RNAi agents for inhibiting alpha-ENaC expression and methods of use

Abstract

The invention relates to RNAi agents for inhibiting expression of alpha-ENaC and methods of use. RNAi agents, compositions comprising the RNAi agents, and methods for inhibiting the alpha-ENaC (SCNN1A) gene are described. The alpha-ENaC RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of the alpha-ENaC gene. Also described are pharmaceutical compositions comprising one or more alpha-ENaC RNAi agents, optionally together with one or more additional therapeutic agents. Delivery of the alpha-ENaC RNAi agents in vivo to epithelial cells, such as pulmonary epithelial cells, provides inhibition of alpha-ENaC gene expression and reduction of ENaC activity, which can provide therapeutic benefits to subjects, including human subjects.

Description

[0001] This application is a divisional application of an invention application filed on July 5, 2018, with Chinese national application number 201880045293.1, and invention name “RNAi agents and methods of use for inhibiting α-ENaC expression”. Technical Field

[0002] The present disclosure relates to RNA interference (RNAi) agents, such as double-stranded RNAi agents, for inhibiting α-ENaC gene expression, compositions comprising α-ENaC RNAi agents, and methods of using the same. Background Art

[0003] The vertebrate amiloride-sensitive epithelial sodium channel ("ENaC" or "amiloride-sensitive sodium channel") is a member of the degenerate protein / ENaC channel superfamily, characterized by two transmembrane domains, intracellular N- and C-termini, and a large extracellular loop that is a substrate for furin. The channel is a heterotrimeric complex composed of three homologous subunits (α, β, and γ) encoded by three separate genes, SCNN1A (α), SCNN1B (β), and SCNN1G (γ). All three subunits are required for full channel activity. The fourth subunit (δ), encoded by SCNN1D, is expressed in the testis and ovary and may functionally replace the α subunit in these tissues.

[0004] ENaC is expressed on the apical membrane of epithelial cells, particularly in the lungs, distal convoluted tubules of the kidney, gastrointestinal (GI) tract, reproductive tract, and ocular surface epithelium of the eye. In these epithelia, ENaC channels mediate the influx of extracellular sodium ions, which are then actively transported from the cell by basolateral sodium / potassium ATPases, establishing an osmotic gradient and leading to the absorption of epithelial luminal water into the interstitium. In the kidneys, ENaC mediates electrolyte balance and blood pressure, and is a target for systemic small molecule diuretics such as amiloride. In the lungs, airway epithelial ENaC plays a key role in regulating lung hydration and mucociliary clearance.

[0005] Patients with pseudohypoaldosteronism (PHA) type 1 who carry loss-of-function mutations in SCNN1A, SCNN1B, or SCNN1G produce excess airway surface fluid and have significantly higher mucociliary clearance. Conversely, airway epithelial ENaC activity is significantly elevated in patients with cystic fibrosis (CF) of all genotypes. Enhanced ENaC activity, along with reduced activity of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, is the primary pathogenic mechanism underlying airway dehydration and mucociliary stasis in patients with CF lung disease.

[0006] Inhaled small molecule ENaC inhibitors have shown initial promise in the treatment of CF, but their clinical development is limited by short duration of action in the lungs and on-target toxicity (hyperkalemia) associated with inhibition of renal ENaC (see, e.g., O'Riordan et al., 27 J. Aerosol Med. & Pulmonary Drug Dev., 200-208 (2014)).

[0007] Certain RNAi agents capable of inhibiting the expression of the α-ENaC gene (i.e., SCNN1A) have been previously identified, such as those disclosed in, for example, U.S. Patent No. 7718632. However, the sequences and modifications of the α-ENaC RNAi agents disclosed herein are different from those previously disclosed or known in the art. The α-ENaC RNAi agents disclosed herein provide highly efficient and effective inhibition of α-ENaC gene expression. Summary of the invention

[0008] New RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers or triggers), such as double-stranded RNAi agents, are needed that can selectively and effectively inhibit the expression of the α-ENaC gene (i.e., SCNN1A). Further, new α-ENaC-specific RNAi agent compositions are needed for treating diseases associated with increased ENaC activity.

[0009] In general, the disclosure features α-ENaC gene-specific RNAi agents, compositions comprising α-ENaC RNAi agents, and methods of using α-ENaC RNAi agents and compositions comprising α-ENaC RNAi agents described herein to inhibit α-ENaC gene expression in vitro and / or in vivo. The α-ENaC RNAi agents described herein are capable of selectively and effectively reducing the expression of the α-ENaC gene, thereby reducing the ENaC level in a subject, reducing the ENaC activity in a subject, or reducing both the ENaC level and the ENaC activity in a subject (e.g., a human or animal subject).

[0010] The α-ENaC RNAi agents can be used in therapeutic treatment (including prophylactic or preventive treatment) methods for symptoms and diseases associated with increased or elevated levels of ENaC activity, including (but not limited to) various respiratory diseases, such as cystic fibrosis, chronic bronchitis, chronic obstructive pulmonary disease (COPD), asthma, respiratory infections, primary ciliary dyskinesia, and lung cancer cystic fibrosis. For example, in subjects with cystic fibrosis (CF), it is known that increased ENaC activity contributes to drying of mucus in the airways and reduces the ability of the lungs to clear toxins and infectious agents. Further, it is also known that CF subjects who have inherited a poorly functioning ENaC gene exhibit milder lung disease, providing further evidence that inhibiting ENaC levels may be beneficial for certain patient populations. The α-ENaC RNAi agents can also be used, for example, for therapeutic treatment (including prophylactic or preventive treatment) of symptoms and diseases associated with increased or elevated levels of ENaC activity in ocular surface epithelial cells (such as conjunctival epithelial cells), including for the treatment of eye diseases and disorders (such as dry eye syndrome). The α-ENaC RNAi agents disclosed herein can selectively reduce α-ENaC expression, which can result in reduced ENaC activity. The methods disclosed herein include administering one or more α-ENaC RNAi agents to a subject (e.g., a human or animal subject) by any suitable means known in the art, such as aerosol inhalation or dry powder inhalation, intranasal administration, intratracheal administration, or oropharyngeal suction administration.

[0011] In one aspect, the disclosure features an RNAi agent for inhibiting expression of an α-ENaC gene, wherein the RNAi agent comprises a sense strand and an antisense strand. Also described herein are compositions comprising or consisting of an RNAi agent capable of inhibiting expression of an α-ENaC gene, wherein the RNAi agent comprises or consists of a sense strand and an antisense strand, and the composition further comprises at least one pharmaceutically acceptable excipient.

[0012] In another aspect, the disclosure features a composition comprising one or more disclosed α-ENaC RNAi agents that are capable of selectively and effectively reducing the expression of an α-ENaC gene. Compositions comprising one or more α-ENaC RNAi agents described herein can be administered to a subject (such as a human or animal subject) to treat (including prophylactic treatment or inhibition) symptoms and diseases associated with enhanced or elevated ENaC activity (also referred to herein as enhanced ENaC channel activity levels or elevated ENaC channel activity levels).

[0013] Each α-ENaC RNAi agent disclosed herein comprises a sense strand and an antisense strand. The sense strand and the antisense strand may be partially, substantially or completely complementary to each other. The length of the sense and antisense strands of the RNAi agent described herein may each be 16-30 nucleotides. In some embodiments, the length of the sense and antisense strands is independently 17-26 nucleotides. The sense and antisense strands may be the same length or different lengths. In some embodiments, the length of the sense and antisense strands is independently 21-26 nucleotides. In some embodiments, the length of the sense and antisense strands is independently 21-24 nucleotides. In some embodiments, the length of both the sense and antisense strands is 21 nucleotides. In some embodiments, the length of the sense and / or antisense strands is independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. When delivered to cells expressing α-ENaC, the RNAi agents described herein inhibit the expression of one or more α-ENaC genes in vivo or in vitro.

[0014] The α-ENaC RNAi agents described herein comprise at least 16 consecutive nucleotides that are at least 85% identical to a core segment sequence of the same number of nucleotides in the α-ENaC mRNA (also referred to herein as a "core segment" or "core sequence"). In some embodiments, the length of the sense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense strand core segment is 17 nucleotides. In some embodiments, the length of the sense strand core segment is 19 nucleotides.

[0015] The antisense strand of the α-ENaC RNAi agent described herein comprises at least 16 consecutive nucleotides, which have at least 85% complementarity with a core segment of the same number of nucleotides in α-ENaC mRNA and with the corresponding sense strand. In some embodiments, the length of the antisense strand core segment is 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.

[0016] In some embodiments, the α-ENaC RNAi agents disclosed herein target a portion of an α-ENaC gene having a sequence of any of the sequences disclosed in Table 1.

[0017] Examples of α-ENaC RNAi agent sense and antisense strands that can be used in α-ENaC RNAi agents are provided in Tables 3 and 4. Examples of α-ENaC RNAi agent duplexes are provided in Table 5. Examples of 19-nucleotide core segment sequences that can consist of or can include the sense and antisense strands of certain α-ENaC RNAi agents disclosed herein are provided in Table 2.

[0018] In another aspect, the disclosure features methods for delivering an α-ENaC RNAi agent to epithelial cells of a subject, such as a mammal, in vivo. Compositions for such methods are also described herein. In some embodiments, disclosed herein are methods for delivering an α-ENaC RNAi agent to lung epithelial cells of a subject in vivo. In some embodiments, disclosed herein are methods for delivering an α-ENaC RNAi agent to lung epithelial cells of a human subject in vivo. One or more α-ENaC RNAi agents may be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, by encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein carriers, or Dynamic Polyconjugates. TM (DPC)) (see, for example, WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169 and WO 2012 / 083185, each of which is incorporated herein by reference).

[0019] In some embodiments, the α-ENaC RNAi agent is delivered to a cell or tissue by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group may include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote cell-extracellular matrix (ECM) adhesion. In particular, integrin α-v-β-6 (αvβ6) is an epithelial-specific integrin that is known to be a receptor for ECM proteins and TGF-β potential associated peptide (LAP) and is expressed in various cells and tissues. Integrin αvβ6 is known to be highly upregulated in damaged lung epithelial cells. In some embodiments, the α-ENaC RNAi agent described herein is linked to an integrin targeting ligand that has affinity for integrin αvβ6. As referred to herein, an "αvβ6 integrin targeting ligand" is a compound that has affinity for integrin αvβ6 and can be used as a ligand to facilitate targeting and delivery of the RNAi agent to which it is attached to the desired cells and / or tissues (i.e., cells expressing integrin αvβ6). In some embodiments, a plurality of αvβ6 integrin targeting ligands or a cluster of αvβ6 integrin targeting ligands are attached to an α-ENaC RNAi agent. In some embodiments, the α-ENaC RNAi agent-αvβ6 integrin targeting ligand conjugate is selectively internalized by lung epithelial cells by receptor-mediated endocytosis or by other means.

[0020] Examples of targeting groups comprising αvβ6 integrin targeting ligands that can be used to deliver α-ENaC RNAi agents are disclosed, for example, in International Patent Application Publication No. WO 2018 / 085415 and U.S. Provisional Patent Application Nos. 62 / 580398 and 62 / 646739, the contents of each of which are incorporated herein by reference in their entirety.

[0021] The targeting group can be attached to the 3' or 5' end of the sense strand or antisense strand of the α-ENaC RNAi agent. In some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is attached to the 5' end of the sense strand. In some embodiments, the targeting group is internally attached to nucleotides on the sense strand and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is attached to the RNAi agent via a linker.

[0022] A targeting group with or without a linker can be attached to the 5' or 3' end of any sense and / or antisense strand disclosed in Tables 2, 3, and 4. A linker with or without a targeting group can be attached to the 5' or 3' end of any sense and / or antisense strand disclosed in Tables 2, 3, and 4.

[0023] In another aspect, the disclosure features compositions including one or more α-ENaC RNAi agents having a duplex structure disclosed in Table 5.

[0024] In some embodiments, compositions comprising a combination or mixture of at least two α-ENaC RNAi agents having different sequences are described herein. In some embodiments, two or more α-ENaC RNAi agents are each separately and independently attached to a targeting group. In some embodiments, two or more α-ENaC RNAi agents are each attached to a targeting group that comprises or consists of an integrin targeting ligand. In some embodiments, two or more α-ENaC RNAi agents are each attached to a targeting group that comprises or consists of an αvβ6 integrin targeting ligand.

[0025] In another aspect, the disclosure features a method for inhibiting expression of an α-ENaC gene in a subject, the method comprising administering to the subject an amount of an α-ENaC RNAi agent capable of inhibiting expression of the α-ENaC gene, wherein the α-ENaC RNAi agent comprises a sense strand and an antisense strand. Compositions for use in this method are also described herein.

[0026] In another aspect, the disclosure features a method of treating (including prophylactic or preventative treatment) a disease or symptom caused by increased or elevated ENaC activity, the method comprising administering to a subject in need thereof an α-ENaC RNAi agent comprising an antisense strand comprising a sequence of any of Table 2 or Table 3. Compositions for use in this method are also described herein.

[0027] In some embodiments, the α-ENaC RNAi agent is optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent can be another α-ENaC RNAi agent (e.g., an α-ENaC RNAi agent that targets a different sequence of the α-ENaC gene). The additional therapeutic agent can also be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. The α-ENaC RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

[0028] In some embodiments, compositions for delivering α-ENaC RNAi agents to epithelial cells in vivo are described. In some embodiments, the α-ENaC RNAi agent is delivered without being conjugated to a targeting ligand or a pharmacokinetic (PK) modulator (referred to as "naked" or "naked RNAi agent"). In some embodiments, the α-ENaC RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group. In some embodiments, the α-ENaC RNAi agent is conjugated to a targeting group, wherein the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. In some embodiments, the targeting group comprises one or more αvβ6 integrin targeting ligands.

