Ornithine decarboxylase mutant, genetically engineered bacteria expressing the same, and applications thereof

Abstract

The present invention belongs to the field of genetic engineering and enzyme engineering technology, and in particular to a kind of ornithine decarboxylase mutant and its encoding gene, expression vector, recombinant strain and application.The ornithine decarboxylase mutant is obtained by mutating the wild-type ornithine decarboxylase ODC10 with an amino acid sequence such as shown in SEQ ID NO.1, and the catalytic activity of the obtained mutant is improved, which helps to improve the biosynthesis efficiency of 1,4-diamine. The recombinant strain expressing the ornithine decarboxylase mutant constructed by the present invention can efficiently synthesize 1,4-diamine, and the molar conversion of ornithine is significantly improved, which is conducive to improving production efficiency and reducing production costs.

Description

Technical Field

[0001] The invention belongs to the technical fields of genetic engineering and enzyme engineering, and particularly relates to an ornithine decarboxylase mutant and its encoding gene, expression vector, recombinant strain and application. Background Art

[0002] 1,4-Butanediamine (1,4-butanediamine), also known as putrescine, has a wide range of applications and is valuable in medicine, agriculture, and industry. It can also be used in pharmaceuticals, surfactants, and crops. Furthermore, 1,4-Butanediamine can be condensed with adipic acid to form nylon-46. Nylon-46, due to its high-temperature resistance, high mechanical strength, and wear resistance, is widely used in the production of electronic and electrical components, automotive cooling systems, gears, and synthetic polyamide fibers. Current market demand for 1,4-Butanediamine is approximately 10,000 tons per year, with a price per ton exceeding €2,500 in Europe, and this is expected to continue to grow.

[0003] Large-scale industrial production of 1,4-butanediamine primarily relies on petrochemical-based chemical synthesis, but these processes require harsh reaction conditions and are harmful to both humans and the environment. Microbial fermentation, which can convert renewable raw materials into 1,4-butanediamine, offers numerous advantages, including environmental friendliness and sustainable development, making it an inevitable trend in the green production of 1,4-butanediamine.

[0004] One of the keys to efficiently accumulating 1,4-butanediamine (BDA) via microbial fermentation is to enhance the catalytic activity of key enzymes in the biosynthetic pathway. Ornithine decarboxylase (ODC), using pyridoxal phosphate as a cofactor, catalyzes the decarboxylation of ornithine to BDA, making it the rate-limiting enzyme in the BDA biosynthesis pathway. BDA is abundant in microorganisms, and researchers have isolated and cloned genes from various microorganisms, including Escherichia coli and lactic acid bacteria. However, the catalytic activity of native BDA is low, resulting in reduced BDA biosynthesis efficiency. Therefore, enhancing the catalytic activity of BDA is crucial. Summary of the Invention

[0005] To address the above issues, the present invention provides an ornithine decarboxylase mutant, its encoding gene, expression vector, recombinant strain, and application. The ornithine decarboxylase mutant has high catalytic activity and can improve the biosynthesis efficiency of 1,4-butanediamine. The recombinant strain expressing the ornithine decarboxylase mutant can efficiently catalyze the production of 1,4-butanediamine using a whole-cell method, and the molar conversion of ornithine is greatly improved, which has important positive significance for improving the utilization rate of ornithine and the efficiency of 1,4-butanediamine production.

[0006] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides an ornithine decarboxylase mutant, which is obtained by mutating the wild-type ornithine decarboxylase ODC10 whose amino acid sequence is shown in SEQ ID NO. 1, wherein the mutation comprises mutating the threonine (Thr, T) at position 209 to alanine (Ala, A), cysteine ​​(Cys, C), serine (Ser, S) or valine (Val, V).

[0008] Ornithine decarboxylase ODC10 (Gene ID: 58090974) was isolated from Staphylococcus lugdunensis ( Staphylococcus lugdunensis ) screened an ornithine decarboxylase with high catalytic activity, and its efficiency in catalyzing the synthesis of 1,4-butanediamine was 23.55 times that of the ornithine decarboxylase from Escherichia coli. The present invention further enhances its catalytic activity by performing the aforementioned mutations, facilitating the efficient catalytic synthesis of 1,4-butanediamine.

[0009] The ornithine decarboxylase mutant provided by the present invention is transformed into a host bacterium via an expression vector to obtain a recombinant strain expressing the mutant. The resulting recombinant strain can be used to catalyze the production of 1,4-butanediamine using ornithine as a substrate using a whole-cell method. Compared to a recombinant strain expressing ornithine decarboxylase ODC10, the recombinant strain expressing the mutant can significantly improve the biosynthesis efficiency of 1,4-butanediamine.

[0010] In the present invention, mutants are identified using the format of "original amino acid + position + substituted amino acid" to represent the mutated amino acid in the ornithine decarboxylase mutant. For example, T209A indicates that the amino acid at position 209 is substituted from threonine in the parent ornithine decarboxylase to alanine, and the position numbering corresponds to the amino acid sequence numbering in SEQ ID NO. 1.

