Oxetane synthase mutants and uses thereof

Abstract

The application belongs to the technical field of genetic engineering, and provides an oxetane synthase mutant and application thereof. The oxetane synthase TOT is a key gene for catalyzing the formation of an oxygen-containing four-membered ring in the skeleton structure of paclitaxel. However, the enzyme is accompanied by a side reaction when generating an oxygen-containing four-membered ring from an oxidized substrate, so that the paclitaxel biosynthesis process is faced with problems such as low synthesis efficiency and difficult separation and purification. Through homology modeling and molecular dynamics simulation, the application finds key residues for controlling the product path and proportion of TOT, and successfully improves the efficiency of TOT in synthesizing an oxetane structure through rational design. The TOT mutant provided by the application helps to improve the biosynthesis efficiency of paclitaxel, and provides a better catalytic tool for realizing the industrial preparation of taxane drugs through enzymatic catalysis and synthetic biology.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically, it relates to an oxacyclobutane synthase mutant and its application. Background Technology

[0002] Paclitaxel is the world's best-selling plant-based anticancer drug. Clinically, paclitaxel is a first-line drug for treating breast, lung, and ovarian cancer, and is one of the most effective anti-tumor drugs for treating many advanced and refractory cancers. It enjoys enormous demand in the international pharmaceutical market and has saved countless lives worldwide. In the late 1990s and early 2000s, annual sales of paclitaxel exceeded $1.5 billion, reaching a peak of $2 billion in 2001.

[0003] As an anticancer drug, paclitaxel has a highly complex molecular structure, featuring a highly oxidized, complex bridged ring system and 11 stereocenters, making it widely recognized in the chemical community as one of the most difficult natural product molecules to synthesize organically. By 1992, more than 30 research groups had participated in the synthesis of paclitaxel, a rarity in the history of organic synthesis. Even in the shortest chemical synthesis route to date, the yield of paclitaxel is only 0.118%. Therefore, achieving efficient and green synthesis of paclitaxel-like drugs through synthetic biology has attracted widespread attention from chemists.

[0004] To achieve efficient synthesis of paclitaxel using synthetic biology methods, elucidating the paclitaxel biosynthetic pathway is crucial. In previous studies, we successfully identified two key enzymes missing in the paclitaxel biosynthetic pathway: T9H and TOT. These enzymes catalyze the hydroxylation of taxane at position 9 and the formation of an oxa-4-membered ring, respectively. By co-injecting these two newly identified enzymes with seven known enzymes in the paclitaxel biosynthetic pathway (TXS, T5αH, T13αH, T2αH, T7βH, TAT, TBT) into tobacco, we achieved the heterologous synthesis of the key intermediate baccatin III in tobacco (B. Jiang, et al. Science, 2024, 383, 622), laying the foundation for the future large-scale green preparation of paclitaxel through metabolic engineering strategies. However, this heterologous synthesis is extremely inefficient, partly because the key enzyme TOT in paclitaxel biosynthesis exhibits functional heterogeneity; in addition to generating the desired oxa-4-membered ring product, it can also produce the byproduct epoxide. Therefore, developing TOT enzyme mutants with higher catalytic efficiency and better selectivity is crucial for the heterologous synthesis of paclitaxel. Summary of the Invention

[0005] The purpose of this invention is to provide an oxacyclobutane synthase mutant and its applications.

[0006] To achieve the objectives of this invention, in a first aspect, the present invention provides an oxetane synthase mutant, said mutant comprising a mutation in the oxetane synthase at amino acid position 382, ​​changing from V to I, F, or Q; or,

[0007] The mutant is a homolog of oxadiazine synthase with amino acid I, F, or Q at position 382.

[0008] Among them, the oxetane synthase (taxane C4-C20 oxetane synthase TOT) is:

[0009] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:1;

[0010] (b) A protein derived from (a) with the sequence shown in SEQ ID NO:1 substituted, deleted or added with one or more amino acids and having the same function.

[0011] The oxetane synthase involved in this invention is derived from Taxus wallichiana (a type of yew tree). Taxus chinensis var. mairei ).