[0029] In some embodiments, the α-ENaC RNAi agent is linked to one or more linking groups or other non-nucleotide groups or compounds, such as pharmacokinetic modulators. In some embodiments, the α-ENaC RNAi agent is conjugated to a polyethylene glycol (PEG) moiety, or to a hydrophobic group having 12 or more carbon atoms, such as cholesterol or palmitoyl. In some embodiments, the α-ENaC RNAi agent is linked to one or more pharmacokinetic modulators selected from cholesterol or a cholesterol derivative, an alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, or aralkyne (each of which may be linear, branched, cyclic, and / or substituted or unsubstituted). In some embodiments, the attachment position of these moieties is at the 5' or 3' end of the sense strand, at the 2' position of the ribose ring of any given nucleotide of the sense strand, and / or to a phosphate or phosphorothioate backbone at any position of the sense strand.

[0030] In some embodiments, one or more of the α-ENaC RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0031] The use of α-ENaC RNAi agents provides methods for therapeutic (including prophylactic) treatment of diseases or disorders associated with enhanced or increased ENaC activity. The α-ENaC RNAi agent is capable of inhibiting (e.g., suppressing) the expression of α-ENaC. α-ENaC RNAi agents can also be used to treat various respiratory diseases, including cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory infections, primary ciliary dyskinesia, and lung cancer cystic fibrosis. α-ENaC RNAi agents can further be used to treat, for example, various eye diseases and disorders (such as dry eyes). This treatment method includes administering an α-ENaC RNAi agent to a human or animal with an increased or enhanced level of ENaC activity. Compositions for delivering α-ENaC RNAi agents to lung epithelial cells are described herein. In addition, compositions for delivering α-ENaC RNAi agents to cells (including renal epithelial cells and / or epithelial cells in the GI or reproductive tract and / or ocular surface epithelial cells of the eye) in vivo are generally described herein.

[0032] Pharmaceutical compositions comprising one or more α-ENaC RNAi agents can be administered in a variety of ways depending on whether local or systemic treatment is desired. Administration can be, for example, but not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (such as dry powder or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.

[0033] The α-ENaC RNAi agent and / or a composition comprising the α-ENaC RNAi agent can be used for a method of therapeutically treating a disease or condition caused by enhanced or elevated ENaC activity levels. This method comprises administering the α-ENaC RNAi agent described herein to a subject (eg, a human or animal subject).

[0034] In another aspect, the present disclosure provides methods for treating (including prophylactic treatment) a pathological state (such as a disorder or disease) mediated at least in part by α-ENaC expression, wherein the method comprises administering to a subject a therapeutically effective amount of a RNAi agent comprising an antisense strand comprising a sequence of any of the sequences in Table 2 or Table 3.

[0035] In some embodiments, disclosed herein are methods for inhibiting expression of an α-ENaC gene, wherein the method comprises administering to a cell an RNAi agent comprising an antisense strand comprising a sequence of any of Table 2 or Table 3.

[0036] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) a pathological condition mediated at least in part by α-ENaC expression, wherein the method comprises administering to a subject a therapeutically effective amount of a RNAi agent comprising a sense strand comprising a sequence of any of Table 2 or Table 4.

[0037] In some embodiments, disclosed herein are methods for inhibiting expression of an α-ENaC gene, wherein the method comprises administering to a cell a RNAi agent comprising a sense strand comprising a sequence of any of the sequences in Table 2 or Table 4.

[0038] In some embodiments, the present disclosure discloses methods for treating (including prophylactic treatment) a pathological condition mediated at least in part by α-ENaC expression, wherein the method comprises administering to a subject a therapeutically effective amount of a RNAi agent comprising a sense strand comprising a sequence of any of the sequences in Table 4 and an antisense strand comprising a sequence of any of the sequences in Table 3.

[0039] In some embodiments, disclosed herein are methods for inhibiting expression of an α-ENaC gene, wherein the method comprises administering to a cell an RNAi agent comprising a sense strand comprising a sequence of any sequence in Table 4 and an antisense strand comprising a sequence of any sequence in Table 3.

[0040] In some embodiments, disclosed herein are methods of inhibiting α-ENaC gene expression, wherein the method comprises administering to a subject an α-ENaC RNAi agent comprising a sense strand consisting of a nucleobase sequence of any sequence in Table 4 and an antisense strand consisting of a nucleobase sequence of any sequence in Table 3. In other embodiments, disclosed herein are methods of inhibiting α-ENaC gene expression, wherein the method comprises administering to a subject an α-ENaC RNAi agent comprising a sense strand consisting of a modified sequence of any modified sequence in Table 4 and an antisense strand consisting of a modified sequence of any modified sequence in Table 3.

[0041] In some embodiments, disclosed herein are methods for inhibiting expression of an α-ENaC gene in a cell, wherein the method comprises administering one or more α-ENaC RNAi agents having a duplex structure of one of the duplexes described in Table 5.

[0042] The α-ENaC RNAi agents disclosed herein are designed to target a specific position on the α-ENaC gene (SEQ ID NO: 1). When base-pairing with the gene, the antisense strand sequence defined herein is designed to target the α-ENaC gene at a given position on the gene when the 5' terminal nucleobase of the antisense strand is aligned with a position 19 nucleotides downstream (towards the 3' end) from the gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target the α-ENaC gene at position 972 requires that when base-pairing with the gene, the 5' terminal nucleobase of the antisense strand is aligned with position 990 of the α-ENaC gene.

[0043] The α-ENaC RNAi agents provided herein do not require the nucleobase at position 1 (5'→3') of the antisense strand to be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity) between the antisense strand and the gene over a core segment sequence of at least 16 consecutive nucleotides. For example, for an α-ENaC RNAi agent disclosed herein that is designed to target position 972 of the α-ENaC gene, the 5' terminal nucleobase of the antisense strand of the α-ENaC RNAi agent must be aligned with position 990 of the gene; however, the 5' terminal nucleobase of the antisense strand can (but need not) be complementary to position 990 of the α-ENaC gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core segment sequence of at least 16 consecutive nucleotides. As shown in the various examples disclosed herein, the specific site of a gene to which the antisense strand of an α-ENaC RNAi agent binds (e.g., whether the α-ENaC RNAi agent is designed to target the α-ENaC gene at position 972, position 1291, position 1000, or some other position) is an important factor in the level of inhibition achieved by the α-ENaC RNAi agent.

[0044] In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) by 0 or 1 nucleobase. In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand that consists of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) by 0 or 1 nucleobase.

[0045] UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) differs by no more than 1 nucleotide, wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, the α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3), wherein SEQ ID NO: 3 is located at positions 1-21 (5'→3') of the antisense strand.

[0046] In some embodiments, the α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) by no more than 1 nucleotide, wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. As will be clearly understood by those of ordinary skill in the art, as shown in the modified nucleotide sequences disclosed herein, the inclusion of phosphorothioate linkages replaces the phosphodiester linkages typically present in oligonucleotides (see, e.g., showing all internucleoside linkages). Figures 12A-12G ).

[0047] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0048] In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5) by 0 or 1 nucleobase. In some embodiments, the α-ENaC RNAi agents disclosed herein comprise a sense strand that differs from the nucleotide sequence (5'→3')CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5) by 0 or 1 nucleobase.

[0049] CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5) differs by no more than 1 nucleotide, consisting essentially of, or comprising the nucleotide sequence, wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, the α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5), wherein SEQ ID NO: 5 is located at positions 1-21 (5'→3') of the antisense strand.

[0050] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5'→3')cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4) by no more than 1 nucleotide, wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the antisense strand is at least substantially complementary to the sense strand. In some embodiments, the α-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3')cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the antisense strand is at least substantially complementary to the sense strand. In some embodiments, one or more inverted abasic residues are added to the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand of SEQ ID NO: 4. In some embodiments, a targeting ligand (such as an αvβ6 integrin targeting ligand) can be covalently linked to the 5' end of the sense strand of SEQ ID NO:4, the 3' end of the sense strand, or both the 5' and 3' ends of the sense strand.

[0051] In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand (consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) by 0 or 1 nucleobase) and a sense strand (consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) by 0 or 1 nucleobase).

[0052] CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5) differs by 0 or 1 nucleobase. In some embodiments, the α-ENaC RNAi agent disclosed herein comprises an antisense strand (consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) by no more than 1 nucleotide, wherein all or substantially all nucleotides are modified nucleotides) and a sense strand (consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5'→3')CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5) by no more than 1 nucleotide, wherein all or substantially all nucleotides are modified nucleotides).

[0053] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3')cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3')cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4), and wherein the sense strand further comprises an inverted abasic residue at the 3' terminus and an αvβ6 integrin targeting ligand covalently linked to the 5' terminus.

[0054] In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) by 0 or 1 nucleobase. In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand that consists of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) by 0 or 1 nucleobase.

[0055] UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) differs by no more than 1 nucleotide, wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, the α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7), wherein SEQ ID NO: 7 is located at positions 1-21 (5'→3') of the antisense strand.

[0056] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6) by no more than 1 nucleotide, wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0057] In some embodiments, the α-ENaC RNAi agents disclosed herein comprise a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9) by 0 or 1 nucleobase. In some embodiments, the α-ENaC RNAi agents disclosed herein comprise a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9) by no more than 1 nucleotide, wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9) by 0 or 1 nucleobase, wherein SEQ ID NO:9 is located at positions 1-21 (5'→3') of the antisense strand.

[0058] In some embodiments, the α-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5'→3')gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8) by no more than 1 nucleotide, wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the antisense strand is at least substantially complementary to the sense strand. In some embodiments, one or more inverted abasic residues are added to the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand of SEQ ID NO: 8. In some embodiments, the targeting ligand (such as an αvβ6 integrin targeting ligand) can be covalently linked to the 5' end of the sense strand, the 3' end of the sense strand, or both the 5' and 3' ends of the sense strand of SEQ ID NO: 4. In some embodiments, the targeting ligand (such as an αvβ6 integrin targeting ligand) can be covalently linked to the 5' end of the sense strand, the 3' end of the sense strand, or both the 5' and 3' ends of the sense strand of SEQ ID NO: 8.

[0059] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) by 0 or 1 nucleobase and a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9) by 0 or 1 nucleobase. In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand (consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) by no more than 1 nucleotide, wherein all or substantially all nucleotides are modified nucleotides) and a sense strand (consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9) by no more than 1 nucleotide, wherein all or substantially all nucleotides are modified nucleotides).

[0060] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand (consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6) by no more than 1 nucleotide) and a sense strand (consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5'→3')gscugugcaAfCfCfagaacaaaua (SEQ ID NO:8) by no more than 1 nucleotide), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6) and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3')gscugugcaAfCfCfagaacaaaua (SEQ ID NO:8), and wherein the sense strand further comprises an inverted abasic residue at the 3' terminus and an αvβ6 integrin targeting ligand covalently linked to the 5' terminus.

[0061] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5'→3') cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) by no more than 1 nucleotide, wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine (see Table 6), and wherein the sense strand is at least substantially complementary to the antisense strand.

[0062] In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand (consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5'→3') cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) by no more than 1 nucleotide) and a sense strand (consisting of, consisting essentially of, or comprising the modified nucleotide sequence that differs from the nucleotide sequence (5'→3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 11). NO:4) is composed of, essentially consists of, or comprises a modified nucleotide sequence that differs by no more than 1 nucleotide, wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine (see Table 6). In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3') cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5'→3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4), and wherein the sense strand further comprises an inverted abasic residue at the 3' terminus and an αvβ6 integrin targeting ligand covalently linked to the 5' terminus.

[0063] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0064] UAUUUGUUCUGGUUGCACAGG(SEQ ID NO:3);

[0065] UAUUUGUUCUGGUUGCACAGC(SEQ ID NO:7);

[0066] UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230); or

[0067] AGAAGUCAUUCUGCUCUGCUU(SEQ ID NO:254);

[0068] wherein the α-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides.

[0069] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0070] UAUUUGUUCUGGUUGCACAGG(SEQ ID NO:3);

[0071] UAUUUGUUCUGGUUGCACAGC(SEQ ID NO:7);

[0072] UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230); or

[0073] AGAAGUCAUUCUGCUCUGCUU(SEQ ID NO:254);

[0074] wherein the α-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; wherein the sense strand comprises an abasic residue with an inversion at the 3' terminus; and wherein the αvβ6 integrin targeting ligand is attached to the 5' terminus of the sense strand.

[0075] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0076] UAUUUGUUCUGGUUGCACAGG(SEQ ID NO:3);

[0077] UAUUUGUUCUGGUUGCACAGC(SEQ ID NO:7);

[0078] UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230); or

[0079] AGAAGUCAUUCUGCUCUGCUU(SEQ ID NO:254);

[0080] wherein the α-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; wherein the sense strand comprises an abasic residue with an inversion at the 3' terminus; wherein the αvβ6 integrin targeting ligand is linked to the 5' terminus of the sense strand; and wherein each antisense strand sequence is located at positions 1-21 of the antisense strand.

[0081] In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following pairs of nucleotide sequences (5'→3'):

[0082] UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3) and CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5);

[0083] UAUUUGUUCUGGUUGCACAGC (SEQ ID NO:7) and GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9);

[0084] UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230) and CUGUGCAACCAGAACAAAUCA (SEQ ID NO:259); or

[0085] AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO: 254) and GCAGAGCAGAAUGACUUCUUU (SEQ ID NO: 289);

[0086] Wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides.

[0087] In some embodiments, the α-ENaC RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following pairs of nucleotide sequences (5'→3'):

[0088] UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3) and CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5);

[0089] UAUUUGUUCUGGUUGCACAGC (SEQ ID NO:7) and GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9);

[0090] UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230) and CUGUGCAACCAGAACAAAUCA (SEQ ID NO:259); or

[0091] AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO: 254) and GCAGAGCAGAAUGACUUCUUU (SEQ ID NO: 289);

[0092] wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; wherein the sense strand comprises an abasic residue with an inversion at the 3' terminus; and wherein the αvβ6 integrin targeting ligand is attached to the 5' terminus of the sense strand.

[0093] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0094] usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg(SEQ ID NO:2);

[0095] usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6);

[0096] cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10);

[0097] usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg(SEQ ID NO:107); or

[0098] asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu(SEQ ID NO:152);

[0099] wherein a, c, g and u represent 2'-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf represent 2'-fluoroadenosine, cytidine, guanosine or uridine, respectively; s represents a phosphorothioate linkage, and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine (see Table 6); wherein the α-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all nucleotides on the sense strand are modified nucleotides.