[0011] Preferably, the amino acid sequence of the ornithine decarboxylase mutant is shown in SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6.

[0012] Preferably, the mutation comprises mutating the threonine at position 209 to alanine, cysteine ​​or valine. Compared with the ornithine decarboxylase mutant T209S and the wild-type ornithine decarboxylase ODC10, the ornithine decarboxylase mutants T209A, T209C and T209V have good temperature stability and pH stability.

[0013] Further preferably, the amino acid sequence of the ornithine decarboxylase mutant is shown as SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 6.

[0014] Preferably, the mutation comprises mutating threonine at position 209 to alanine or cysteine. Ornithine decarboxylase mutants T209A and T209C have higher temperature and pH stability than ornithine decarboxylase mutant T209V, and higher enzyme activity. The fermentation broth produced by the whole-cell method using recombinant strains expressing T209A or T209C to catalyze the synthesis of 1,4-butanediamine has higher 1,4-butanediamine yields and higher molar conversion rates of ornithine.

[0015] Further preferably, the amino acid sequence of the ornithine decarboxylase mutant is shown as SEQ ID NO. 3 or SEQ ID NO. 4.

[0016] Preferably, the mutation comprises mutating threonine at position 209 to alanine. Compared to ornithine decarboxylase mutants T209C and T209V, ornithine decarboxylase mutant T209A has better temperature stability and better pH stability in the pH range of 6.5-7.5, and the enzyme activity of the mutant is higher.

[0017] Further preferably, the amino acid sequence of the ornithine decarboxylase mutant is shown in SEQ ID NO.3.

[0018] Preferably, the mutation comprises mutating threonine at position 209 to cysteine. Compared to ornithine decarboxylase mutants T209A and T209V, the fermentation broth catalyzed by the recombinant strain expressing T209C for the synthesis of 1,4-butanediamine using the whole-cell method has higher 1,4-butanediamine yield and ornithine molar conversion rate.

[0019] Further preferably, the amino acid sequence of the ornithine decarboxylase mutant is shown in SEQ ID NO.4.

[0020] The second aspect of the present invention provides a gene encoding the above-mentioned ornithine decarboxylase mutant.

[0021] Those skilled in the art can obtain the desired nucleotide sequence by codon optimization according to actual needs. The present invention is not limited to the nucleotide sequence of the gene encoding the above-mentioned ornithine decarboxylase mutant. All genes that can encode the above-mentioned ornithine decarboxylase mutant are within the scope of protection of the present invention.

[0022] The third aspect of the present invention provides a recombinant plasmid comprising the above gene.

[0023] The present invention has no special requirements for the type of expression vector, and a common vector that can be expressed in strains such as Escherichia coli, Corynebacterium glutamicum or yeast can be selected. The construction method can adopt the method commonly used in the art, such as ligating the target gene into the vector after enzyme digestion. Exemplarily, the recombinant plasmid is selected from the pET series plasmids, pTRC99A plasmid, pWB600 plasmid, pXMJ19 plasmid, pHT1 plasmid, etc., and can also be a plasmid of a fungal expression system such as pJ912, pPIC9, pPIC9K, pPIC3.5K, pPICZalphaA, B, C, pYES2, pAUR123, pRS303TEF, pRS304, pRS305, pUG6, pSH47, pUC110, pPZP-HYG2, pPZP201, pFW22.1, pFC330, etc.

[0024] More preferably, the recombinant plasmid is pET22b plasmid.

[0025] The fourth aspect of the present invention provides a recombinant strain expressing the above-mentioned ornithine decarboxylase mutant.

[0026] Preferably, the host cells used by the recombinant strain include Escherichia coli, Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens, Corynebacterium glutamicum, Saccharomyces cerevisiae, Pichia pastoris, Yarrowia lipolytica and Hansenula spp.

[0027] The fifth aspect of the present invention provides the use of the above-mentioned ornithine decarboxylase mutant or its encoding gene, or an expression vector of its encoding gene, or a recombinant strain expressing the same in the preparation of 1,4-butanediamine.

[0028] The sixth aspect of the present invention provides a method for producing 1,4-butanediamine using an ornithine decarboxylase mutant as a catalyst, which specifically comprises the following operations: adding ornithine hydrochloride and the ornithine decarboxylase mutant to a buffer solution containing pyridoxal phosphate, reacting at 32-42°C, inactivating the enzyme after the reaction, and obtaining the 1,4-butanediamine in the resulting reaction solution.

[0029] Preferably, the buffer containing pyridoxal phosphate comprises the following components: 1 mM ethylenediaminetetraacetic acid (EDTA), 25 mM dithiothreitol (DTT), 1 mM pyridoxal phosphate (PLP), 1% Tween-80, and the solvent is 10 mM Tris-HCl at pH 7.5.