[0012] Preferably, the mutant comprises a mutation in amino acid position 382 of the oxadiazon synthase, changing from V to I; or,

[0013] The mutant is a homolog of oxadiazine synthase with amino acid I at position 382.

[0014] Secondly, the present invention provides a gene encoding the mutant, the nucleotide sequence of which is:

[0015] i) The nucleotide sequence shown in SEQ ID NO:2;

[0016] ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:2 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function;

[0017] iii) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:2 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS, followed by washing the membrane with the same solution; or

[0018] iv) Nucleotide sequences that have more than 90% homology with the nucleotide sequences of i), ii) or iii) and express the same functional protein.

[0019] Thirdly, the present invention provides biological materials containing the gene, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or transgenic cell lines.

[0020] Fourthly, the present invention provides the use of the mutant, or its encoding gene, or biological material containing the gene, in the synthesis of oxygen-containing heterocyclic compounds.

[0021] In this invention, the oxygen-containing heterocyclic compound includes taxane compounds having an oxocyclic butane ring group and an epoxy group.

[0022] Preferably, the taxane compound includes at least one of paclitaxel and its derivatives, docetaxel and its derivatives, and cabazitaxel and its derivatives.

[0023] Fifthly, the present invention provides a method for synthesizing oxygen-containing heterocyclic compounds in vivo or in vitro, using taxane compounds containing 5α-acetoxy-4,20-enyl groups as substrates (such as taxadiene-hexaol-hexaacetate), and synthesizing oxygen-containing heterocyclic compounds under the catalysis of the mutant.

[0024] Furthermore, the term "in vivo" includes microorganisms, plant cells, and / or animal cells.

[0025] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0026] This invention is the first to discover key sites affecting the proportion of TOT products and constructs a more selective TOT-V382I mutant using site-directed mutagenesis. This mutant has potential applications in the heterologous synthesis of paclitaxel drugs. Furthermore, the TOT-V382F and TOT-V382Q mutants exhibit better selectivity for epoxide products and have potential applications in the heterologous synthesis of taxane epoxides. Attached Figure Description

[0027] Figure 1 In a preferred embodiment of the present invention, the TOT enzyme oxidizes the C4-C20 double bond of compound 1 to generate an oxa-four-membered ring product 1-dehydroxybaccatin IV (compound 2) and an epoxy compound baccatin I (compound 3).

[0028] Figure 2 In a preferred embodiment of the present invention, a TOT structure modeled by AlphaFold2 is used.

[0029]

[0030] Figure 9 In a preferred embodiment of the present invention, TOTV382A Density functional theory (DFT) calculations of an enzyme-free model of mutant-mediated oxidation.

[0031] Figure 10 A schematic diagram of the distance between amino acid residue 382 and the C5 acetyl carbonyl group in a preferred embodiment of the present invention.

[0032] Figure 11 The preferred embodiment of the present invention shows the ratio of oxetane product 2 and epoxide product 3 catalytically generated by different V382 mutants in tobacco. Detailed Implementation

[0033] This invention provides an oxidative reaction enzyme derived from yew trees, which is modified to improve its efficiency in synthesizing oxetane products using taxane substrates, providing theoretical support for achieving selective enhancement of its homologous proteins through rational modification.

[0034] The present invention adopts the following technical solution:

[0035] This invention provides a mutant of an oxetane cyclase and its application in the synthesis of compounds containing oxetane through the catalytic oxidation of taxane compounds.

[0036] The present invention also provides a mutant of oxadiazine cyclase and its application in catalyzing the oxidation of taxane compounds to generate compounds containing epoxides.

[0037] The present invention also provides a mutation site and method for improving the activity and selectivity of TOT and its homologous proteins.

[0038] This invention also provides a mutant of the oxadiazon synthase TOT, wherein the mutant contains the following mutation at position V382 in the amino acid sequence shown in SEQ ID NO:1:

[0039] 1) V382I;

[0040] 2) V382F;

[0041] 3) V382Q;

[0042] The proportion of oxetane products catalyzed by mutant No. 1 is significantly higher than that of the wild-type TOT. The proportion of epoxy products catalyzed by mutants No. 2 and No. 3 is significantly higher than that of the wild-type, and also higher than that of mutant V382A disclosed in CN117070480A.