[0100] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0101] usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg(SEQ ID NO:2);

[0102] usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6);

[0103] cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10);

[0104] usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg(SEQ ID NO:107); or

[0105] asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu(SEQ ID NO:152);

[0106] wherein the α-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on the sense strand are modified nucleotides; wherein the sense strand comprises an abasic residue with an inversion at the 3' terminus; and wherein the αvβ6 integrin targeting ligand is attached to the 5' terminus of the sense strand.

[0107] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand and a sense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequence pairs (5'→3'):

[0108] usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4);

[0109] usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6) and gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8);

[0110] cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4);

[0111] usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO:107) and csugugcaaCfCfAfgaacaaaucas (SEQ ID NO:293); or

[0112] asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152) and gscagagCfAfGfaaugacuucuuu (SEQ ID NO: 294);

[0113] wherein a, c, g and u represent 2'-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf represent 2'-fluoroadenosine, cytidine, guanosine or uridine, respectively; s represents a phosphorothioate linkage, and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine (see Table 6).

[0114] In some embodiments, an α-ENaC RNAi agent disclosed herein comprises an antisense strand and a sense strand consisting of, consisting essentially of, or comprising one of the following nucleotide sequence pairs (5'→3'):

[0115] usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4);

[0116] usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6) and gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8);

[0117] cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4);

[0118] usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO:107) and csugugcaaCfCfAfgaacaaaucas (SEQ ID NO:293); or

[0119] asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152) and gscagagCfAfGfaaugacuucuuu (SEQ ID NO: 294);

[0120] wherein a, c, g and u represent 2'-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf represent 2'-fluoroadenosine, cytidine, guanosine or uridine, respectively; s represents a phosphorothioate linkage, and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine (see Table 6); wherein the sense strand comprises an abasic residue with an inversion at the 3' terminus; and wherein the αvβ6 integrin targeting ligand is attached to the 5' end of the sense strand.

[0121] In some embodiments, the α-ENaC RNAi agent disclosed herein comprises an antisense strand comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACA (SEQ ID NO: 21) by 0 or 1 nucleobase. In some embodiments, the α-ENaC RNAi agent disclosed herein comprises an antisense strand comprising a nucleotide sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACA (SEQ ID NO: 21) by no more than 1 nucleotide, wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, the α-ENaC RNAi agent disclosed herein comprises an antisense strand comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACA (SEQ ID NO: 21) by 0 or 1 nucleobase, wherein SEQ ID NO: 21 is located at positions 1-19 (5'→3') of the antisense strand.

[0122] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which independently may be modified or unmodified.

[0123] As used herein, "RNAi agents" (also referred to as "RNAi triggers") refer to compositions containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that are capable of degrading or inhibiting (e.g., degrading or inhibiting under appropriate conditions) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. The RNAi agents used herein may act through an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway machinery of mammalian cells (RNA-induced silencing complex or RISC)) or through any alternative mechanism or pathway. Although it is believed that the term RNAi agent used herein acts primarily through an RNA interference mechanism, the disclosed RNAi agents are not bound or limited by any particular pathway or mechanism of action. The RNAi agents disclosed herein consist of a sense strand and an antisense strand, and include, but are not limited to: short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the targeted mRNA (i.e., α-ENaC mRNA). The RNAi agent can comprise one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0124] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown" when referring to the expression of a given gene mean that the expression of the gene is reduced when a cell, cell population, tissue, organ, or subject is treated with a RNAi agent described herein, as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from the mRNA in the cell, cell population, tissue, organ, or subject in which the gene is transcribed, as compared to a second cell, cell population, tissue, organ, or subject that has not been so treated.

[0125] As used herein, the terms "sequence" and "nucleotide sequence" mean the order or sequence of nucleobases or nucleotides, described in alphabetical order using standard nomenclature.

[0126] As used herein, "base", "nucleotide base" or "nucleobase" is a heterocyclic pyrimidine or purine compound as a nucleotide component, and includes primary purine bases adenine and guanine and primary pyrimidine bases cytosine, thymine and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, bases with enlarged sizes and fluorinated bases (see, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds comprising modified nucleobases) is known in the art.

[0127] As used herein, and unless otherwise indicated, the term "complementary" when used to describe a first core base or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) relative to a second core base or nucleotide sequence (e.g., RNAi agent antisense strand or single-stranded antisense oligonucleotide), means that an oligonucleotide or polynucleotide comprising a first nucleotide sequence hybridizes (forming base pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)) with an oligonucleotide or polynucleotide comprising a second nucleotide sequence and forms a duplex or double helix structure under certain standard conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, in order to determine identity or complementarity, a and Af defined herein are complementary to U (or T) and identical to A.

[0128] As used herein, "perfect complementarity" or "complete complementarity" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, all (100%) bases in the first oligonucleotide contiguous sequence will hybridize to the same number of bases in the second oligonucleotide contiguous sequence. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

[0129] As used herein, "partial complementarity" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 70% (but not all) of the bases in the first oligonucleotide contiguous sequence will hybridize to the same number of bases in the second oligonucleotide contiguous sequence. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

[0130] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 85% (but not all) of the bases in the first oligonucleotide contiguous sequence will hybridize to the same number of bases in the second oligonucleotide contiguous sequence. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

[0131] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used with respect to nucleobase or nucleotide matches between the sense and antisense strands of an RNAi agent or between the antisense strand of an RNAi agent and an α-ENaC mRNA sequence.

[0132] As used herein, the term "substantially identical" or "substantially identical" as applied to nucleic acid sequences means that the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or higher, such as at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleic acid base occurs in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein includes nucleotide sequences substantially identical to those disclosed herein.

[0133] The terms "treat", "treatment", etc. used herein refer to methods or steps used to reduce or alleviate the number, severity and / or frequency of one or more symptoms of a disease in a subject. "Treatment" and "treatment" used herein may include preventative treatment, management, prophylactic treatment and / or inhibition or reduction of the number, severity and / or frequency of one or more symptoms of a disease in a subject.

[0134] When referring to RNAi agents, the phrase "introduced into a cell" as used herein means that the RNAi agent is functionally delivered to the cell. The phrase "functional delivery" means that the RNAi agent is delivered to the cell in a manner such that the RNAi agent has the desired biological activity (e.g., sequence-specific inhibition of gene expression).

[0135] Unless otherwise stated, the symbols used in this document are The use of means that any one or more groups according to the scope of the invention described herein may be attached thereto.

[0136] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers". Stereoisomers that are not mirror images of each other are called "diastereomers", and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four different substituents is called a "chiral center".

[0137] As used herein, unless specifically identified as having a particular conformation in a structure, for each structure in which an asymmetric center exists and thus produces enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms thereof. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as single stereoisomers.

[0138] The phrase "consisting of" as used in the claims herein excludes any elements, steps, or ingredients not specified in the claim. When used in the claims herein, the phrase "consisting essentially of" limits the scope of the claim to the specified materials or steps and those materials or steps that do not materially affect the basic and novel characteristics of the claimed invention.

[0139] Those of ordinary skill in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition is located. Thus, the structures disclosed herein as used herein contemplate that certain functional groups (such as OH, SH, or NH) may be protonated or deprotonated. As those of ordinary skill in the art will readily appreciate, the disclosure herein is intended to encompass the disclosed compounds and compositions, regardless of their protonation state based on the environment (such as pH).

[0140] When referring to the connection between two compounds or molecules, the term "connected" or "conjugated" as used herein means that the two compounds or molecules are connected by a covalent bond. Unless otherwise specified, the terms "connected" and "conjugated" as used herein may refer to a connection between a first compound and a second compound with or without any intervening atoms or groups of atoms.

[0141] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including (but not limited to)". Unless the context clearly indicates otherwise, the term "or" is used herein to mean, and is used interchangeably with, the term "and / or".

[0142] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used for practice or testing of the present invention, suitable methods and materials are described below. All disclosures, patent applications, patents and other references mentioned herein are combined by reference in their entirety. In the event of a conflict, this specification (including definitions) shall prevail. In addition, materials, methods and embodiments are only illustrative and are not intended to be restrictive.

[0143] Other objects, features, aspects and advantages of the present invention will be apparent from the following detailed description, the accompanying drawings and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0144] Figure 1 . Histogram showing the relative expression of α-ENaC expression in whole lung of mice following administration of various α-ENaC RNAi agents compared to vehicle control.

[0145] Figure 2 . Histogram showing the relative expression of α-ENaC expression in whole lung of mice following administration of α-ENaC RNAi agents AD04025 and AD04858 compared to vehicle control.

[0146] Figure 3 . Graph showing the relative expression of α-ENaC expression in rat whole lung for α-ENaC RNAi agent AD04025 and AD04025-conjugate (ie, AD04025 conjugated to a peptide-based αvβ6 epithelial cell targeting ligand).

[0147] Figure 4 .Chemical structure representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM2.

[0148] Figure 5 .Chemical structure representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM1.

[0149] Figure 6 .Chemical structure representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM6.1.

[0150] Figure 7 .Chemical structure representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM9.

[0151] Figure 8 . Representation of the chemical structure of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM6.

[0152] Fig. 9 .Chemical structure representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM8.

[0153] Fig.10 .Chemical structure representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM10.

[0154] Fig.11.Chemical structure representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM11.

[0155] Fig. 12A Schematic representation of the modified sense and antisense strands of α-ENaC RNAi agent AD05453 (see Tables 3-5), showing an amino group at the 5' end of the sense strand to facilitate attachment to a targeting ligand.

[0156] exist Figures 12A-12G The following abbreviations are used: a, c, g, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; p is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted abasic residue; cPrp is a 5'-terminal cyclopropylphosphonate group (see Table 6); NH2-C6 is a C6 amino group (see Table 6); and TriAlk14 is a triyne linker having a structure described herein (see Table 6).

[0157] Fig. 12B Schematic diagram of the modified sense and antisense strands of α-ENaC RNAi agent AD05924 (see Tables 3-5), showing functionalization with a triacetin group at the 5' end of the sense strand to facilitate attachment to a targeting ligand. AD05453 and AD05924 described herein have the same modified nucleotide sequence and represent an alternative method for synthesizing the α-ENaC RNAi agent conjugates disclosed herein.

[0158] Fig. 12C Schematic representation of the modified sense and antisense strands of α-ENaC RNAi agent AD05625 (see Tables 3-5), showing functionalization with an amino group at the 5' end of the sense strand to facilitate attachment to a targeting ligand.

[0159] Fig.12D Schematic representation of the modified sense and antisense strands of α-ENaC RNAi agent AD05347 (see Tables 3-5), showing functionalization with an amino group at the 5' end of the sense strand to facilitate attachment to a targeting ligand.

[0160] Fig.12E Schematic representation of the modified sense and antisense strands of α-ENaC RNAi agent AD05831 (see Tables 3-5), showing functionalization with an amino group at the 5' end of the sense strand to facilitate attachment to a targeting ligand.

[0161] Fig.12F Schematic representation of the modified sense and antisense strands of α-ENaC RNAi agent AD05833 (see Tables 3-5), showing functionalization with an amino group at the 5' end of the sense strand to facilitate attachment to a targeting ligand.

[0162] Figure 12G Schematic representation of the modified sense and antisense strands of α-ENaC RNAi agent AD05453 and α-ENaC RNAi agent AD05924 (see Tables 3-5), where X represents a tridentate αvβ6 integrin targeting ligand (including any linker).

[0163] Fig.12H Schematic diagram of an example tridentate αvβ6 integrin targeting ligand-RNAi agent conjugate described herein, wherein the tridentate αvβ6 integrin targeting ligand is conjugated to the 5' end of the sense strand. As shown therein, each αvβ6 represents an αvβ6 integrin targeting compound.

[0164] Figures 13A-13D .Chemical structure representation of α-ENaC RNAi agent AD05453, which contains the NH2-C6 terminal amino group, shown as a sodium salt.

[0165] Figures 14A-14D .Chemical structure representation of the α-ENaC RNAi agent AD05924, comprising a triyne functionalized linker group (TriAlk14), shown as a sodium salt.

[0166] Figures 15A-15E .Chemical structure representation of α-ENaC RNAi agent AD05453, shown as a sodium salt conjugated to Tri-SM6.1. As described herein, the same chemical structure can be synthesized using a triyne functionalized linker group (TriAlk14), which can be added by phosphoramidite synthesis, as described for the modified sense strand nucleotide sequence of α-ENaC RNAi agent AD05924 (i.e., AM07807-SS in Table 4).

[0167] Figures 16A-16D .Chemical structure representation of α-ENaC RNAi agent AD05453, containing the NH2-C6 terminal functionalized amino group, shown as a free acid. DETAILED DESCRIPTION

[0168] RNAi Agents

[0169] RNAi agents (referred to herein as α-ENaC RNAi agents or α-ENaC RNAi triggers) for inhibiting α-ENaC (i.e., SCNN1A) gene expression are described herein. Each α-ENaC RNAi agent comprises a sense strand and an antisense strand. The length of the sense strand and the antisense strand may each be 16-30 nucleotides. In some embodiments, the length of the sense and antisense strands may each be 17-26 nucleotides. The sense and antisense strands may be the same length, or they may be different lengths. In some embodiments, the length of the sense and antisense strands is each independently 17-26 nucleotides. In some embodiments, the length of the sense and antisense strands is each independently 17-21 nucleotides. In some embodiments, the length of both the sense and antisense strands is each 21-26 nucleotides. In some embodiments, the length of the sense and antisense strands is each 21-24 nucleotides. In some embodiments, the length of the sense strand is about 19 nucleotides, and the length of the antisense strand is about 21 nucleotides. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the sense and antisense strands of the RNAi agent are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0170] In some embodiments, the region of complete, substantial or partial complementarity between the sense and antisense strands is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., the region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not completely, substantially or partially complementary).