[0030] A seventh aspect of the present invention provides a method for producing 1,4-butanediamine by whole cell catalysis, which specifically comprises the following operations:

[0031] The recombinant strain is cultured and activated, and then inoculated into a fermentation medium containing pyridoxal phosphate. When the OD value is 0.7-0.9, isopropyl-β-D-thiogalactopyranoside (IPTG) is added to induce expression. Then, ornithine hydrochloride is added for fermentation, and the 1,4-butanediamine is obtained in the resulting fermentation broth.

[0032] This method has no particular limitation on the culture medium for culturing the activated recombinant strain, and the culture medium conventionally used in the art can be used.

[0033] Preferably, the final concentration of the isopropyl-β-D-thiogalactoside added to the fermentation medium is 0.1 mmol / L; and the conditions for inducing expression are: induction culture at 37±1°C for 6±1 h.

[0034] Preferably, the final concentration of the ornithine hydrochloride added to the fermentation medium is 10 g / L.

[0035] Preferably, the fermentation temperature is 37±1°C.

[0036] Preferably, the fermentation medium comprises: 8 g / L ammonium sulfate ((NH4)2SO4), 2 g / L potassium dihydrogen phosphate (KH2PO4), 2 g / L magnesium sulfate heptahydrate (MgSO4·7H2O), 2.5 g / L yeast extract, 0.02 mg / L vitamin B 12 (VB 12 ), 40 g / L 3-morpholinepropanesulfonic acid (MOPS), 2 mg / L pyridoxal phosphate and 5 mL / L trace element mixture.

[0037] The present invention has the beneficial effects of obtaining ornithine decarboxylase mutants with further enhanced catalytic activity by mutating an ornithine decarboxylase ODC10 with high catalytic activity from Staphylococcus lugdunensis. Compared to wild-type ornithine decarboxylase ODC10, the ornithine decarboxylase mutants T209A, T209C, T209V, and T209S provided by the present invention have increased specific activities by 37.39%, 19.92%, 0.91%, and 2.04%, respectively, and are capable of efficiently catalyzing the production of 1,4-butanediamine. Recombinant strains expressing the ornithine decarboxylase mutants can be obtained by transferring the ornithine decarboxylase mutants into host cells via expression plasmids. Compared with the strain expressing wild-type ornithine decarboxylase ODC10, the recombinant strains expressing ornithine decarboxylase mutants T209A, T209C, T209V, and T209S increased the 1,4-butanediamine yields by 146.39%, 167.41%, 109.62%, and 54.39%, respectively, in the fermentation broth of 1,4-butanediamine produced by whole-cell catalysis using ornithine hydrochloride as a substrate, and the molar conversion rates reached 91.21%, 97.3%, 90.98%, and 90.03%, respectively, which has important positive significance for improving the utilization of ornithine and the efficiency of 1,4-butanediamine production. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a HPLC test chart of 1,4-butanediamine standard in an embodiment of the present invention;

[0039] Figure 2 This is a HPLC test chart of ornithine hydrochloride standard in the embodiment of the present invention;

[0040] Figure 3 is the yield of 1,4-butanediamine in the fermentation broth of the recombinant strain expressing different ornithine decarboxylase mutants in Example 2 of the present invention;

[0041] Figure 4 This is the SDS-PAGE analysis of the wild-type ornithine decarboxylase and its mutants in Example 3 of the present invention;

[0042] Figure 5 is the optimum temperature of the wild-type ornithine decarboxylase and its mutants in Example 5 of the present invention;

[0043] Figure 6 The temperature stability of the wild-type ornithine decarboxylase and its mutants in Example 5 of the present invention;

[0044] Figure 7 is the optimal pH value of the wild-type ornithine decarboxylase and its mutants in Example 6 of the present invention;

[0045] Figure 8The pH stability of the wild-type ornithine decarboxylase and its mutants in Example 6 of the present invention;

[0046] Figure 9 These are the shake flask fermentation results of Example 7 of the present invention for biotransformation synthesis of 1,4-butanediamine by the recombinant strain expressing wild-type ornithine decarboxylase and its mutants. DETAILED DESCRIPTION

[0047] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0048] At present, the catalytic activity of ornithine decarboxylase in the production of 1,4-butanediamine by microbial fermentation is low, resulting in high production costs and low strain performance.

[0049] To address this issue, the present invention presents ornithine decarboxylase mutants T209A, T209C, T209S, and T209V, obtained by random and saturation mutagenesis of the highly catalytically active ornithine decarboxylase ODC10 isolated from Staphylococcus lugdunensis. These mutants exhibit significantly enhanced catalytic activity compared to wild-type ornithine decarboxylase ODC10, enabling higher yields of 1,4-butanediamine produced using a whole-cell catalytic method using recombinant strains expressing these mutants. Furthermore, T209A, T209C, and T209V exhibit excellent temperature and pH stability, with T209A and T209C exhibiting superior temperature and pH stability and higher enzyme activity. T209A exhibits the best temperature, pH, and enzyme activity.

[0050] The present invention also provides a gene encoding the mutant.

[0051] The embodiments of the present invention also provide a recombinant plasmid containing the above gene and a construction method thereof.

[0052] The embodiments of the present invention also provide a recombinant strain expressing the mutant and a method for constructing the same.