[0043] The coding genes of the above-mentioned mutants fall within the scope of protection of this invention.

[0044] Furthermore, the biological material containing the encoding gene is an expression cassette, plasmid, vector, microorganism, insect cell, animal cell, or plant cell.

[0045] The present invention also provides the application of the above-mentioned mutants or their encoding genes or biological materials containing their encoding genes in catalytic oxidation reactions.

[0046] The present invention also provides the application of the above-mentioned mutants or their encoding genes or biological materials containing their encoding genes in the synthesis of oxy-containing heterocyclic butanes or epoxide products.

[0047] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0048] The following examples involve Southern Yew (Taxus chinensis) Taxus chinensis var. mairei The tobacco (from Fujian Province, China) was cultured in a growth chamber at 22°C with a photoperiod of 16 hours light / 8 hours dark. Nicotiana benthamiana They were grown in a greenhouse with a photocycle of 16 hours of light / 8 hours of darkness, at 25°C and 60% relative humidity.

[0049] The Taxus chinensis RNA extraction kit was the Plant RNA Kit (purchased from Omega). cDNA was prepared using the HiScript III 1st Strand cDNA Synthesis Kit (containing a gDNA wiper, purchased from Vazyme). The full-length TOT sequence was amplified from the cDNA using primers (synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd.) and inserted into the pEAQ-HT vector (digested with NruI-HF and XhoI-HF). The plasmid carrying the candidate gene was transformed into Agrobacterium using the freeze-thaw method. Agrobacterium tumafaciensGV3101 competent cells (purchased from Weidi). Substrate 1 (taxadiene-hexaol-hexaacetate) was synthesized according to the reference (Characterization and heterologous reconstitution of Taxus biosynthetic enzymes leading to baccatin III, Bin Jiang, Lei Gao, Haijun Wang, Yaping Sun, Xiaolin Zhang, Han Ke, Shengchao Liu, Pengchen Ma, Qinggang Liao, Yue Wang, Huan Wang, Yugeng Liu, Ran Du, Torben Rogge, Wei Li, Yi Shang, KN Houk, Xingyao Xiong, Daoxin Xie, Sanwen Huang, Xiaoguang Lei, Jianbin Yan, Science, 2024, 383, 622).

[0050] Example 1: Expression and Function Verification of the TOT Gene

[0051] 1. Extraction of total RNA from Taxus chinensis

[0052] Take about 100 grams of yew leaves and put them into a mortar. Add liquid nitrogen and grind them into powder. Then extract RNA according to the instructions of the Plant RNA Kit from Omega.

[0053] 2. Preparation of Taxus chinensis cDNA

[0054] The extracted total RNA was treated with DNAase at 37°C for half an hour, then purified using an RNA purification kit, and the recovery concentration was determined using nanodrop. cDNA was obtained by reverse synthesis using the HiScript III 1st Strand cDNA Synthesis Kit according to the manufacturer's instructions.

[0055] 3. Amplification of the TOT gene

[0056] The genome of *Taxus wallichiana* was analyzed to obtain the TOT sequence. The amino acid sequence and the nucleotide sequence of the reading frame of TOT are SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0057] Based on the nucleotide sequence of the TOT protein, primers were designed to amplify the target sequence from the cDNA of Taxus chinensis.

[0058] Upstream primer sequence pEAQ-TOT-F:

[0059] GTATATTCTGCCCAAATTCGCGAATGGTTCATGTGTTGCAGG

[0060] Downstream primer sequence pEAQ-TOT-R:

[0061] ACCAGAGTTAAAGGCCTCGAGTTAGGATCTGGGAGTAGGTTTTATTGAAAATC

[0062] PCR reaction system (50 μL):

[0063] Template cDNA 1 μL

[0064] 10 μM upstream primer 1.5 μL

[0065] 10 μM downstream primer 1.5 μL

[0066] 5×Transstart Fastpfu Buffer 10 μL

[0067] Transstart fastpfu DNA polymerase 1 μL

[0068] 10 mM dNTPs 4 μL

[0069] ddH2O 31 μL

[0070] PCR cycling conditions (50 μl system): 95℃ for 2 min; 98℃ for 30 s, 52℃ for 30 s, 72℃ for 1 min, for a total of 32 cycles; 72℃ for 5 min.

