer, were purchased from Guangzhou Chemical Reagent Factory.
[0029] LB medium: 10 g / L peptone -1 5g·L yeast extract -1 NaCl 10 g·L -1 (Add 15 g·L to solid culture medium) -1 (Agar powder).
[0030] Inorganic salt medium (MM): K2HPO4 1.5 g·L -1 KH2PO4 0.5g·L -1 NaCl 1g·L -1 MgSO4·7H2O 0.2g·L -1 .
[0031] MM-P: Add an additional 10 g·L to MM medium. -1 Peptone.
[0032] Animal manure, collected from an animal hospital.
[0033] Example 1: Screening, morphological observation and identification of degrading bacteria
[0034] 1. Screening of degrading bacteria
[0035] 1.1 Enrichment Culture
[0036] Weigh 10g of fecal sample and add it to an Erlenmeyer flask containing 100mL of sterile water. Place the flask in a constant temperature shaker at 30℃ and 150rpm for 30min, then let it stand for 10min. Take 10mL of the supernatant and add it to an Erlenmeyer flask containing 100mL of LB medium. Add TC solution to bring the TC concentration in the medium to 20mg·L⁻¹. -1 The conical flask was wrapped with aluminum foil to prevent photolysis of TC, and incubated in a constant temperature shaker at 30°C and 150 rpm for 5 days. After 5 days of incubation, 10 mL of the culture medium was added to fresh LB medium for continued incubation, with the TC concentration in the LB medium increased by 20 mg / L at each inoculation. -1 Until it reaches 100 mg·L -1 Each culture cycle lasts for 5 days.
[0037] 1.2 Separation and Purification
[0038] After enrichment culture is complete, take 1 mL of the enriched culture medium and mix it with 9 mL of sterile water to form 10... -1 Repeat this process with the diluted solution until a dilution of 10 is achieved. -7 Until then. Select 10. -5 ~10 -7 Three dilution factors were prepared, and 100 μL of bacterial culture from each factor was spread onto a medium containing TC (100 mg / L). -1 Incubate on LB agar plates at 37°C. After colonies have grown, select single colonies with different morphologies and repeatedly streak them onto LB agar plates to isolate and purify single strains.
[0039] 1.3 Determination of TC degradation rate by the strain
[0040] A small amount of purified single colony was picked up using an inoculation loop and inoculated into LB medium. After thorough mixing by shaking, the culture was incubated in a shaker at 30°C and 150 rpm in the dark for 3 days. The culture was centrifuged at 6000 rpm for 5 min, the supernatant was discarded, and sterile water was added to wash the bacterial cells. This process was repeated twice. After adding sterile water again and shaking, the absorbance of the bacterial culture was measured at 600 nm using a visible spectrophotometer, expressed as OD0.05. 600 The inoculum solution was prepared using a standard concentration of 1.0. The inoculum solution was then inoculated into MM-P medium (TC concentration 50 mg / L) at a 5% inoculation rate. -1The culture medium was incubated in a constant temperature shaker at 25℃ and 150 rpm in the dark for 3 days. After 3 days, samples were taken to determine the removal rate of TC in the culture medium, and strains with TC degradation ability were selected for subsequent experiments.
[0041] 2. Morphological observation of degrading bacteria
[0042] Morphological observation of degrading bacteria includes observation of colony morphology and observation of bacterial cell morphology.
[0043] The morphology of the degrading bacteria colonies was observed using the streak plating method. Single colonies of the degrading bacteria were picked up with an inoculation loop and streaked onto LB agar plates. After incubation at 37°C for 24 hours, the colony morphology was observed.
[0044] The morphology of the degrading bacteria cells was observed using scanning electron microscopy (SEM). After inoculating the degrading bacteria in LB medium and culturing for 3 days, the culture medium was centrifuged at 6000 rpm for 5 min, and the supernatant was discarded to obtain bacterial cell samples. The bacterial cell samples were subjected to SEM scanning according to the following procedure: ① Sample fixation with 2.5% glutaraldehyde solution; ② Rinsing the sample three times with phosphate buffer (0.1 M, pH 7.0); ③ Sample fixation with 1% osmium tetroxide solution; ④ Rinsing the sample three times with phosphate buffer (0.1 M, pH 7.0); ⑤ Dehydration treatment once each with gradient concentrations (30%, 50%, 70%, 80%, 90%) ethanol solutions, and twice with 100% ethanol; ⑥ Critical point drying; ⑦ Coating and observation. The final samples were observed using a field emission scanning electron microscope (Thermo Fisher Scientific, Verios 460).