[0171] The sense strand and the antisense strand each contain a core segment (also referred to herein as a "core sequence" or "core segment sequence") of 16-23 nucleotides in length. The antisense strand core segment is 100% (completely) complementary or at least 85% (substantially) complementary to a nucleotide sequence present in the α-ENaC target (sometimes referred to as, for example, a target sequence). The sense strand core segment is 100% (completely) complementary or at least 85% (substantially) complementary to the core segment in the antisense strand, and thus the sense strand core segment is generally completely identical or at least 85% identical to a nucleotide sequence present in the α-ENaC mRNA target (target sequence). The sense strand core segment may be the same length as the corresponding antisense core segment, or may be a different length. In some embodiments, the length of the antisense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the sense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0172] Examples of nucleotide sequences used to form α-ENaC RNAi agents are provided in Tables 2, 3, and 4. Examples of RNAi agent duplexes (comprising the sense and antisense strand nucleotide sequences in Tables 2, 3, and 4) are shown in Table 5.

[0173] The sense and antisense strands of the α-ENaC RNAi agent anneal to form a duplex. The sense and antisense strands of the α-ENaC RNAi agent can be partially, substantially or completely complementary to each other. Within the complementary duplex region, the sense strand core segment sequence is at least 85% complementary or 100% complementary to the antisense core segment sequence. In some embodiments, the sense strand core segment sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core segment sequence (i.e., the sense and antisense core segment sequences of the α-ENaC RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base paired or 100% base paired).

[0174] In some embodiments, the antisense strand of an α-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any antisense strand sequence in Table 2 or Table 3. In some embodiments, the sense strand of an α-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any sense strand sequence in Table 2 or Table 4.

[0175] The sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5 or 6 nucleotides (extensions) at the 3' end, 5' end, or both 3' and 5' ends of the core segment sequence. The additional nucleotides of the antisense strand (if present) may be complementary or non-complementary to the corresponding sequence in the α-ENaC mRNA. The additional nucleotides of the sense strand (if present) may be the same as or different from the corresponding sequence in the α-ENaC mRNA. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the additional nucleotides of the corresponding sense strand (if present).

[0176] The extension used herein comprises 1, 2, 3, 4, 5 or 6 nucleotides at the 5' and / or 3' end of the sense strand core segment sequence and / or the antisense strand core segment sequence. The extension nucleotides on the sense strand may be complementary or non-complementary to the nucleotides (core segment sequence nucleotides or extension nucleotides) in the corresponding antisense strand. On the contrary, the extension nucleotides on the antisense strand may be complementary or non-complementary to the nucleotides (core segment nucleotides or extension nucleotides) in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more 3' extension nucleotides of one strand are base paired with one or more 5' extension nucleotides of another strand. In other embodiments, one or more 3' extension nucleotides of one strand are not base paired with one or more 5' extension nucleotides of another strand. In some embodiments, the α-ENaC RNAi agent has an antisense strand (with a 3' extension) and a sense strand (with a 5' extension). In some embodiments, the extension nucleotides are unpaired and form an overhang. As used herein, "overhang" refers to a stretch of one or more unpaired nucleotides at the end of the sense strand or antisense strand that does not form part of the hybridized or duplex portion of the RNAi agents disclosed herein.

[0177] In some embodiments, the α-ENaC RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the α-ENaC RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides complementary to the corresponding α-ENaC mRNA sequence.

[0178] In some embodiments, the 3' end of the antisense strand may include an additional abasic residue (Ab). An "abasic residue" or "abasic site" is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety (see, e.g., U.S. Pat. No. 5,998,203). In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the abasic residue may be added as an inverted abasic residue (invAb) (see Table 6) (see, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31 (11), 2705-16).

[0179] In some embodiments, the sense strand or antisense strand may include a "terminal cap," which as used herein is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of a strand of an RNAi agent disclosed herein, and in some cases can provide certain beneficial properties to the RNAi agent, such as protection from exonuclease degradation. Terminal caps are generally known in the art and include inverted abasic residues and carbon chains (such as terminal C3, C6 or C 12 ). In some embodiments, a terminal cap is present at the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand.

[0180] In some embodiments, the α-ENaC RNAi agent comprises a sense strand having a 3' extension length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more sense strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to nucleotides in the α-ENaC mRNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences or consists of: T, UT, TT, UU, UUT, TTT, or TTTT (each listed as 5' to 3').

[0181] In some embodiments, the 3' end of the sense strand may comprise additional abasic residues.In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand.

[0182] In some embodiments, one or more inverted abasic residues are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near one or more ends of the sense strand of the RNAi agent enables the activity or other desired properties of the RNAi agent to be enhanced.

[0183] In some embodiments, the α-ENaC RNAi agent comprises a sense strand having a 5' extension length of 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, one or more sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides corresponding to nucleotides in the α-ENaC mRNA sequence. In some embodiments, the sense strand 5' extension is one of (but not limited to) the following sequences: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed as 5' to 3'). The sense strand may have a 3' extension and / or a 5' extension.

[0184] In some embodiments, the 5' end of the sense strand may include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues may be inserted between the targeting ligand and the core base sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near one or more ends of the sense strand of the RNAi agent may enable the activity or other desired properties of the RNAi agent to be enhanced. In some embodiments, the abasic (deoxyribose) residue may be substituted by a ribitol (absic ribose) residue.

[0185] In some embodiments, the 3' end of the antisense strand core segment sequence or the 3' end of the antisense strand sequence may contain an inverted abasic residue (invAb (see Table 6)).

[0186] Examples of sequences for forming α-ENaC RNAi agents are provided in Tables 2, 3, and 4. In some embodiments, the α-ENaC RNAi agent antisense strand comprises a sequence of any sequence in Table 2 or 3. In some embodiments, the α-ENaC RNAi agent antisense strand comprises a sequence of nucleotides (from 5' end → 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any sequence in Table 2 or Table 3. In certain embodiments, the α-ENaC RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3. In some embodiments, the α-ENaC RNAi agent sense strand comprises a sequence of any sequence in Table 2 or 4. In some embodiments, the sense strand of the α-ENaC RNAi agent comprises a sequence of nucleotides (from 5' end → 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23, 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23, or 5-24 of any sequence in Table 2 or 4. In certain embodiments, the sense strand of the α-ENaC RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4.

[0187] In some embodiments, the sense and antisense strands of RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of the RNAi agent form a flat end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of the RNAi agent form a flat end. In some embodiments, the two ends of the RNAi agent form a flat end. In some embodiments, both ends of the RNAi agent are not flat ends. "Flat ends" used herein refers to the ends of double-stranded RNAi agents in which the terminal nucleotides of the two annealed chains are complementary (forming complementary base pairs).

[0188] In some embodiments, the 5' end of the sense strand of the RNAi agent and the 3' end of the antisense strand form a scattered end. In some embodiments, the 3' end of the sense strand of the RNAi agent and the 5' end of the antisense strand form a scattered end. In some embodiments, both ends of the RNAi agent form a scattered end. In some embodiments, both ends of the RNAi agent are not scattered ends. The scattered end used herein refers to the end of a double-stranded RNAi agent, wherein the terminal nucleotides from two annealed chains of a pair (i.e., not forming an overhang) are not complementary (i.e., forming a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one chain of the double-stranded RNAi agent form an overhang. Unpaired nucleotides can produce 3' or 5' overhangs on the sense or antisense strands. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends. Generally, when present, the overhang is located at the 3' end of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0189] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can retain the activity of the compounds in cells while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the polynucleotide or oligonucleotide construct.

[0190] In some embodiments, the α-ENaC RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the α-ENaC RNAi agent is prepared as a sodium salt. Such forms, which are well known in the art, are within the scope of the invention disclosed herein.

[0191] Modified nucleotides

[0192] In some embodiments, the α-ENaC RNAi agent contains one or more modified nucleotides. As used herein, "modified nucleotides" are nucleotides other than ribonucleotides (2'-hydroxy nucleotides). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimetics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides (represented herein as invdN, invN, invn), nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNA), 2',3'-split ring nucleotide mimetics unlocked nucleobase analogs, represented herein as N UNA or NUNA), locked nucleotide (represented herein as N LNA or NLNA), 3'-O-methoxy (2' internucleoside linked) nucleotides (represented herein as 3'-OMen), 2'-F-arabinonucleotides (represented herein as NfANA or Nf ANA ), 5'-Me, 2'-fluoro nucleotides (denoted herein as 5Me-Nf), morpholino nucleotides, vinylphosphonate deoxyribonucleotides (denoted herein as vpdN), vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides (cPrpN). 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (denoted herein as lowercase 'n' in the nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (also referred to herein as 2'-fluoro nucleotides, and denoted herein as Nf), 2'-deoxy nucleotides (denoted herein as dN), 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also referred to herein as 2'-MOE, and denoted herein as NM), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Instead, more than one modification may be incorporated into a single α-ENaC RNAi agent or even into a single nucleotide thereof. The sense and antisense strands of the α-ENaC RNAi agent can be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

[0193] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiouracil, thymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (e.g. 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0194] In some embodiments, all or substantially all nucleotides of RNAi agent are modified nucleotides. RNAi agent wherein substantially all nucleotides present are modified nucleotides used herein is 4 or less (i.e. 0, 1, 2, 3 or 4) nucleotides in both sense strand and antisense strand are ribonucleotides (i.e. unmodified) RNAi agent. Sense strand wherein substantially all nucleotides present are modified nucleotides used herein is a sense strand wherein two or less (i.e. 0, 1 or 2) nucleotides in the sense strand are unmodified ribonucleotides. Antisense strand wherein substantially all nucleotides present are modified nucleotides used herein is a sense strand wherein two or less (i.e. 0, 1 or 2) nucleotides in the antisense strand are unmodified ribonucleotides. In some embodiments, one or more nucleotides of RNAi agent are unmodified ribonucleotides.

[0195] Modified internucleoside linkages

[0196] In some embodiments, one or more nucleotides of the α-ENaC RNAi agent are linked by a non-standard linkage or backbone (i.e., a modified internucleoside linkage or modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as lowercase "s"), chiral phosphorothioates, phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphonamidates, aminoalkylphosphoramidates, or thiophosphoramidates), thioalkylphosphonates, thioalkylphosphotriesters, morpholino linkages, borophosphates with normal 3'-5' linkages, 2'-5' linked analogs of borophosphates, or borophosphates with inverted polarity, wherein adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl sugar linkages, mixed heteroatoms and alkyl or cycloalkyl sugar linkages, or one or more short-chain heteroatoms or heterocyclic sugar linkages. In some embodiments, the modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formyl acetyl and thioformyl acetyl backbones, methylene formyl acetyl and thioformyl acetyl backbones, olefin-containing backbones, aminosulfonate backbones, methylene imino and methylene hydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 components.

[0197] In some embodiments, the sense strand of the α-ENaC RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of the α-ENaC RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of the α-ENaC RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the α-ENaC RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0198] In some embodiments, the sense strand of the α-ENaC RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, at least two phosphorothioate internucleoside linkages are located between nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is located at the 5' end of the sense strand, and another phosphorothioate linkage is located at the 3' end of the sense strand. In some embodiments, at least two phosphorothioate internucleoside linkages are located between nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, the antisense strand of the α-ENaC RNAi agent contains 4 phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are located between nucleotides at positions 1-3 and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, the α-ENaC RNAi agent contains at least two phosphorothioate internucleoside linkages in the sense strand and 3 or 4 phosphorothioate internucleoside linkages in the antisense strand.

[0199] In some embodiments, the α-ENaC RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with a modified internucleoside linkage.

[0200] α-ENaC RNAi Agent

[0201] In some embodiments, the α-ENaC RNAi agents disclosed herein target an α-ENaC gene at or near the location of the α-ENaC sequence shown in Table 1. In some embodiments, the antisense strand of the α-ENaC RNAi agents disclosed herein comprises a core segment sequence that is completely, substantially, or at least partially complementary to the target α-ENaC 19-mer sequence disclosed in Table 1.

[0202] Table 1. α-ENaC 19-mer mRNA target sequence (derived from homo sapiens sodium channel epithelial 1 α subunit (SCNN1A), transcript variant 1, GenBank NM_001038.5 (SEQ ID NO: 1))

[0203]

[0204] In some embodiments, the α-ENaC RNAi agent comprises an antisense strand, wherein position 19 of the antisense strand (5'→3') is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, the α-ENaC agent comprises an antisense strand, wherein position 1 of the antisense strand (5'→3') is capable of forming a base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0205] In some embodiments, the α-ENaC agent comprises an antisense strand, wherein position 2 of the antisense strand (5'→3') is capable of forming a base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, the α-ENaC agent comprises an antisense strand, wherein positions 2-18 of the antisense strand (5'→3') are capable of forming a base pair with each of the corresponding complementary bases located at positions 18-2 of a 19-mer target sequence disclosed in Table 1.

[0206] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) may be completely complementary to the α-ENaC gene, or may be non-complementary to the α-ENaC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) forms an A:U or U:A base pair with the sense strand.

[0207] In some embodiments, the α-ENaC RNAi agent antisense strand comprises a sequence of nucleotides (from 5' end → 3' end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3. In some embodiments, the α-ENaC RNAi sense strand comprises a sequence of nucleotides (from 5' end → 3' end) 1-17, 1-18, or 2-18 of any sense strand sequence in Table 2 or Table 4.

[0208] In some embodiments, the α-ENaC RNAi agent consists of: (i) an antisense strand comprising a sequence of nucleotides (from 5' end → 3' end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3, and (ii) a sense strand comprising a sequence of nucleotides (from 5' end → 3' end) 1-17 or 1-18 of any sense strand sequence in Table 2 or Table 4.

[0209] In some embodiments, the α-ENaC RNAi agent comprises the core 19-mer nucleotide sequence shown in Table 2 below.

[0210] Table 2. α-ENaC RNAi agent antisense and sense strand core segment base sequences (N = any nucleobase)

[0211]

[0212]

[0213] The sense and antisense strands of the α-ENaC RNAi agent comprising or consisting of the nucleotide sequence in Table 2 may be modified nucleotides or unmodified nucleotides. In some embodiments, the α-ENaC RNAi agent having sense and antisense strand sequences comprising or consisting of any nucleotide sequence in Table 2 is all or substantially all modified nucleotides.

[0214] In some embodiments, the antisense strand of an α-ENaC RNAi agent disclosed herein differs from any antisense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an α-ENaC RNAi agent disclosed herein differs from any sense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides.

[0215] As used herein, each N listed in the sequence disclosed in Table 2 can be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have nucleobases complementary to the N nucleotides at the corresponding position of the other chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have nucleobases that are not complementary to the N nucleotides at the corresponding position of the other chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have the same nucleobases as the N nucleotides at the corresponding position of the other chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have nucleobases different from the N nucleotides at the corresponding position of the other chain.