[0053] The embodiment of the present invention also provides a method for producing 1,4-butanediamine by catalysis using an ornithine decarboxylase mutant.

[0054] The embodiment of the present invention also provides the use of the above recombinant strain in whole-cell catalytic production of 1,4-butanediamine.

[0055] The solutions of the present invention are described below through specific embodiments.

[0056] In the following examples, the mutants are identified using the format of "original amino acid + position + replaced amino acid" to indicate the mutated amino acid in the ornithine decarboxylase mutant. For example, T209A indicates that the amino acid at position 209 is replaced by alanine (Ala) instead of threonine (Thr) in the parent ornithine decarboxylase. The position numbering corresponds to the amino acid sequence numbering of ornithine decarboxylase in SEQ ID NO: 1.

[0057] The following examples analyzed the concentration of 1,4-butanediamine in the product and substrate in the reaction solution by high-performance liquid chromatography (HPLC). The HPLC analysis method was as follows: Column model: Agilent AAA, Mobile phase A: 10 mM Na2B4O7 and 10 mM Na2HPO4 (pH = 8.2), Mobile phase B: Methanol: Acetonitrile: Water = 45:45:10, Detection wavelength: 338 nm, Flow rate: 1.0 mL / min, Column temperature: 40°C. The peaks of the product (standard 1,4-butanediamine) and substrate (standard ornithine) are as follows: Figure 1 and Figure 2 shown.

[0058] ODC-PLP storage solution: contains 1 mM EDTA, 25 mM DTT, 1 mM PLP, 1% Tween-80, and the solvent is 10 mM Tris-HCl, pH=7.5.

[0059] Unless otherwise specified, the techniques used in the following examples are conventional techniques well known to those skilled in the art. The materials and reagents used in the following examples are all commercially available. The E. coli BL21 strain and the pET22b plasmid are both commercially available plasmids.

[0060] Example 1

[0061] This example provides a recombinant strain expressing the ornithine decarboxylase mutant T209A and its acquisition process.

[0062] The wild-type ornithine decarboxylase ODC10 gene with the nucleotide sequence shown in SEQ ID NO. 2 was amplified from the plasmid pET22b-ODC10 by error-prone PCR using primers SF (sequence shown in SEQ ID NO. 7) and SR (sequence shown in SEQ ID NO. 8). 2 μL of 25 mM MnCl2 was added to the total 50 μL reaction system to obtain the ODC10 target gene fragment containing the mutation site.

[0063] SF: AGAAGGAGATATACATATGAAATTTCTGAAAGTTGCAAGCAG;

[0064] SR: TGGTGGTGGTGGTGCTCGAGGCTCTCCAGAACATAAC.

[0065] PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C at 2 kb / min for 30 cycles; followed by extension at 72°C for 10 min. After purification, the PCR product was cloned into pET22b between the NdeI and XhoI sites using seamless cloning technology and transformed into BL21 competent cells to construct a random library of ornithine decarboxylase mutants. The random mutant library was initially screened in 96-well plates using the DSMI-CB6 assay. DSMI is a fluorescent dye that binds to the macrocyclic receptor cucurbituril (CB6) in appropriate amounts, producing a fluorescent signal. During the reaction, putrescine, the product of the ODC enzymatic reaction, has a higher affinity for CB6 and thus competitively displaces DSMI bound to CB6, resulting in a decrease in the fluorescent signal. Strains with significantly reduced fluorescence signals from the initial screening were inoculated into shake flasks for rescreening. The fermentation broth was assayed for 1,4-butanediamine production, resulting in the identification of the recombinant strain ODC10-①, which exhibited increased 1,4-butanediamine production by 146.39%. The ornithine decarboxylase mutant T209A in this recombinant strain was constructed by mutating the threonine at position 209 of the wild-type ornithine decarboxylase enzyme (SEQ ID NO. 1) to alanine. The amino acid sequence of this ornithine decarboxylase mutant T209A is shown in SEQ ID NO. 3.

[0066] Example 2

[0067] This example provides recombinant strains expressing ornithine decarboxylase mutants T209C, T209V, and T209S and the process for obtaining the same.

[0068] The mutation site of the ornithine decarboxylase mutant T209A obtained in Example 1 was subjected to site-directed saturation mutagenesis by overlapping PCR. Primers F1 (sequence shown in SEQ ID NO. 9), F2 (sequence shown in SEQ ID NO. 10), R1 (sequence shown in SEQ ID NO. 11), and R2 (sequence shown in SEQ ID NO. 12) were designed. The gene of the ornithine decarboxylase mutant T209A was used as a template, and the upstream fragment of the target gene was amplified using F1 and R2 as primers, while the downstream fragment was amplified using R1 and F2 as primers. The mutant gene fragment was amplified in large quantities using the above downstream fragments as templates and F1 and F2 as primers. The purified mutant gene fragment was ligated to the pET22b vector digested with XhoI and NdeI using seamless cloning enzyme to construct the mutant gene expression vectors pET22b-ODC10-② to pET22b-ODC10-⑲, and the accuracy of the mutant was verified by sequencing. The above expression vector was transformed into Escherichia coli BL21 strain to obtain 18 different ornithine decarboxylase mutant recombinant strains: ODC10-② to ODC10-⑲. The mutants expressed by each recombinant strain are shown in Table 1.