[0045] 3. Identification of 16S rRNA in degrading bacteria
[0046] 16S rRNA sequencing was used to identify the degrading bacteria. The procedure included DNA extraction, PCR amplification, and sequencing of the PCR products.
[0047] DNA extraction steps are as follows: ① Add 200 μL Buffer ATL and 20 μL Proteinase K to a grinding tube, add half a spoonful of 3 mm zirconium beads / one 5 mm steel bead (depending on the state of the bacterial plate, zirconium beads are sufficient for bacteria, while steel beads are required for fungal hyphae and anaerobic bacteria), take a single colony from the bacterial plate and put it into the grinding tube, grind it at 60 Hz for 2 min on an automatic grinder; ② Briefly centrifuge, add 200 μL Buffer ATL, and mix thoroughly; ③ Incubate at 70℃ for 15 min, shaking twice during the process, centrifuge at 12000 rpm for 3 min after lysis, take 400 μL of supernatant and transfer it to a new deep-well plate, add 300 μL Buffer BD and 20 μL magnetic beads to the deep-well plate, and place it in station 2 of the extraction instrument; ④ Take a new extraction plate and dispense 300 μL Buffer ATL into each well. BW1 is placed at extraction station 3. Two plates containing 500 μL / well of 75% ethanol are placed at stations 4 and 5 respectively. 100 μL / 80 μL / 60 μL of elution buffer is dispensed into each well of the elution plate (the corresponding volume is dispensed according to the sample condition). The elution buffer is placed at station 6. ⑤ Select the corresponding program, check the instrument status and extraction plate information, and then run the program. ⑥ After the program is completed, remove the elution plate for DNA concentration and electrophoresis gel detection, and store it at 4℃.
[0048] The composition of the PCR amplification system is shown in Table 1, where the upstream primer is 27F (AGAGTTTGATCCTGGCTCAG) and the downstream primer is 1492R (TACGGYTACCTTGTTACGACTT).
[0049] Table 1. PCR amplification system (30 μL)
[0050]
[0051] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ final extension for 5 min. All procedures were performed by Wuhan Tianyi Huayu Gene Technology Co., Ltd.
[0052] Good PCR products with electrophoretic bands matching the theoretical target size were sent for Sanger sequencing using an ABI 3730x LDNAAnalyzer sequencer.
[0053] 4 Experimental Results
[0054] Multiple strains were isolated from livestock and poultry manure. Four strains with significantly different appearances were selected. Among them, strain SH01 showed the highest degradation rate of TC, with a degradation rate of 58.19%. Therefore, strain SH01 was selected for subsequent experiments.
[0055] The colonies of strain SH01 are milky white, thick in texture, smooth and moist on the surface, with neat edges, and single colonies are round. Figure 1 Its bacterial cells are ellipsoidal with a central indentation, and the surface is slightly rough, with an average size of 0.5 × 1.0 μm. Figure 2 ).
[0056] The total length of the 16S rRNA sequence of strain SH01 is 1407 bp. It was submitted to the NCBI database for BLAST comparison, and phylogenetic trees were constructed using strain sequences with high similarity. Figure 3 The results showed that strain SH01 belonged to the genus Enterococcus and clustered with Enterococcus faecalis, therefore strain SH01 was identified as Enterococcus faecalis. This strain was deposited with the Guangdong Provincial Center for Microbial Culture Collection on December 6, 2024, with accession number GDMCC NO: 65588, and classified as Enterococcus faecalis.
[0057] Existing reports have identified mostly Pseudomonas, Klebsiella, Sphingosomal, and Bacillus bacteria as TC-degrading bacteria, with no reports on Enterococcus faecalis degrading TC. This invention is the first to isolate an Enterococcus faecalis strain capable of degrading TC, enriching the microbial resources for the bioremediation of TC pollution.
[0058] Example 2: Investigation of the degradation performance of strain SH01
[0059] 1. Single-factor experiment
[0060] 1.1 Effect of temperature on the degradation of TC by the strain
[0061] Four different temperature gradients were set up: 15, 20, 25, and 30 °C. 20 mL of MM-P medium was added to a 50 mL Erlenmeyer flask, the pH was adjusted to 7, and the flask was autoclaved at 121 °C for 20 min. The initial TC concentration was 30 mg / L. -1 Add inoculum at a rate of 2% (v / v, inoculum volume / degradation system volume), seal the flask opening with a rubber stopper, and wrap the Erlenmeyer flask body with aluminum foil to prevent photodegradation from affecting the experimental results. Place the Erlenmeyer flask in a constant temperature shaker and incubate at 15, 20, 25, and 30°C at 150 rpm for 3 days. Samples are taken at 12, 24, 36, 48, 60, and 72 hours, and stored at -20°C for analysis.