[0216] Certain modified α-ENaC RNAi agent sense and antisense strands are provided in Tables 3 and 4. Modified α-ENaC RNAi agent antisense strands and their potential unmodified nucleobase sequences are provided in Table 3. Modified α-ENaC RNAi agent sense strands and their potential unmodified nucleobase sequences are provided in Table 4. In forming the α-ENaC RNAi agent, each nucleotide in each potential base sequence listed in Tables 3 and 4 above and Table 2 can be a modified nucleotide.

[0217] The α-ENaC RNAi agents described herein are formed by annealing the antisense strand to the sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a continuous sequence of 16, 17, 18, 19, 20, or 21 nucleotides.

[0218] In some embodiments, the α-ENaC RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0219] In some embodiments, the α-ENaC RNAi agent comprises or consists of a duplex having a nucleobase sequence of the sense and antisense strands of any sequence in Table 2, Table 3, or Table 4.

[0220] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.

[0221] As used in Tables 3 and 4, the following symbols are used to represent modified nucleotides, targeting groups, and linking groups:

[0222] A = adenosine-3'-phosphate

[0223] C = cytidine-3'-phosphate

[0224] G = guanosine-3'-phosphate

[0225] U = uridine-3'-phosphate

[0226] I = inosine-3'-phosphate

[0227] a = 2'-O-methyladenosine-3'-phosphate

[0228] as = 2'-O-methyladenosine-3'-phosphorothioate

[0229] c = 2'-O-methylcytidine-3'-phosphate

[0230] cs = 2'-O-methylcytidine-3'-phosphorothioate

[0231] g = 2'-O-methylguanosine-3'-phosphate

[0232] gs = 2'-O-methylguanosine-3'-phosphorothioate

[0233] i = 2'-O-methylinosine-3'-phosphate

[0234] is = 2'-O-methylinosine-3'-phosphorothioate

[0235] t = 2'-O-methyl-5-methyluridine-3'-phosphate

[0236] ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate

[0237] u = 2'-O-methyluridine-3'-phosphate

[0238] us = 2'-O-methyluridine-3'-phosphorothioate

[0239] Nf = any 2'-fluorine modified nucleotide

[0240] Af = 2'-fluoroadenosine-3'-phosphate

[0241] Afs = 2'-fluoroadenosine-3'-phosphorothioate

[0242] Cf = 2'-fluorocytidine-3'-phosphate

[0243] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0244] Gf = 2'-fluoroguanosine-3'-phosphate

[0245] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0246] Tf = 2'-fluoro-5'-methyluridine-3'-phosphate

[0247] Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate

[0248] Uf = 2'-fluorouridine-3'-phosphate

[0249] Ufs = 2'-fluorouridine-3'-phosphorothioate

[0250] dN = any 2'-deoxyribonucleotide

[0251] dT = 2'-deoxythymidine-3'-phosphate

[0252] N UNA =2',3'-split nucleotide analog (unlocked nucleobase analog)-3'-phosphate

[0253] N UNA s = 2',3'-split nucleotide analog (unlocked nucleobase analog)-3'-phosphorothioate

[0254] A UNA =2',3'-cleaved-adenosine-3'-phosphate

[0255] A UNA s = 2',3'-schizo-adenosine-3'-phosphorothioate

[0256] C UNA =2',3'-Cytidine-3'-phosphate

[0257] C UNA s = 2',3'-cleaved-cytidine-3'-phosphorothioate

[0258] G UNA =2',3'-Cyclic-Guanosine-3'-phosphate

[0259] G UNA s = 2',3'-cleaved-guanosine-3'-phosphorothioate

[0260] U UNA =2',3'-cleaved-uridine-3'-phosphate

[0261] U UNA s = 2',3'-cleaved-uridine-3'-phosphorothioate

[0262] a_2N = See Table 7

[0263] a_2Ns = See Table 7

[0264] pu_2N = see Table 7

[0265] pu_2Ns = see Table 7

[0266] D2us = See Table 7

[0267] Npu = See Table 7

[0268] Nus = See Table 7

[0269] N LNA = Locked Nucleotide

[0270] Nf ANA =2'-F-arabinonucleotide

[0271] NM = 2'-O-(2-methoxyethyl) nucleotide

[0272] AM = 2'-O-(2-methoxyethyl)adenosine-3'-phosphate

[0273] AMs = 2'-O-(2-methoxyethyl)adenosine-3'-phosphorothioate

[0274] TM = 2'-O-(2-methoxyethyl)thymidine-3'-phosphate

[0275] TMs = 2'-O-(2-methoxyethyl)thymidine-3'-phosphorothioate

[0276] R = Ribitol

[0277] (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucleotides)

[0278] (invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide-5'-phosphate, see Table 7

[0279] (invAb)s = inverted (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 7

[0280] (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide)

[0281] s = phosphorothioate linkage

[0282] vpdN = vinylphosphonate deoxyribonucleotide

[0283] (5Me-Nf)=5'-Me,2'-fluoronucleotide

[0284] cPrp = cyclopropylphosphonate, see Table 7

[0285] epTcPr = See Table 7

[0286] epTM = see Table 7

[0287] spus = see Table 7

[0288] (Chol-TEG) ​​= See Table 7

[0289] (TEG-Biotin) = See Table 7

[0290] (PEG-C3-SS) = See Table 7

[0291] (Alk-SS-C6) = See Table 7

[0292] (C6-SS-Alk) = See Table 7

[0293] (C6-SS-C6) = See Table 7

[0294] (6-SS-6) = See Table 7

[0295] (C6-SS-Alk-Me) = See Table 7

[0296] (NH2-C6) = See Table 7

[0297] (TriAlk#) = See Table 7

[0298] (TriAlk#)s = See Table 7

[0299] As will be readily understood by one of ordinary skill in the art, unless otherwise indicated by the sequence (such as by a phosphorothioate linkage "s"), when present in an oligonucleotide, the nucleotide monomers are interconnected by 5'-3'-phosphodiester bonds. Further, as will be readily understood by one of ordinary skill in the art, the terminal nucleotide at the 3' end of a given oligonucleotide sequence will generally have a hydroxyl (-OH) rather than an isolated phosphate moiety at the corresponding 3' position of a given monomer. In addition, as will be readily understood and appreciated by one of ordinary skill in the art, although the phosphorothioate chemical structures described herein generally show anions on the sulfur atom, the invention disclosed herein includes all phosphorothioate tautomers and / or diastereomers (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise expressly stated herein, this understanding of one of ordinary skill in the art is used when describing the α-ENaC RNAi agents and compositions of α-ENaC RNAi agents disclosed herein.

[0300] Certain examples of targeting groups and linking groups for use with the α-ENaC RNAi agents disclosed herein are included in the chemical structures provided below in Table 6. Each sense strand and / or antisense strand can have any of the targeting groups or linking groups listed herein, as well as other targeting or linking groups, conjugated to the 5' and / or 3' end of the sequence.

[0301]

[0302]

[0303]

[0304]

[0305]

[0306]

[0307] The α-ENaC RNAi agents disclosed herein are formed by annealing the antisense strand to the sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides.

[0308] In some embodiments, the antisense strand of an α-ENaC RNAi agent disclosed herein differs from any antisense strand sequence in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an α-ENaC RNAi agent disclosed herein differs from any sense strand sequence in Table 4 by 0, 1, 2, or 3 nucleotides.

[0309] In some embodiments, the α-ENaC RNAi agent antisense strand comprises a nucleotide sequence of any sequence in Table 2 or Table 3. In some embodiments, the α-ENaC RNAi agent antisense strand comprises a sequence of nucleotides (from 5' end → 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any sequence in Table 2 or Table 3. In certain embodiments, the α-ENaC RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.

[0310] In some embodiments, the sense strand of the α-ENaC RNAi agent comprises a nucleotide sequence of any sequence in Table 2 or Table 4. In some embodiments, the sense strand of the α-ENaC RNAi agent comprises a sequence of nucleotides (from 5' end → 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any sequence in Table 2 or Table 4. In certain embodiments, the sense strand of the α-ENaC RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3.

[0311] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) may be completely complementary to the α-ENaC gene, or may be non-complementary to the α-ENaC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) is U, A, or dT (or a modified form of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) forms an A:U or U:A base pair with the sense strand.

[0312] In some embodiments, the α-ENaC RNAi agent antisense strand comprises a sequence of nucleotides (from 5' end → 3' end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3. In some embodiments, the α-ENaC RNAi sense strand comprises a sequence of nucleotides (from 5' end → 3' end) 1-17 or 1-18 of any sense strand sequence in Table 2 or Table 4.

[0313] In some embodiments, the α-ENaC RNAi agent comprises: (i) an antisense strand comprising a sequence of nucleotides (from 5' end → 3' end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3, and (ii) a sense strand comprising a sequence of nucleotides (from 5' end → 3' end) 1-17 or 1-18 of any sense strand sequence in Table 2 or Table 4.

[0314] A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides. In some embodiments, the α-ENaC RNAi agent has a sense strand consisting of a modified sequence of any modified sequence in Table 4 and an antisense strand consisting of a modified sequence of any modified sequence in Table 3. Some representative sequence pairs are exemplified by the duplex ID numbers shown in Table 5.

[0315] In some embodiments, the α-ENaC RNAi agent comprises, consists of, or is substantially composed of a duplex represented by any duplex ID number presented herein. In some embodiments, the α-ENaC RNAi agent consists of any duplex ID number presented herein. In some embodiments, the α-ENaC RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any duplex ID number presented herein. In some embodiments, the α-ENaC RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any duplex ID number presented herein and a targeting group, a linking group, and / or other non-nucleotide groups, wherein the targeting group, the linking group, and / or other non-nucleotide groups are covalently linked (i.e., conjugated) to the sense strand or antisense strand. In some embodiments, the α-ENaC RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any duplex ID number presented herein. In some embodiments, the α-ENaC RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any duplex ID number presented herein and a targeting group, a linking group, and / or other non-nucleotide groups, wherein the targeting group, the linking group, and / or other non-nucleotide groups are covalently linked to the sense strand or the antisense strand.

[0316] In some embodiments, the α-ENaC RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex of Table 2 or Table 5, and further comprises a targeting group. In some embodiments, the α-ENaC RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex of Table 2 or Table 5, and further comprises one or more αvβ6 integrin targeting ligands.

[0317] In some embodiments, the α-ENaC RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex of Table 2 or Table 5, and further comprises a targeting group that is an integrin targeting ligand. In some embodiments, the α-ENaC RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex of Table 2 or Table 5, and further comprises one or more αvβ6 integrin targeting ligands or a cluster of αvβ6 integrin targeting ligands (e.g., a tridentate αvβ6 integrin targeting ligand).

[0318] In some embodiments, the α-ENaC RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes of Table 5.

[0319] In some embodiments, the α-ENaC RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any antisense strand / sense strand duplex of Table 5, and further comprises an integrin targeting ligand.

[0320] In some embodiments, the α-ENaC RNAi agent comprises, consists of, or consists essentially of any duplex of Table 5.

[0321] Table 5. α-ENaC RNAi agent duplexes with corresponding sense and antisense strand ID numbers

[0322]

[0323]

[0324]

[0325] In some embodiments, the α-ENaC RNAi agent is prepared or provided as a salt, mixed salt, or free acid.After delivery to cells expressing α-ENaC genes, the RNAi agents described herein inhibit or knock down the expression of one or more α-ENaC genes in vivo and / or in vitro.

[0326] Targeting groups, linkers, pharmacokinetic (PK) modifiers, and delivery vehicles

[0327] In some embodiments, the α-ENaC RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to, the following: a targeting group, a linking group, a pharmacokinetic (PK) modifier, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance the targeting, delivery, or connection of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group can be covalently linked to the 3' and / or 5' end of the sense strand and / or antisense strand. In some embodiments, the α-ENaC RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the α-ENaC RNAi agent. The non-nucleotide group can be directly or indirectly linked to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via an unstable, cleavable, or reversible bond or linker.

[0328] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached to improve the cell or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi agent.

[0329] The targeting group or targeting moiety enhances the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which it is connected, to improve the cell-specific (including organ-specific in some cases) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. The targeting group may be monovalent, divalent, trivalent, tetravalent, or have a higher valence for the target it is directed to. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules. In some embodiments, a linker, such as a PEG linker or one, two or three abasic and / or ribitol (abasic ribose) residues (which can be used as a linker in some cases), is used to connect the targeting group to the RNAi agent. In some embodiments, the targeting group comprises an integrin targeting ligand.

[0330] The α-ENaC RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5'-end and / or 3'-end. The reactive groups can then be used to attach targeting moieties using methods typical in the art.

[0331] For example, in some embodiments, the α-ENaC RNAi agents disclosed herein are synthesized to have an NH2-C6 group at the 5'-terminus of the sense strand of the RNAi agent. The terminal amino group can then be reacted with, for example, a group comprising an αvβ6 integrin targeting ligand to form a conjugate. In some embodiments, the α-ENaC RNAi agents disclosed herein are synthesized to have one or more alkyne groups at the 5'-terminus of the sense strand of the RNAi agent. The terminal alkyne group can then be reacted with, for example, a group comprising an αvβ6 integrin targeting ligand to form a conjugate.

[0332] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of the αvβ6 integrin targeting ligand promotes cell-specific targeting of cells having αvβ6 on their respective surfaces, and the binding of the integrin targeting ligand can promote the entry of the therapeutic agent (such as an RNAi agent) to which it is attached into cells (such as epithelial cells, including lung epithelial cells and kidney epithelial cells). The integrin targeting ligand can be monomeric or monovalent (e.g., having a single integrin targeting moiety) or polymeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' end of the RNAi oligonucleotide using methods known in the art. The preparation of the targeting group (such as an αvβ6 integrin targeting ligand) is described, for example, in International Patent Application Publication No. WO 2018 / 085415 and U.S. Provisional Patent Application Nos. 62 / 580398 and 62 / 646739, the contents of each of which are incorporated herein in their entirety.