[0069] Table 1 Mutant identifiers corresponding to mutants ODC10-①~ODC10-⑲

[0070]

[0071] Single colonies of wild-type ornithine decarboxylase ODC10 and all constructed ornithine decarboxylase mutant recombinant strains were inoculated into 5 mL of LB liquid medium and cultured overnight at 37°C and 220 rpm to prepare seed liquid. Then, 500 μL of the seed liquid was transferred to a 250 mL flask containing 25 mL of LB medium at a 2% inoculation ratio and shake-flask fermentation was performed at 37°C and 220 rpm. The yield of 1,4-butanediamine in the 24-h shake-flask fermentation broth of the recombinant strains ODC10-② to ODC10-⑲ was shown in Figure 2. Figure 3 As shown, compared with the strain expressing wild-type ornithine decarboxylase ODC10, the production of 1,4-butanediamine in the fermentation broth of the recombinant strains ODC10-② to ODC10-④ expressing ornithine decarboxylase mutants T209C, T209V and T209S was significantly increased by 53.76%, 26.28% and 28.9%, respectively.

[0072] F1: AGAAGGAGATATACATATGAAATTTCTGAAAGTTGCAAGCAG;

[0073] R2: AATTGCGCTGGTAATAATAATATTATTGCTGGT;

[0074] R1: ACCAGCAATAATATTATTATTACCAGCGCAATT;

[0075] F2: TGGTGGTGGTGGTGCTCGAGGCTCTCCAGAACATAAC.

[0076] Example 3

[0077] This example provides a method for expressing and purifying ornithine decarboxylase and its mutants.

[0078] Strain ODC10 expressing wild-type ornithine decarboxylase (ODC10) and recombinant strains ODC10-① to ODC10-④ expressing ornithine decarboxylase mutants T209A, T209C, T209V, and T209S were inoculated into liquid LB medium and induced at 37°C for 12 hours. After incubation, the fermentation broth was poured into a centrifuge cup and centrifuged at 4000 rpm for 10 minutes. The supernatant was discarded and the cells were harvested. The cells were washed twice with 20-25 mL of lysis buffer (pH 7.5) and resuspended. The cells were then ultrasonically disrupted: 2 seconds on, 3 seconds off, and 30 minutes on. The supernatant was then centrifuged at 4000 rpm for 30 minutes at 4°C to obtain the crude enzyme solution containing the ornithine decarboxylase mutants. The supernatant, Ni ion resin, and rotor were placed in a beaker, covered with plastic wrap, and allowed to combine on a magnetic stirrer at 4°C for 1 hour. Transfer all bound samples to the gravity column in a 4°C chromatography cabinet, and wash the gravity column three times with 5 mL of wash buffer containing 20 mM imidazole to elute impurities. Wash three times with 5 mL of elution buffer containing 200 mM imidazole to obtain the target protein eluate. Collect the purified enzyme solution in an ultrafiltration tube with a membrane pore diameter of 10 kDa and replace it with lysis buffer until 1 mL of liquid remains. Use sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) to analyze the purity of the target protein. The target protein reaches electrophoretic purity, such as Figure 4 As shown ( Figure 4 In the figure, 1 is the wild-type ornithine decarboxylase ODC10, 2 is the mutant T209A, 3 is the mutant T209S, 4 is the mutant T209V, 5 is the mutant T209C, and M is the Protein Marker).

[0079] The target protein concentration was determined using an ultramicrospectrophotometer NanoDrop 2000. The enzyme concentrations of wild-type ornithine decarboxylase ODC10 and ornithine decarboxylase mutants T209A, T209C, T209V, and T209S were 1.0 mg / mL, 1.5 mg / mL, 3.2 mg / mL, 2 mg / mL, and 1.2 mg / mL, respectively.

[0080] Example 4

[0081] This example measured the specific activities of wild-type ornithine decarboxylase ODC10 and its mutants.

[0082] Because ornithine decarboxylase is a pyridoxal phosphate-dependent decarboxylase, a specific reaction buffer is required: ODC-PLP stock solution. On ice, add 800 µL of ODC-PLP stock solution (pH 7.5) to a 1.5 mL EP tube. Simultaneously, add 50 µL of ornithine hydrochloride solution to a final concentration of 2 g / L. Add 50 µL of the ultrafiltered enzyme solution (obtained in Example 3) to the reaction system. The reaction mixture is incubated in a 37°C water bath for 60 min. Immediately after completion, the reaction is boiled for 5 min. All data sets are run in triplicate. Subsequently, the solution is centrifuged at 13,000 rpm for 5 min. The supernatant is collected for derivatization and 1,4-butanediamine content is determined by HPLC.