[0062] 1.2 Effect of pH on the degradation of TC by the strain
[0063] Set six different pH values: 4, 5, 6, 7, 8, and 9. The remaining operating procedures are described in 1.1.
[0064] 1.3 Effect of inoculum size on TC degradation by the strain
[0065] Five different inoculation amounts were set: 1%, 2%, 3%, 5%, and 9%. The remaining procedures are described in 1.1.
[0066] 1.4 Effect of initial TC concentration on TC degradation by the strain
[0067] Five different initial TC concentrations were set: 10, 20, 30, 40, and 50 mg·L⁻¹. -1 For the remaining operating procedures, see 1.1.
[0068] Optimization of 2TC degradation conditions
[0069] The optimal conditions for TC degradation by strain SH01 were explored using response surface methodology. A series of optimization experiments were designed using Design-Expert software, and the specific parameters are shown in Table 2.
[0070] Table 2. Box-Behnken design for SH01-degraded TC
[0071]
[0072]
[0073] 3 Experimental Results
[0074] 3.1 Effects of different degradation conditions on the degradation of TC by SH01
[0075] The effect of temperature on the degradation of TC by SH01 is shown in the figure. Figure 4 Within the experimental range (15-30℃), the degradation rate of TC by SH01 increased with increasing temperature. The highest degradation rate of TC (84.00%) was observed at a culture temperature of 30℃. Furthermore, even at lower culture temperatures (15℃), SH01 still exhibited some degradation effect on TC, with a degradation rate of 65.28%, which may be related to the strong environmental adaptability of Enterococcus faecalis itself.
[0076] The effect of pH on the degradation of TC by SH01 is shown in [reference]. Figure 5 As the pH increased from 4 to 7, the degradation rate of TC by SH01 gradually increased; as the pH increased from 7 to 9, the degradation rate of TC by SH01 gradually decreased. That is, at pH 7, the degradation rate of TC by SH01 was the highest, at 69.25%.
[0077] The effect of inoculum size on TC degradation by SH01 is shown in the figure. Figure 6When the inoculum amount increased from 1% to 2%, the degradation rate of TC by SH01 increased slightly; however, when the inoculum amount increased from 2% to 5%, the degradation rate of TC by SH01 decreased rapidly. That is, the degradation rate of TC by SH01 was highest at an inoculum amount of 2%, reaching 66.40%.
[0078] The effect of initial TC concentration on SH01 degradation of TC is shown in the figure. Figure 7 As the initial TC concentration increased from 10 mg·L⁻¹ -1 Increase to 40 mg·L -1 The degradation rate of TC by SH01 increased rapidly; however, when the initial TC concentration increased from 40 to 50 mg·L⁻¹, the degradation rate of TC increased rapidly. -1 The degradation rate of TC by SH01 began to decrease slowly. That is, the initial TC concentration was 40 mg·L⁻¹. -1 At that time, SH01 showed the highest degradation rate of TC, at 74.30%.
[0079] 3.2 Optimization of degradation conditions for TC by strain SH01
[0080] The effects of degradation conditions such as temperature, pH, inoculum size, and initial TC concentration on TC degradation by SH01 were analyzed using Design-Expert software. The resulting equation for the TC degradation model is as follows:
[0081] Y=-115.3301+4.43544A+32.33125B+0.832917B+0.502646D+0.0285AB-0.062833AC+0.003967AD+0.146250BC+0.039812BD-0.019875CD-0.069593A 2 -2.40427B 2 -0.312708C 2 -0.011508D 2
[0082] In the formula: Y is the predicted TC degradation rate, and A, B, C and D are temperature, pH, inoculum amount and initial TC concentration, respectively.
[0083] Based on this equation, the response surface is derived. Figure 8 Response surface methodology (RSM) prediction showed that, within the experimental parameters, the degradation rate of TC by SH01 increased with increasing temperature and decreased with increasing inoculum size. Furthermore, the degradation rate of TC by SH01 initially increased and then decreased with increasing pH or initial TC concentration. Based on the degradation model, the optimal conditions for TC degradation by strain SH01 were predicted to be: temperature 29.67℃, pH 7.21, inoculum size 1.01%, and initial TC concentration 39.18 mg·L⁻¹. -1 The highest degradation rate was 86.04%.