[0333] Embodiments of the present disclosure include pharmaceutical compositions for delivering α-ENaC RNAi agents to lung epithelial cells in vivo. Such pharmaceutical compositions may include, for example, α-ENaC RNAi agents conjugated to targeting groups comprising integrin targeting ligands. In some embodiments, the integrin targeting ligand consists of an αvβ6 integrin ligand.

[0334] In some embodiments, the linking group is conjugated to the RNAi agent. The linking group promotes the covalent connection of the RNAi agent to the targeting group, the pharmacokinetic modulator, the delivery polymer or the delivery vehicle. The linking group may be connected to the 3' and / or 5' end of the sense strand or antisense strand of the RNAi agent. In some embodiments, the linking group is connected to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to: Alk-SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6 and C6-SS-Alk-Me, reactive groups (such as primary amines and alkynes), alkyls, abasic residues / nucleotides, amino acids, triacetylene functionalized groups, ribitols and / or PEG groups.

[0335] A linker or connecting group is a connection between two atoms that connects a target chemical group (such as an RNAi agent) or fragment to another target chemical group (such as a targeting group, a pharmacokinetic modulator, or a delivery polymer) fragment via one or more covalent bonds. Unstable connections contain unstable bonds. The connection may optionally include a spacer, which increases the distance between the two connected atoms. The spacer may further increase the flexibility and / or length of the connection. Spacers include (but are not limited to) alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl; each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and carbohydrates. Spacers are well known in the art, and the preceding list is not meant to limit the scope of the description.

[0336] In some embodiments, the targeting group is connected to the α-ENaC RNAi agent without the use of an additional linker. In some embodiments, the targeting group is designed with a linker that is readily present to facilitate connection to the α-ENaC RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, the same linker can be used to connect the two or more RNAi agents to their respective targeting groups. In some embodiments, when two or more RNAi agents are included in the composition, different linkers are used to connect the two or more RNAi agents to their respective targeting groups.

[0337] Any of the α-ENaC RNAi agent nucleotide sequences listed in Tables 2, 3, and 4, whether modified or unmodified, may contain 3' and / or 5' targeting groups, linking groups, and / or pharmacokinetic modulators. Any of the α-ENaC RNAi agent sequences listed in Tables 3 and 4 or described elsewhere herein that contain 3' or 5' targeting groups, linking groups, or pharmacokinetic modulators may not contain 3' or 5' targeting groups, linking groups, or pharmacokinetic modulators, or may contain different 3' or 5' targeting groups, linking groups, or pharmacokinetic modulators (including but not limited to those shown in Table 6). Any of the α-ENaC RNAi agent duplexes listed in Table 5, whether modified or unmodified, may further comprise a targeting group or linking group (including but not limited to those shown in Table 6), and the targeting group or linking group may be attached to the 3' or 5' end of the sense strand or antisense strand of the α-ENaC RNAi agent duplex.

[0338] Some examples of targeting groups and linking groups are provided in Table 6.

[0339] Table 6. Structures representing various modified nucleotides, targeting groups, and linker groups

[0340]

[0341]

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

[0353]

[0354] Alternatively, other linking groups known in the art may be used.

[0355] In some embodiments, a delivery vehicle can be used to deliver the RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves the delivery of an RNAi agent to a cell or tissue. The delivery vehicle may include or consist of, but is not limited to, a polymer (such as an amphiphilic polymer, a membrane active polymer), a peptide, melittin, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

[0356] In some embodiments, the RNAi agent can be combined with a lipid, nanoparticle, polymer, liposome, micelle, DPC, or other delivery system available in the art. The RNAi agent can also be chemically conjugated to a targeting group, a lipid (including but not limited to cholesterol and cholesterol-based derivatives), a nanoparticle, a polymer, a liposome, micelle, DPC (see, e.g., WO 99 / 05666).

[0357] 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference) or other delivery systems available in the art.

[0358] Pharmaceutical compositions and preparations

[0359] The α-ENaC RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicaments"). In some embodiments, the pharmaceutical composition comprises at least one α-ENaC RNAi agent. These pharmaceutical compositions are particularly useful in inhibiting the expression of α-ENaC mRNA in a target cell, cell population, tissue, or organism. The pharmaceutical composition can be used to treat a subject suffering from a disease, disorder, or condition that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. The pharmaceutical composition can be used to treat a subject at risk of suffering from a disease or disorder that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method comprises administering an α-ENaC RNAi agent linked to a targeting ligand described herein to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising an α-ENaC RNAi agent to form a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject (including humans).

[0360] Pharmaceutical compositions comprising α-ENaC RNAi agents and methods disclosed herein reduce target mRNA levels in cells, cell populations, cell populations, tissues, organs, or subjects, including inhibiting the expression of α-ENaC RNAi in a subject by administering to the subject a therapeutically effective amount of an α-ENaC RNAi agent described herein. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder mediated at least in part by ENaC expression. In some embodiments, the subject has been previously identified or diagnosed as having increased ENaC activity in one or more cells or tissues. In some embodiments, the subject has been previously diagnosed with one or more respiratory diseases, such as cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory infections, primary ciliary dyskinesia, and lung cancer cystic fibrosis. In some embodiments, the subject has been previously diagnosed with one or more eye diseases (such as dry eyes). In some embodiments, the subject suffers from symptoms associated with one or more respiratory diseases associated with or caused by increased ENaC activity.

[0361] In some embodiments, the pharmaceutical compositions comprising the α-ENaC RNAi agents are used to treat or manage clinical manifestations that benefit from inhibition of ENaC expression in a subject. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any disclosed α-ENaC RNAi agent can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0362] The pharmaceutical compositions comprising α-ENaC RNAi agents can be used to treat at least one symptom in a subject suffering from a disease or disorder that would benefit from reduction or inhibition of α-ENaC RNAi expression. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising α-ENaC RNAi agents, thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more α-ENaC RNAi agents, thereby preventing or inhibiting at least one symptom.

[0363] The route of administration is the route by which the α-ENaC RNAi agent contacts the body. In general, methods for administering drugs, oligonucleotides, and nucleic acids for treating mammals are well known in the art and can be applied to administering the compositions described herein. The α-ENaC RNAi agents disclosed herein can be administered by any suitable route in a formulation suitable for a particular route. Thus, in some embodiments, the pharmaceutical compositions described herein are administered by inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration. In some embodiments, the pharmaceutical compositions can be administered, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally, or by local injection.

[0364] Pharmaceutical compositions comprising α-ENaC RNAi agents described herein can be delivered to cells, cell groups, tissues or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) may be suitable for use with the compositions described herein. For example, delivery may be by topical administration (e.g., direct injection, implantation or topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal or topical (including buccal and sublingual) administration. In some embodiments, the composition is administered by inhalation, intranasal administration, oropharyngeal aspiration administration or intratracheal administration. For example, in some embodiments, it is desired that the α-ENaC RNAi agent described herein inhibit the expression of the α-ENaC gene in lung epithelial cells, for which administration by inhalation (e.g., by an inhaler device, such as a metered dose inhaler or a nebulizer, such as a jet or vibrating mesh nebulizer or a soft mist inhaler) is particularly suitable and advantageous.

[0365] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients.The pharmaceutical compositions described herein are formulated for administration to a subject.

[0366] The pharmaceutical composition or medicament used herein comprises a pharmacologically effective amount of at least one of the therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances that are intentionally included in the drug delivery system in addition to active pharmaceutical ingredients (API, therapeutic products, such as α-ENaC RNAi agents). Excipients do not or are not intended to exert therapeutic effects at the intended dose. Excipients may play the following roles: a) assist in the handling of the drug delivery system during preparation, b) protect, support or enhance the stability, bioavailability or patient acceptability of the API; c) assist in product identification; and / or d) enhance the overall safety, effectiveness or delivery of the API during storage or use. Any other attribute.

[0367] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, expanders, fillers, flavoring agents, glidants, wetting agents, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, waterproofing agents, and wetting agents.

[0368] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, In some embodiments, the present invention relates to a composition comprising a phosphate buffered saline (PBS) or ELTM (BASF, Parsippany, NJ). The composition should be stable under the conditions of preparation and storage, and should be stored to prevent the contamination of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol) and suitable mixtures thereof. Suitable fluidity can be maintained, for example, by using a coating (such as lecithin), by maintaining the required particle size in the case of a dispersion, and by using a surfactant. In many cases, it is preferred to include an isotonic agent in the composition, such as a sugar, a polyol (such as mannitol, sorbitol) and sodium chloride. By including an agent (such as aluminum monostearate and gelatin) that delays absorption in the composition, the extended absorption of the injectable composition can be achieved.

[0369] Sterile injectable solutions can be prepared by incorporating the desired amount of the active compound into an appropriate solvent together with the desired one or combination of the above-mentioned ingredients, followed by filtration sterilization. Typically, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the desired other ingredients from those described above. In the case of sterile powders for the preparation of sterile injectable solutions, preparation methods include vacuum drying and freeze drying to produce a powder of the active ingredient plus any additional desired ingredients from a previously sterile filtered solution thereof.

[0370] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for intra-articular and ophthalmic administration.

[0371] The preparation suitable for inhalation administration can be prepared by mixing the active compound of the desired amount into a suitable solvent and then aseptically filtering. Generally, the preparation for inhalation administration is a sterile solution at physiological pH, and has low viscosity (<5cP). Salt can be added to the preparation to balance tension. In some cases, a surfactant or cosolvent can be added to increase the solubility of the active compound and improve aerosol properties. In some cases, an excipient can be added to control viscosity to ensure the size and distribution of the atomized droplets.

[0372] The active compound can be prepared with a carrier that will protect the compound from rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. The preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as described in U.S. Patent No. 4,522,811.

[0373] The α-ENaC RNAi agent can be formulated as a composition in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suitable as unit dosages for subjects to be treated, each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect together with the required pharmaceutical carrier. The specifications for the dosage unit forms of the present disclosure are dictated by or directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the limitations inherent in the art of formulating such active compounds for the treatment of individuals.

[0374] The pharmaceutical composition may contain other additional components that are commonly found in pharmaceutical compositions. Such additional components include (but are not limited to): antipruritic agents, astringents, local anesthetics or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). It is also envisioned that cells, tissues or isolated organs expressing or containing the RNAi agents defined herein can be used as "pharmaceutical compositions". "Pharmacologically effective amount", "therapeutically effective amount" or simply "effective amount" as used herein refers to the amount of RNAi agent that produces a pharmacological, therapeutic or preventive result.

[0375] In some embodiments, the methods disclosed herein further include the step of administering a second therapeutic agent or treatment in addition to administering a RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another α-ENaC RNAi agent (e.g., an α-ENaC RNAi agent that targets a different sequence within the α-ENaC target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0376] Typically, the effective amount of the α-ENaC RNAi agent disclosed herein will be in the range of about 0.0001-about 20 mg / kg body weight / day, for example, about 0.001-about 3 mg / kg body weight / day. In some embodiments, the effective amount of the α-ENaC RNAi agent will be in the range of about 0.001-about 0.500 mg / kg body weight per dose. In some embodiments, the effective amount of the α-ENaC RNAi agent will be in the range of about 0.001-about 0.100 mg / kg body weight per dose. In some embodiments, the effective amount of the α-ENaC RNAi agent will be in the range of about 0.001-about 0.050 mg / kg body weight per dose. The amount administered may also depend on variables such as the overall health status of the patient, the relative biological efficacy of the delivered compound, the pharmaceutical formulation, the presence and type of excipients in the formulation, and the route of administration. Moreover, it should be understood that the initial dose administered may be increased to exceed the above upper limit level to quickly reach the desired blood level or tissue level, or the initial dose may be less than the optimal dose.

[0377] To treat a disease or form a medicament or composition for treating a disease, the pharmaceutical compositions comprising the α-ENaC RNAi agent described herein can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to, a second or additional RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.

[0378] When the α-ENaC RNAi agent is added to a pharmaceutically acceptable excipient or adjuvant, it can be packaged into a kit, container, package or dispenser. The pharmaceutical composition described herein can be packaged in a dry powder or aerosol inhaler, other metered dose inhaler, nebulizer, pre-filled syringe or vial.

[0379] Treatment and methods of suppressing expression

[0380] The α-ENaC RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) that would benefit from reduction and / or inhibition of α-ENaC RNAi expression.

[0381] In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) with diseases or disorders including, but not limited to, cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory infections, primary ciliary dyskinesia, and lung cancer cystic fibrosis and / or dry eye. Treatment of the subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more α-ENaC RNAi agents described herein. The subject can be a human, a patient, or a human patient. The subject can be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions described herein can be to a human or an animal.

[0382] Increased ENaC activity is known to promote dehydration of airway surface fluid and impair mucociliary clearance. In some embodiments, the α-ENaC RNAi agent is used to treat at least one symptom mediated at least in part by ENaC activity levels in a subject. The subject is administered a therapeutically effective amount of any one or more of the α-ENaC RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the RNAi agents, thereby treating the subject by preventing or inhibiting at least one symptom.

[0383] In certain embodiments, the disclosure provides methods for treating a disease, disorder, condition or pathological state mediated at least in part by α-ENaC gene expression in a patient in need thereof, wherein the method comprises administering to the patient any one of the α-ENaC RNAi agents described herein.

[0384] In some embodiments, the α-ENaC RNAi agent is used to treat or manage a clinical manifestation or pathological condition in a subject, wherein the clinical manifestation or pathological condition is mediated at least in part by ENaC expression. The subject is administered a therapeutically effective amount of one or more α-ENaC RNAi agents described herein or a composition containing an α-ENaC RNAi agent. In some embodiments, the method comprises administering to the subject to be treated a composition comprising an α-ENaC RNAi agent described herein.