[0083] Enzyme activity definition: One activity unit (U) is the amount of enzyme required to produce 1 μmol of 1,4-butanediamine per minute at 37°C and pH 7.5. The specific activity of each ornithine decarboxylase was calculated by dividing the measured enzyme activity by the enzyme mass. Specific activity is expressed in U / mg protein. The results are shown in Table 2. The specific activity of wild-type ornithine decarboxylase ODC10 was 464.75 U / mg, the specific activity of ornithine decarboxylase mutant T209A was 638.50 U / mg, the specific activity of ornithine decarboxylase mutant T209C was 557.34 U / mg, the specific activity of ornithine decarboxylase mutant T209V was 468.96 U / mg, and the specific activity of ornithine decarboxylase mutant T209S was 474.25 U / mg. The ornithine decarboxylase mutant T209A had the highest specific activity, which was 37.39% higher than that of the wild-type ornithine decarboxylase ODC10.

[0084] Table 2 Specific activities of wild-type ornithine decarboxylase and its mutants

[0085]

[0086] Example 5

[0087] This example determined the optimal temperature and temperature stability of wild-type ornithine decarboxylase ODC10 and its mutants.

[0088] 50 μL of ultrafiltered enzyme solution (obtained in Example 3) was added to the ODC-PLP stock solution at pH 7.5. The reaction tubes were equilibrated at different temperatures (22, 27, 32, 37, and 42°C) for 10 min. 50 μL of ornithine hydrochloride solution (final concentration 2 g / L) was added to initiate the reaction. The reaction was continued for 60 min. After completion of the reaction, the tubes were immediately boiled for 5 min. The 1,4-butanediamine content was determined by HPLC, and the specific activity of ornithine decarboxylase and its mutants was calculated to obtain the optimal temperature of ornithine decarboxylase and its mutants. The results are shown in Figure 2. Figure 5 shown.

[0089] Take 50 μL of the ultrafiltered enzyme solution (obtained in Example 3) and place it in a water bath at different temperatures (27, 32, 37, and 42°C) and keep warm for 8 hours (the sample was immediately taken out and placed on ice after the reaction time). Under the conditions of the optimal reaction temperature of 37°C and the optimal reaction pH = 7.5, ornithine hydrochloride solution and ODC-PLP storage solution (pH = 7.5) were added to react for 60 minutes, and the ornithine decarboxylase activity of all samples was detected. The highest enzyme activity was defined as 100%, and the enzyme activities measured under different conditions were compared with it to calculate the relative enzyme activity. The temperature stability of ornithine decarboxylase and its mutants was obtained by plotting. The results are shown in Figure 2. Figure 6 shown.

[0090] The detection of optimal temperature and temperature stability showed that the optimal reaction temperature of the recombinant strains expressing ornithine decarboxylase mutants T209A, T209C, T209V and T209S was 37°C, and these mutants had good temperature stability. After being placed at 27°C for 8 h, the enzyme activity of T209S decreased to about 95%, while the enzyme activities of the other mutants remained above 97%; after being placed at 32°C for 8 h, the enzyme activities of the wild-type ornithine decarboxylase ODC10 and the mutants remained above 92%; after being placed at 37°C for 8 h, the enzyme activity of T209S decreased to 88%, which was lower than the enzyme activity of the wild-type ornithine decarboxylase, while the enzyme activities of the other mutants remained above 90% and higher than the enzyme activity of the wild-type ornithine decarboxylase ODC10; after being placed at 42°C for 8 h, the enzyme activity of T209S decreased to 83%, and the enzyme activities of the other mutants decreased to about 90%, but were significantly higher than the enzyme activity of the wild-type ornithine decarboxylase ODC10. From the above results, it can be seen that at temperatures of 37°C and 42°C, the mutant T209S is not as stable as the wild-type ornithine decarboxylase ODC10, while the mutants T209A, T209C, and T209V have higher temperature stability than the wild-type ornithine decarboxylase ODC10.

[0091] Example 6

[0092] This example determines the optimal pH and pH stability of wild-type ornithine decarboxylase and its mutants.

[0093] Prepare 10 mM Tris-HCl with different pH values ​​(6.5, 7.0, 7.5, 8.0, 8.5), and then use it to prepare ODC-PLP storage solutions with different pH values. Take 50 μL of the ultrafiltered enzyme solution (obtained in Example 3) and add it to the ODC-PLP storage solutions with different pH values ​​(6.5, 7.0, 7.5, 8.0, 8.5), respectively. At the same time, add 50 μL of ornithine hydrochloride solution (final concentration 2 g / L) to start the reaction. Place the mixture in a 37°C water bath for 60 min. After the reaction, immediately boil it for 5 min. The 1,4-butanediamine content is detected by HPLC. The specific activity of ornithine decarboxylase and its mutants is calculated to obtain the optimal pH value of ornithine decarboxylase and its mutants. The results are shown in Figure 2. Figure 7 shown.