[0084] Previous studies have shown that Trichosporon mycotoxinivorans XPY-10 degrades TC by 78.28% within 7 days (Huang et al., 2016); Pseudomonas sp. TC952 can degrade 72.8% of TC (50 mg·L⁻¹) within 6 days. -1 (Tan et al., 2022); The optimal degradation conditions for TC by Klebsiella sp. SQY5 are a TC concentration of 61.27 mg·L⁻¹. -1 At a temperature of 34.96℃, pH 7.17, and an inoculum size of 29.89%, the highest degradation rate was 78.78%. Compared with previous studies, strain SH01 achieved a relatively high degradation rate of TC (86.04%).
[0085] Example 3: Antibacterial Activity Analysis of TC Degradation Products
[0086] 1 Experimental Methods
[0087] The antibacterial activity of TC degradation products was determined using the perforation method. 30 mg·L⁻¹ of TC was added to LB medium. -1 TC, 2% degrading bacteria and 30 mg·L -1 TC and 2% degrading bacteria were used, with a final volume of 20 mL for each treatment, and incubated in a constant-temperature shaker at 25°C and 150 rpm for 72 h. At 0, 24, 48, and 72 h, 2 mL of culture medium was collected, centrifuged at 6000 rpm for 5 min, and the supernatant was filtered through a 0.22 μm nylon filter. A well was punched in the center of an LB agar plate, and 100 μL of supernatant was added to each well. E. coli was then spread onto the agar plate (Escherichia coli ATCC 25922, purchased from Beijing Bio-Tech Biotechnology Co., Ltd.), and incubated at 37°C for 24 h. The diameter of the inhibition zone of E. coli was then measured. The size of the inhibition zone diameter reflects the antibacterial activity of the TC degradation products, and the toxicity of the TC degradation products was evaluated using antibacterial activity as a parameter.
[0088] 2 Experimental Results
[0089] Since the addition of degrading bacteria did not show any inhibitory effect on Escherichia coli, it was not observed in... Figure 9 Draw it out in the middle. For example... Figure 9 As shown, when the degradation time reached 72h, the diameter of the inhibition zone in the TC+SH01 treatment decreased from 14.20mm at 0h to 12.16mm, which was also lower than the diameter of the inhibition zone in the TC treatment at 72h (15.99mm). This indicates that the antibacterial activity of TC degradation products decreased in the TC+SH01 treatment, and the biodegradation process of SH01 can reduce the toxicity of TC degradation products.
Claims
1. A strain of Enterococcus faecalis ( Enterococcus faecalis ), characterized in that, Its accession number is GDMCC NO: 65588.
2. A method for culturing Enterococcus faecalis as described in claim 1, characterized in that, Inoculate it into LB medium and culture it.
3. The cultivation method as described in claim 2, characterized in that, The culture conditions are as follows: pH of the culture medium is 6.5-7.5, culture temperature is 24-26℃, and the rotation speed of the constant temperature shaker is 120-180 rpm.
4. The application of Enterococcus faecalis as described in claim 1 in the degradation of tetracycline.
5. The application as described in claim 4, characterized in that, The application is for degrading tetracycline contaminants in wastewater.
6. A method for degrading tetracycline pollutants in wastewater, characterized in that, The Enterococcus faecalis as described in claim 1 is added to the wastewater to be treated for treatment to degrade the tetracycline pollutant.
7. The method as described in claim 6, characterized in that, The treatment temperature is 28-31℃, the pH value is 6.5-8.0, the inoculum amount is 0.5-1.5% (v / v) based on the ratio of inoculum volume to degradation system volume, and the tetracycline pollutant in the wastewater is adjusted to 25-45 mg·L. -1 .
8. The method as described in claim 6, characterized in that, The treatment temperature is 29-30℃, the pH value is 7.0-7.5, the inoculum amount is 0.8-1.2% (v / v) based on the ratio of inoculum volume to degradation system volume, and the tetracycline pollutant in the wastewater is adjusted to 38-41 mg·L⁻¹. -1 .
9. The method as described in claim 7 or 8, characterized in that, The inoculum is obtained according to the culture method described in claim 2 or 3.