[0385] In some embodiments, gene expression levels and / or mRNA levels of an α-ENaC gene are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% in certain epithelial cells of a subject administered the α-ENaC RNAi agent relative to the subject prior to administration of the α-ENaC RNAi agent or relative to a subject that did not receive the α-ENaC RNAi agent. In some embodiments, ENaC levels or ENaC channel activity levels are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% in certain epithelial cells of a subject administered the α-ENaC RNAi agent relative to the subject prior to administration of the α-ENaC RNAi agent or relative to a subject that did not receive the α-ENaC RNAi agent. Gene expression levels, protein levels, and / or mRNA levels in a subject can be reduced in a cell, cell population, and / or tissue of the subject. In some embodiments, the level of α-ENaC RNAi is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% in certain epithelial cells of a subject that has been administered the α-ENaC RNAi agent relative to a subject prior to administration of the α-ENaC RNAi agent or relative to a subject that has not received the α-ENaC RNAi agent. In some embodiments, the level of the ENaC heterotrimeric protein complex is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% in certain epithelial cells of a subject that has been administered the α-ENaC RNAi agent relative to a subject prior to administration of the α-ENaC RNAi agent or relative to a subject that has not received the α-ENaC RNAi agent. The subject's ENaC level may be reduced in a cell, cell population, tissue, blood, and / or other fluid of the subject.For example, in some embodiments, the level of α-ENaC mRNA and / or ENaC heterotrimeric protein complex is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% in lung epithelial cells of a subject that has been administered the α-ENaC RNAi agent relative to the subject prior to administration of the α-ENaC RNAi agent or relative to a subject that has not received the α-ENaC RNAi agent. In some embodiments, the level of α-ENaC mRNA and / or ENaC heterotrimeric protein complex and / or ENaC channel activity is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% in a subset of lung epithelial cells, such as airway epithelial cells, in a subject that has been administered the α-ENaC RNAi agent relative to the subject prior to administration of the α-ENaC RNAi agent or relative to a subject that has not received the α-ENaC RNAi agent.

[0386] Reduction in gene expression, mRNA and protein levels can be evaluated by any method known in the art. Reduction or reduction in α-ENaC mRNA levels, ENaC channel activity levels and / or ENaC heterotrimeric protein complex levels are collectively referred to herein as reduction or decrease in α-ENaC or inhibition or reduction in α-ENaC gene expression. The examples described herein illustrate known methods for evaluating inhibition of α-ENaC gene expression.

[0387] Cells, tissues, organs and non-human organisms

[0388] Cells, tissues, organs, and non-human organisms comprising at least one α-ENaC RNAi agent described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering a RNAi agent to the cell, tissue, organ, or non-human organism.

[0389] The embodiments and items provided above are now illustrated by the following non-limiting examples.

[0390] Example

[0391] Example 1. Synthesis of α-ENaC RNAi Agents.

[0392] The α-ENaC RNAi agent duplexes shown in Table 5 were synthesized according to the following method:

[0393] A. Synthesis. The sense and antisense strands of the α-ENaC RNAi agent were synthesized on a solid phase for oligonucleotide synthesis using the phosphoramidite technique. (Bioautomation), (Bioautomation) or OP Pilot 100 (GE Healthcare). or The PCR products were obtained from Prime Synthesis, Aston, PA, USA. All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used included the following: (5'-O-dimethoxytrityl-N 6 -(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N 2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. 2'-Deoxy-2'-fluorophosphoramidite has the same protecting group as 2'-O-methyl RNA phosphoramidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite was purchased from Glen Research (Virginia). Inverted abasic (3′-O-dimethoxytrityl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5′-(4,4′-dimethoxytrityl)-N6-(benzoyl)-2′,3′-cleaved-adenosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-(4,4′-dimethoxytrityl)-N-acetyl-2′,3′-cleaved-cytosine , 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-sec-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 5'-(4,4'-dimethoxytrityl)-2',3'-sec-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. TFA amino-linked phosphoramidites are also commercially available (ThermoFisher).

[0394] The phosphoramidite containing the triyne was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves were added. 5-Benzylthio-1H-tetrazolium (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazolium (ETT, 250 mM in acetonitrile) was used as the activator solution. The coupling times were 10 min (RNA), 90 sec (2'O-Me) and 60 sec (2'F). To introduce the phosphorothioate linkage, a 100 mM solution of 3-phenyl 1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0395] Alternatively, the triyne moiety is introduced post-synthesis (see Section E below). For this approach, the sense strand is functionalized with a 5' and / or 3' terminal nucleotide containing a primary amine. The TFA amino linker arm phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves were added. 5-Benzylthio-1H-tetrazolium (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazolium (ETT, 250 mM in acetonitrile) was used as the activator solution. The coupling times were 10 min (RNA), 90 sec (2'O-Me) and 60 sec (2'F). To introduce the phosphorothioate linkage, a 100 mM solution of 3-phenyl 1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0396] B. Cleavage and deprotection of support-bound oligomers. After completion of solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt.% methylamine and 28%-31% ammonium hydroxide solution (Aldrich) in water at 30° C. for 1.5 hours. The solution was evaporated and the solid residue was reconstituted with water (see below).

[0397] C. Purification. Crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, and contained 20% acetonitrile, and buffer B was the same as buffer A (1.5 M sodium chloride was added). UV traces at 260 nm were recorded. Appropriate fractions were merged and then run on size exclusion HPLC using a GE Healthcare XK 16 / 40 column equipped with Sephadex G-25 fine powder and 100 mM ammonium bicarbonate (pH 6.7) and 20% acetonitrile or filtered water running buffer. Alternatively, the combined fractions were desalted and replaced with appropriate buffer or solvent systems through tangential flow filtration.

[0398] D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1×PBS (phosphate buffered saline, 1×, Corning, Cellgro) to form RNAi agents. Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution on a UV-Vis spectrometer in 1×PBS. The absorbance of the solution at 260nm was then multiplied by the conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise stated, the conversion factor used was 0.037 mg / (mL·cm).

[0399] E. Conjugation of a triyne linker. Before or after annealing, the 5' or 3' amine functionalized sense strand is conjugated to a triyne linker. An example triyne linker structure that can be used to form the constructs disclosed herein is as follows: The following describes the conjugation of the triyne linker to the annealed duplex: the amine-functionalized duplex was dissolved in 90% DMSO / 10% H2O at ~50-70 mg / mL. 40 equivalents of triethylamine were added, followed by 3 equivalents of triyne-PNP. Once complete, the conjugate was precipitated twice with a solvent system of 1x phosphate buffered saline / acetonitrile (1:14 ratio) and dried.

[0400] F. Conjugation of targeting ligands. Either before or after annealing, the 5' or 3' tridentate alkyne functionalized sense strand is conjugated to the targeting ligand. The following example describes the conjugation of the targeting ligand to the annealed duplex: Prepare a stock solution of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and 2 M sodium ascorbate solution in deionized water. Prepare a 75 mg / mL solution of the targeting ligand in DMSO. Add 25 μL of 1 M Hepes pH 8.5 buffer to a 1.5 mL centrifuge tube containing the triyne functionalized duplex (3 mg, 75 μL, 40 mg / mL, ~15000 g / mol in deionized water). After vortexing, add 35 μL of DMSO and vortex the solution. The targeting ligand was added to the reaction (6 equivalents / duplex, 2 equivalents / alkyne, ~15 μL) and the solution was vortexed. The pH was checked using pH paper and confirmed to be pH ~8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5M THPTA was mixed with 10 uL of 0.5M Cu(II)SO4·5H2O, vortexed and incubated at room temperature for 5 minutes. After 5 minutes, THPTA / Cu solution (7.2 μL, 6 equivalents of 5:1 THPTA:Cu) was added to the reaction vial and vortexed. Immediately thereafter, 2M ascorbate (5 μL, 50 equivalents per duplex, 16.7 per alkyne) was added to the reaction vial and vortexed. Once the reaction was complete (generally completed within 0.5-1 hour), the reactants were immediately purified by non-denaturing anion exchange chromatography.

[0401] Example 2. Intratracheal administration of α-ENaC RNAi agents in mice in vivo

[0402] To evaluate the in vivo activity of α-ENaC RNAi agents, male ICR mice were administered 50 microliters of isotonic saline vehicle (used as a control) or 5 mg / kg of one of the following α-ENaC RNAi agents formulated in isotonic saline without a conjugated ligand (i.e., "naked RNAi agents"): AD04019, AD04020, AD04021, AD04022, AD04023, AD04024, AD04025, or AD04026 via a microsprayer device suitable for intratracheal (IT) administration (Penn Century, Philadelphia, PA) on days 1 and 2 of the study. (See, e.g., Tables 3-6 for information on the chemical structures of the chemically modified duplexes used in this example).

[0403] Four or five mice were dosed per group. Mice were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0404] Figure 1 Relative expression of the identified α-ENaC RNAi agent composition (AD04019, AD04020, AD04021, AD04022, AD04023, AD04024, AD04025, and AD04026) is shown, with each RNAi agent demonstrating significant reduction in lung α-ENaC expression compared to vehicle control.

[0405] Example 3. Intratracheal administration of α-ENaC RNAi agents in mice in vivo

[0406] On days 1 and 2 of the study, male ICR mice were administered 50 microliters of isotonic saline vehicle (used as a control) or 3 mg / kg of α-ENaC RNAi agents (i.e., AD04025 or AD04858 (see, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example) formulated in isotonic saline via a micronebulizer device suitable for intratracheal (IT) administration (PennCentury, Philadelphia, PA). Four or five mice were dosed per group. Mice were sacrificed on day 9 of the study, and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0407] Figure 2Relative expression of α-ENaC RNAi agents AD04025 and AD04858 is shown, with both RNAi agents showing significant reductions in lung α-ENaC expression compared to control.

[0408] Example 4. Intratracheal administration of α-ENaC RNAi agents conjugated and unconjugated to epithelial cell targeting ligands in rats in vivo

[0409] On days 1 and 2 of the study, male Sprague Dawley rats were given 200 microliters of 0.5 mg / kg, 1.5 mg / kg, or 5 mg / kg of α-ENaC RNAi agent in isotonic saline via a micronebulizer device suitable for intratracheal (IT) administration (PennCentury, Philadelphia, PA). Five (5) rats were administered per group. Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0410] Figure 3 Relative expression of α-ENaC RNAi agent AD04025 and AD04025-conjugate is shown. AD04025-conjugate is synthesized by the following method: a peptide-based integrin targeting ligand with affinity for αvβ6 integrin is attached to the amino group added to the 5' end of the sense strand of the RNAi agent via a masked poly-L-lysine (PLL) scaffold after synthesis. (For chemical structure information of the chemically modified duplexes used in this example, see, e.g., Tables 3-6). Although both naked RNAi agent and RNAi agent-conjugate showed significant reductions in lung α-ENaC expression compared to baseline measurements, AD04025-conjugate showed numerical improvements in knockdown levels at each of the three dose levels measured (0.5 mg / kg, 1.5 mg / kg, and 5 mg / kg), with particularly significant improvements at a dose of 1.5 mg / kg (78% knockdown with ligand versus 47% knockdown without ligand).

[0411] Example 5. In vivo oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0412] On day 1 of the study, male Sprague Dawley rats were dosed with 200 microliters via oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups as described in Table 7:

[0413] Table 7. Rats administered in Example 5

[0414]

[0415] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0416] A tridentate small molecule αvβ6 epithelial cell targeting ligand called Tri-SM2 in group 2-7 has Figure 4 The structure shown is conjugated to the RNAi agent via the terminal amine at the 5' end of the sense strand (ie, by forming a covalent bond with the terminal NH2-C6 group).

[0417] Five (5) rats were dosed per group (n=5). Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0418] Table 8. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 5

[0419]

[0420] As shown in Table 8 above, each α-ENaC RNAi agent showed a decrease in mRNA expression in rats compared to the control. For example, AD05347, which contains a cyclopropyl-phosphonate group at the 5' end of the antisense strand, showed an average decrease in mRNA of about 59% (0.411) compared to the control. Further, each of the other α-ENaC RNAi agents showed a decrease in rENaC mRNA of at least about 27% compared to the control.

[0421] Example 6. Intratracheal administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats in vivo

[0422] On day 1 of the study, male Sprague Dawley rats were administered 200 microliters of isotonic saline vehicle (used as a control) or one of the following α-ENaC RNAi agents according to the following dosing groups as described in Table 9 via a microsprayer device suitable for intratracheal (IT) administration (Penn Century, Philadelphia, PA):

[0423] Table 9. Rats administered in Example 6

[0424]

[0425]

[0426] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0427] A tridentate small molecule αvβ6 epithelial cell targeting ligand called Tri-SM1 in groups 2, 5, and 6 has Figure 5 The structure shown is conjugated to the RNAi agent via the terminal amine at the 5' end of the sense strand (i.e., by forming a covalent bond with the terminal NH2-C6 group). For groups 3 and 4, the tridentate small molecule ligands in groups 3 and 4 are replaced with a linker containing a cysteine-PEG2 connection as shown below Figure 5 Glutaric acid linker shown:

[0428]

[0429] Five (5) rats (n=5) were dosed in each of Groups 1, 2, 3, 4, 5 and 7, and four (4) rats were dosed in Group 6. Rats were sacrificed on day 9 of the study, and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0430] Table 10. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 6

[0431]

[0432] As shown in Table 10 above, each α-ENaC RNAi agent showed a decrease in mRNA expression in rats compared to the control. In addition, the use of a tridentate small molecule αvβ6 epithelial cell targeting ligand showed a similar decrease in mRNA expression when compared to a peptide-based αvβ6 epithelial cell targeting ligand further comprising a 20 kDa PEG PK modifier.

[0433] Example 7. In vivo oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0434] On Day 1 of the study, male Sprague Dawley rats were dosed with 200 microliters via oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups as described in Table 11:

[0435] Table 11. Rats administered in Example 7

[0436]

[0437] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0438] The tridentate small molecule αvβ6 epithelial cell targeting ligand, called Tri-SM2, in each of Groups 2-6 and 8-10 has Figure 4 The structure shown is conjugated to the RNAi agent via the terminal amine at the 5' end of the sense strand (ie, by forming a covalent bond with the terminal NH2-C6 group). Group 7 ligands comprise a cysteine ​​linker group (see, eg, Example 6).

[0439] Four (4) rats (n=4) were dosed in groups 1, 2, 3, 4, 5, 6, 7 and 9, and three (3) rats (n=3) were dosed in groups 8 and 10. Rats were sacrificed on day 9 of the study, and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0440] Table 12. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 7

[0441]

[0442] As shown in Table 12 above, each α-ENaC RNAi agent showed a decrease in mRNA expression in rats compared to the control. For example, AD05347 showed a mean rENaC mRNA expression decrease of about 54% (0.457) compared to the control.