[0094] The ultrafiltered enzyme solution (obtained in Example 3) was diluted to an appropriate concentration using lysis buffers of different pH values ​​(6.5, 7, 7.5, and 8), and dispensed into 1.5EP tubes. The tubes were then placed in a 37°C water bath for 8 hours (the samples were immediately removed and placed on ice after the reaction). Under the optimal reaction temperature of 37°C and the optimal reaction pH of 7.5, ornithine hydrochloride solution and ODC-PLP storage solution (pH = 7.5) were added and reacted for 60 minutes. The ornithine decarboxylase activity of all samples was then tested. The results are shown in Figure 2. Figure 8 shown.

[0095] The test of optimum pH and pH stability showed that the optimum reaction pH of each recombinant strain was 7.5. After being placed at pH = 6.5 for 8 h, the enzyme activity of mutant T209S decreased to 80%, while the enzyme activities of mutants T209A and T209C remained at around 90%. h later, except for mutant T209S, the enzyme activities of wild-type ornithine decarboxylase ODC10 and other mutants remained above 85%, and mutants T209A and T209C had the highest enzyme activities; after being placed under pH=7.5 conditions for 8 h, the enzyme activity of mutant T209S decreased to about 90%, and mutant T209A had the highest enzyme activity; after being placed under pH=8.0 conditions for 8 h, the enzyme activities of mutants T209S and mutant T209V decreased to about 75%, the enzyme activities of wild-type ornithine decarboxylase ODC10 and mutant T209A decreased to about 80%, and T209C had the highest enzyme activity. The above results show that within the pH range of 6.5-7.5, the wild-type ornithine decarboxylase ODC10 and mutants T209V and T209S all have enzyme activities above 80%, and mutants T209A and T209C have enzyme activities above 87%, indicating that the mutants and wild-type ornithine decarboxylase ODC10 all have high pH stability.

[0096] Example 7

[0097] This example measured the conversion rate of ornithine to 1,4-butanediamine catalyzed by recombinant strains expressing wild-type ornithine decarboxylase and its mutants.

[0098] After activation, strains expressing wild-type ornithine decarboxylase ODC10 and recombinant strains expressing mutants T209A, T209C, T209V, and T209S were selected and inoculated into 5 ml of liquid LB medium containing 100 μg / mL ampicillin. The culture was shaken at 220 rpm and 37°C for 12-16 hours (to reach the logarithmic growth phase) to obtain seed liquid. The seed liquid was inoculated at a 2% inoculum into fresh liquid fermentation medium containing the same concentration of resistance (fermentation medium containing: 8 g / L (NH4)2SO4, 2 g / L KH2PO4, 2 g / L MgSO4·7H2O, 2.5 g / L yeast extract, 0.02 mg / L VB 12, 40g / L MOPS, 2mg / L PLP and 5mL trace element mixture, ammonia water adjusted to pH 7.0). When the OD value was about 0.8, IPTG (isopropyl-β-D-thiogalactopyranoside) was added to a final concentration of 0.1 mmol / L. After induction culture at 37℃ for 6 hours, ornithine hydrochloride with a final concentration of 10 g / L was added as a substrate. After continued culture for 24 hours, 1mL of fermentation broth was taken into a 1.5mL EP tube and centrifuged at 12000 rpm for 5 minutes. The supernatant was collected and diluted to a certain multiple and the content of 1,4-butanediamine in the fermentation broth was detected by HPLC. The results are shown in Figure 2. Figure 9 As shown, the 1,4-butanediamine production in the fermentation broth of the strain expressing the wild-type ornithine decarboxylase ODC10 was 2090.50 mg / mL, and the 1,4-butanediamine production in the fermentation broth of the recombinant strains expressing the mutants T209A, T209C, T209V and T209S was 5150.79 mg / mL, 5590.20 mg / mL, 4382.06 mg / mL, 3227.52 mg / mL, compared with the strain expressing the wild-type ornithine decarboxylase ODC10, the 1,4-butanediamine production increased by 146.39%, 167.41%, 109.62% and 54.39%, respectively, and the molar conversion rates reached 91.21%, 97.3%, 90.98% and 90.03%, respectively, which were 90%, 102.7%, 89.5% and 87.6% higher than the ornithine molar conversion rate of 48% of the strain expressing ODC10.

[0099] Molar conversion = moles of product / moles of substrate × 100%.

[0100] Example 8

[0101] This example provides an ornithine decarboxylase mutant T209A, whose amino acid sequence is shown in SEQ ID NO. 3.

[0102] The ornithine decarboxylase mutant T209A provided in this example was directly synthesized by a biosynthetic method.

[0103] Example 9

[0104] This example provides an ornithine decarboxylase mutant T209C, whose amino acid sequence is shown in SEQ ID NO. 4.

[0105] The ornithine decarboxylase mutant T209C provided in this example was directly synthesized by a biosynthetic method.

[0106] Example 10

[0107] This example provides an ornithine decarboxylase mutant T209S, whose amino acid sequence is shown in SEQ ID NO. 5.

[0108] The ornithine decarboxylase mutant T209S provided in this example was directly synthesized by a biosynthetic method.