[0071] The PCR product was excised and recovered from the gel. Using the ClonExpress one-step cloning kit (Novizan), the product was recombinated and ligated with a linear pEAQ-HT vector digested with RruI and XhoI (see https: / / doi.org / 10.1111 / j.1467-7652.2009.00434.x, pEAQ-HT vector was kindly provided by Professor Liu Yule of Tsinghua University), and named pEAQ-HT-TOT.

[0072] 4. TOT enzyme activity test

[0073] The pEAQ-HT-TOT plasmid carrying the candidate gene was transformed into Agrobacterium tumefaciens GV3101 competent cells (Weidi) using a freeze-thaw method. The Agrobacterium cells containing the TOT gene were resuspended in MMA buffer (10 mM MES, pH 5.6, 10 mM magnesium chloride, 100 µM acetylsyl syringaldehyde) to achieve a specific optical density (OD). 600 The concentration reaches 1.0, after which the tobacco is infiltrated.

[0074] On the fourth day after bacterial infiltration, 5 μg of substrate 1 (dissolved in an aqueous solution containing 0.02% DMSO) was infiltrated into the leaves. After 24 hours of cultivation, the leaves were harvested, rapidly frozen, and the samples were extracted for LC-MS analysis. TOT can catalyze the production of oxetane product 2 and epoxide product 3 from taxadien-hexaacetate (substrate 1, i.e., compound 1). Figure 1 ).

[0075] LC-MS analysis of metabolites: Samples were analyzed by reversed-phase liquid chromatography on an ACQUITY UPLC® I-Class system using a 1.8 μm, 2.1 mm × 55 mm ACQUITY UPLC® HSS T3 column. The mobile phase was water (A) containing 0.1% formic acid and methanol (B) containing 0.1% formic acid, at a flow rate of 0.3 mL / min. The gradient elution method was as follows for 11 min: 0–1 min, 60% B; 1–9 min, 60%–92% B; 9–10 min, 92%–100% B; 10–10.2 min, 100%–60% B; 10.2–11 min, 60% B. The injection volume was 3 µL. For reversed-phase analysis, mass spectrometry data were collected in positive ion mode (ESI+) using a coupled VionWaters® Vion IMS Q-TOF (parameters: mass range 50–1000 m / z; capillary voltage 2.5 kV; dry gas temperature 280 °C, flow rate 800 L / h; protective gas flow rate 50 L / h; ion source temperature 120 °C; acquisition time 500 ms per spectrum). For tandem mass spectrometry (MS / MS) analysis, collision energies of 5, 15, 25, and 35 V were used. Data were collected and analyzed using UNIFI software (version 1.9.4.053).

[0076] Example 2: Elucidation of the TOT mechanism based on computational chemistry

[0077]

[0078] Example 3: TOT Mutation and Functional Verification

[0079]

[0080]

[0081] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. An oxetane synthase mutant characterized in that, The mutant only has a mutation from V to I at the 382th amino acid of the oxetane synthase; The amino acid sequence of the oxetane synthase is shown in SEQ ID NO:

1.

2. A gene encoding the mutant of claim 1.

3. Biomaterials containing the gene according to claim 2, characterized in that, The biological material is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, an engineered bacterium or a transgenic cell line, and the transgenic cell line is a non-plant cell.

4. Use of the mutant of claim 1, or the gene of claim 2 or the biological material of claim 3 in the synthesis of oxetane-containing compounds. The oxetane-containing compounds are oxetane tetramer products 1-dehydroxybaccatin IV and epoxide compounds baccatin I.

5. A method for synthesizing an oxygen-containing heterocyclic compound in vitro, characterized by, The oxetane-containing compounds are oxetane tetramer products 1-dehydroxybaccatin IV and epoxide compounds baccatin I. The substrate is taxadiene-hexol-hexaacetate; The method is not for the purpose of disease diagnosis and treatment. ​

Images