[0109] Example 11

[0110] This example provides an ornithine decarboxylase mutant T209V, whose amino acid sequence is shown in SEQ ID NO.6.

[0111] The ornithine decarboxylase mutant T209V provided in this example was directly synthesized by a biosynthetic method.

[0112] Example 12

[0113] This example provides a recombinant plasmid containing a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 3 and a method for constructing the same, as well as a recombinant strain expressing the ornithine decarboxylase mutant T209A and a method for constructing the same.

[0114] 1. Construction of recombinant plasmid pET22b-ODC10-T209A

[0115] A nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 3 was directly synthesized by synthetic biology and ligated into the pET22b vector digested with XhoI and NdeI using a seamless cloning enzyme to obtain the recombinant plasmid pET22b-ODC10-T209A.

[0116] 2. Construction of a recombinant strain expressing the ornithine decarboxylase mutant T209A

[0117] The correctly sequenced pET22b-ODC10-T209A plasmid solution was added to competent E. coli BL21 cells, incubated on ice for 10 minutes, then heat-shocked in a 42°C water bath for 90 seconds. Immediately, the cells were incubated on ice for 2 minutes. Afterwards, LB medium without antibiotics was added and the cells were shaken at 37°C and 220 rpm for 1 hour. At the end of the incubation period, the cells were centrifuged at 4°C and 4800 rpm for 5 minutes. The supernatant was aspirated, and the resuspended cells were spread onto LB plates containing Amp-resistant strains. The plates were then incubated in an inverted 37°C incubator for 12 hours. After identification, a recombinant strain expressing the ornithine decarboxylase mutant T209A was obtained.

[0118] According to the construction method of this embodiment, recombinant plasmids containing nucleotide sequences encoding amino acid sequences shown in SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, as well as recombinant strains expressing ornithine decarboxylase mutants T209C, T209S, and T209V can also be obtained.

[0119] Example 13

[0120] This example provides the use of the recombinant strain in Example 12 in the whole-cell catalytic production of 1,4-butanediamine.

[0121] After activation of the recombinant strain expressing mutants T209A, T209C, T209V, or T209S described in Example 12, a single colony was inoculated into 5 ml of liquid LB medium containing 100 μg / mL ampicillin and cultured in a shaker at 220 rpm and 37°C for 12-16 hours to obtain a seed solution. A 2% inoculum of the seed solution was inoculated into fresh liquid fermentation medium containing the same concentration of resistance (each liter of fermentation medium contained: 8 g (NH4)2SO4, 2 g KH2PO4, 2 g MgSO4·7H2O, 2.5 g yeast extract, 0.02 mg VB4). 12 , 40g MOPS, 2mg PLP, and 5mL of a trace element mixture (adjust pH to 7.0 with ammonia). When the OD value is around 0.8, IPTG is added to a final concentration of 0.1 mmol / L. After induction culture at 37°C for 6 hours, ornithine hydrochloride is added as a substrate at a final concentration of 10 g / L to catalyze the production of 1,4-butanediamine.

[0122] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An ornithine decarboxylase mutant, characterized in that The mutant is obtained by mutating the wild-type ornithine decarboxylase ODC10 whose amino acid sequence is shown in SEQ ID NO.1, wherein the mutation is to mutate the threonine at position 209 to alanine, cysteine, serine or valine.

2. The ornithine decarboxylase mutant according to claim 1, wherein The amino acid sequence of the ornithine decarboxylase mutant is shown in SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO.

6.

3. The ornithine decarboxylase mutant according to claim 1 or 2, characterized in that The mutation is to mutate the threonine at position 209 to alanine, cysteine ​​or valine.

4. The ornithine decarboxylase mutant according to claim 3, characterized in that The mutation is to mutate the threonine at position 209 to alanine or cysteine.

5. A gene encoding the ornithine decarboxylase mutant according to any one of claims 1 to 4.

6. A recombinant plasmid containing the gene according to claim 5.

7. A recombinant strain expressing the ornithine decarboxylase mutant according to claim 1.

8. Use of the ornithine decarboxylase mutant according to claim 1 or its encoding gene, or an expression vector of its encoding gene, or a recombinant strain expressing the same in the preparation of 1,4-butanediamine.

9. A method for producing 1,4-butanediamine by catalyzing an ornithine decarboxylase mutant, characterized in that: Specifically, the process comprises the following steps: adding ornithine hydrochloride and the ornithine decarboxylase mutant according to claim 1 to a buffer solution containing pyridoxal phosphate, reacting at 32-42° C., inactivating the enzyme after the reaction, and obtaining the 1,4-butanediamine in the resulting reaction solution.

10. A method for producing 1,4-butanediamine by whole cell catalysis, characterized in that: The specific operations include: The recombinant strain according to claim 7 is cultured and activated and then inoculated into a fermentation medium containing pyridoxal phosphate. When the OD value is 0.7-0.9, isopropyl-β-D-thiogalactoside is added to induce expression, and then ornithine hydrochloride is added for fermentation. The 1,4-butanediamine is obtained in the resulting fermentation broth.

Images