[0443] Example 8. In vivo oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0444] On Day 1 of the study, male Sprague Dawley rats were dosed with 200 microliters via oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups as described in Table 13:

[0445] Table 13. Rats administered in Example 8

[0446]

[0447]

[0448] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0449] The tridentate small molecule αvβ6 epithelial cell targeting ligand in groups 2 and 4, called Tri-SM2, has Figure 4 The structures shown; the tridentate small molecule αvβ6 epithelial cell targeting ligand in groups 3 and 8, called Tri-SM6.1, has Figure 6 The structure shown; the tridentate small molecule αvβ6 epithelial cell targeting ligand in group 5, called Tri-SM9, has Figure 7 The structure shown; the tridentate small molecule αvβ6 epithelial cell targeting ligand in group 6, called Tri-SM6, has Figure 8 The structure shown; the tridentate small molecule αvβ6 epithelial cell targeting ligand in group 7, called Tri-SM8, has Fig. 9 The structure shown; the tridentate small molecule αvβ6 epithelial cell targeting ligand in group 9, called Tri-SM10, has Fig.10 The structure shown; and a tridentate small molecule αvβ6 epithelial cell targeting ligand called Tri-SM11 in Group 10 has Fig.11 Each tridentate small molecule αvβ6 epithelial cell targeting ligand was added by conjugation via the amino group on the 5' end of each α-ENaC RNAi agent.

[0450] Four (4) rats were dosed per group (n=4). Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0451] Table 14. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 8

[0452]

[0453]

[0454] As shown in Table 14 above, each α-ENaC RNAi agent showed a decrease in mRNA expression in rats compared to the control. For example, AD05347-Tri-SM6.1 (Group 3) showed a mean rENaC mRNA expression decrease of about 64% (0.358) compared to the control, and AD05453-Tri-SM6.1 (Group 8) showed a mean rENaC mRNA expression decrease of 55% (0.454) compared to the control. Further, in the absence of 5' terminal cyclopropyl-phosphonate modification on the antisense strand, the average rENaC mRNA expression of Groups 8 and 9 was reduced by about 55% (0.454), and in the case of 5' antisense cyclopropyl-phosphonate modification, an inhibitory effect similar to Group 2 was shown, with an average rENaC mRNA expression decrease of about 53% (0.469). In addition, as observed in Groups 4, 6, 8, 9, and 10, the tridentate small molecule αvβ6 epithelial cell targeting ligands were similar or in some cases numerically superior to Group 11 (e.g., Groups 8 and 9 comprising Tri-SM6.1 and Tri-SM10), which utilized tridentate peptide-based αvβ6 epithelial cell targeting ligands known to have affinity for integrin αvβ6 (see International Patent Application Publication No. WO 2018 / 085415 for chemical structure information). Fig.11 ).

[0455] Example 9. In vivo oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0456] On day 1 of the study, male Sprague Dawley rats were dosed with 200 microliters via oropharyngeal ("OP") aspiration using a pipette, which included the following dosing groups as described in Table 15:

[0457] Table 15. Rats administered in Example 9

[0458]

[0459]

[0460] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0461] A tridentate small molecule αvβ6 epithelial cell targeting ligand called Tri-SM6.1 in groups 3 and 5-8 has Figure 6 The structure shown.

[0462] Four (4) rats were dosed per group (n=4). Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0463] Table 16. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 9

[0464]

[0465] As shown in Table 16 above, each α-ENaC RNAi agent showed a decrease in mRNA expression in rats compared to the control. Further, AD05453 showed only about 29% inhibition (0.713) when given naked, but when conjugated to the Tri-SM6.1 integrin targeting ligand, it showed a 44% decrease in average rENaC mRNA expression (0.562).

[0466] Example 10. In vivo oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0467] On day 1 of the study, male Sprague Dawley rats were dosed with 200 microliters via oropharyngeal ("OP") aspiration using a pipette, which included the following dosing groups as described in Table 17:

[0468] Table 17. Rats administered in Example 10

[0469]

[0470] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0471] A tridentate small molecule αvβ6 epithelial cell targeting ligand in group 2-10, called Tri-SM6.1, has Figure 6 The structure shown.

[0472] Four (4) rats were dosed per group (n=4). Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0473] Table 18. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 10

[0474]

[0475]

[0476] As shown in Table 18 above, each of the α-ENaC RNAi agents showed a decrease in mRNA expression in rats compared to controls.

[0477] Example 11. In vivo oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0478] On day 1 of the study, male Sprague Dawley rats were dosed with 200 microliters via oropharyngeal ("OP") aspiration using a pipette, which included the following dosing groups as described in Table 19:

[0479] Table 19. Rats administered in Example 11

[0480]

[0481] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0482] A tridentate small molecule αvβ6 epithelial cell targeting ligand called Tri-SM6.1 in Group 2-7 has Figure 6 The structure shown.

[0483] Five (5) rats were dosed per group (n=5). Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0484] Table 20. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 11

[0485]

[0486] As shown in Table 20 above, each of the α-ENaC RNAi agents showed a decrease in mRNA expression in rats compared to controls.

[0487] Example 12. In vivo oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0488] On Day 1 of the study, male Sprague Dawley rats were dosed with 200 microliters via oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups as described in Table 21:

[0489] Table 21. Rats administered in Example 12

[0490]

[0491]

[0492] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0493] A tridentate small molecule αvβ6 epithelial cell targeting ligand called Tri-SM6.1 in group 2-13 has Figure 6 The structure shown.

[0494] Four (4) rats were dosed per group (n=4). Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0495] Table 22. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 12

[0496]

[0497] As shown in Table 22 above, each of the α-ENaC RNAi agents showed a decrease in mRNA expression in rats compared to the control.

[0498] Example 13. Dose-ranging study of oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0499] On Day 1 of the study, male Sprague Dawley rats were dosed with 200 microliters via oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups as described in Table 23:

[0500] Table 23. Rats administered in Example 13

[0501]

[0502]

[0503] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0504] The tridentate small molecule αvβ6 epithelial cell targeting ligand in group 2-8, called Tri-SM6.1, has Figure 6 The structure shown.

[0505] Six (6) rats (n=5) were dosed in each of Groups 1, 2, 3, 4, 7, and 8. Four rats (n=4) were dosed in Groups 5 and 6. Rats were sacrificed on day 9 of the study, and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0506] Table 24. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 13

[0507]

[0508] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0509] As shown in Table 24 above, the α-ENaC RNAi agent AD05453 demonstrated a decrease in mRNA expression in rats at each dose level administered compared to controls.

[0510] Example 14. Intratracheal administration of α-ENaC RNAi agents in mice in vivo

[0511] On the 1st and 2nd day of the study, male ICR mice were given 50 microliters of isotonic saline vehicle (used as a control) or 5 mg / kg of one of the following α-ENaC RNAi agents (i.e., "naked RNAi agents") formulated in isotonic saline without conjugated ligands: AD04025, AD04526, AD04527, AD04528, AD04529, AD04530, AD04531, AD04536 or AD04537 via a microsprayer device (Penn Century, Philadelphia, PA). Four mice (n=4) were administered to each group. Mice were sacrificed on the 9th day of the study, and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0512] Table 25. Average relative expression of mENaC mRNA at sacrifice (day 9) in Example 14

[0513]

[0514] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0515] As shown in Table 25 above, each of the α-ENaC RNAi agents showed a decrease in mRNA expression in rats compared to controls.

[0516] Example 15. Intratracheal administration of α-ENaC RNAi agents in mice in vivo

[0517] On days 1 and 2 of the study, male ICR mice were given 50 microliters of isotonic saline vehicle (used as a control) or 5 mg / kg of one of the following α-ENaC RNAi agents (i.e., "naked RNAi agents") formulated in isotonic saline without a conjugated ligand: AD04025, AD04538, AD04539, AD04532, AD04533, AD04534, AD04535, or AD04540 via a microsprayer device (Penn Century, Philadelphia, PA). (See, e.g., Tables 3-6 for information on the chemical structures of the chemically modified duplexes used in this example).

[0518] Four (4) mice were dosed per group (n=4). Mice were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0519] Table 26. Average relative expression of mENaC mRNA at sacrifice (day 9) in Example 15

[0520]

[0521] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0522] As shown in Table 26 above, the base sequence of each α-ENaC RNAi agent affects the level of ENaC gene inhibition achieved. For example, α-ENaC RNAi agent AD04025 comprises an antisense strand sequence designed to target position 972 of the α-ENaC gene (i.e., nucleotides 1-19 of the antisense strand are designed to be at least partially complementary to the α-ENaC gene (SEQ ID NO: 1) at positions 972-990). In this example, AD04525 achieved the highest level of inhibition of the RNAi agents tested and showed a gene expression knockdown of approximately 55% (0.448) compared to the control. The remaining α-ENaC RNAi agents are designed to target different positions of the gene, including α-ENaC RNAi agents AD04538 (targeting gene position 973), AD04539 (targeting gene position 999), AD04532 (targeting gene position 1000), AD04533 (also targeting gene position 973), AD04534 (also targeting gene position 999), AD04535 (targeting gene position 1291) and AD04540 (targeting gene position 763). As shown above, α-ENaC RNAi agents designed to target different positions of the gene can have different inhibitory activities (e.g., comparing the α-ENaC RNAi knockdown levels of AD04025 (position 972) with AD04538 (position 973) and AD04533 (position 973)). In addition, when comparing α-ENaC RNAi agents at the same position (e.g., AD04539 and AD04534), although both sequences have a basic nucleobase designed to inhibit a gene at the same position (e.g., position 999 of a gene), slight modifications of the basic base sequence and / or inclusion of different modified nucleotides can result in different inhibitory activities, at least numerically.

[0523] Example 16. Intratracheal administration of α-ENaC RNAi agents in rats in vivo

[0524] On days 1 and 2 of the study, male Sprague Dawley rats were administered 200 microliters of isotonic saline vehicle (used as a control) or approximately 3 mg / kg of one of the following α-ENaC RNAi agents formulated in isotonic saline without a conjugated ligand (i.e., "naked RNAi agents"): AD04835, AD04022, AD05116, AD05117, AD05118, or AD05119 via a microsprayer device (Penn Century, Philadelphia, PA). (See, e.g., Tables 3-6 for information on the chemical structures of the chemically modified duplexes used in this example).

[0525] Five (5) rats were dosed per group (n=5). Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0526] Table 27. Average relative expression of rENaC mRNA at sacrifice (day 9) in Example 16

[0527]

[0528] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0529] Table 27 above provides additional data indicating that the base sequence of each α-ENaC RNAi agent affects the level of ENaC gene inhibition achieved. For example, α-ENaC RNAi agents AD04025 and AD04835 each comprise an antisense strand sequence designed to target position 972 of the α-ENaC gene (i.e., nucleotides 1-19 of the antisense strand are designed to be at least partially complementary to the α-ENaC gene (SEQ ID NO: 1) at positions 972-990). Of the α-ENaC RNAi agents tested in this embodiment, these two RNAi agents showed a maximum knockdown level of more than 70%. The remaining α-ENaC RNAi agents are designed to target different positions of the gene, including α-ENaC RNAi agents AD05116 (targeting gene position 944), AD05117 (targeting gene position 945), AD05118 (targeting gene position 1289), and AD05119 (targeting gene position 1579).

[0530] Example 17. Multiple-dose, dose-ranging study of oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0531] Male Sprague Dawley rats were dosed with 200 microliters of 1% dapoxetine on Study Day 1, Study Day 2, and Study Day 3 according to the following dosing groups as described in Table 28, using a pipette for oropharyngeal ("OP") aspiration:

[0532] Table 28. Rats administered in Example 17

[0533]

[0534] (See, e.g., Tables 3-6 for chemical structure information on the chemically modified duplexes used in this example.) As described herein, the same RNAi agent-tridentate small molecule αvβ6 epithelial cell targeting ligand conjugate structure in this example (i.e., Tri-SM6.1-AD05453) can alternatively be synthesized by using a triyne-functionalized linker (TriAlk14) (as shown in AD05924) rather than post-synthesis addition to the terminal amino group (as shown in AD05453). (See also Example 1).

[0535] A tridentate small molecule αvβ6 epithelial cell targeting ligand called Tri-SM6.1 in Group 2-7 has Figure 6 The structure shown.

[0536] Seven (7) rats (n=7) were dosed in each of Groups 1, 2, 3, 4, 5 and 6 and six (6) rats (n=6) were dosed in Group 7. Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0537] Table 29. Average relative expression of rENaC mRNA at sacrifice (day 9) in Example 17

[0538]

[0539] As shown in Table 29 above, the α-ENaC RNAi agent AD05453 showed a decrease in mRNA expression in rats at each dose level administered compared to the control. Further, when the same α-ENaC RNAi agent was used, multiple OP administrations showed signs of further knockdown of rENaC mRNA expression compared to a single administration (e.g., comparing Group 7 of Example 17 with Group 5 of Example 13).

[0540] Example 18. In vivo intratracheal administration of α-ENaC RNAi agents in mice and evaluation of human COPD sputum stability

[0541] To evaluate and compare the activity and stability of known prior art duplexes with the RNAi agents disclosed herein, as disclosed in International Patent Application Publication No. WO 2008 / 152131 to Novartis et al. (see Table 1C therein, ND-9201), duplexes having the following modified structures were synthesized:

[0542] Antisense strand sequence (5'→3'): GAUUUGUUCUGGUUGcAcAdTsdT (SEQ ID NO: 291)

[0543] Sense strand sequence (5'→3'): uGuGcAAccAGAAcAAAucdTsdT (SEQ ID NO: 292)

[0544] (Hereinafter referred to as ND-9201) According to WO 2008 / 152131, ND-9201 exhibits a relatively effective inhibitory effect on α-ENaC gene expression in vitro.

[0545] First, a study was conducted to evaluate the inhibitory activity of α-ENaC in vivo. On the 1st and 2nd days of the study, male ICR mice were given isotonic glucose (D5W) vehicles (used as controls) or about 10 mg / kg of ND-9201 prepared with D5W via a micro-spray device (Penn Century, Philadelphia, PA). Mice were killed on the 9th day, and total RNA was isolated from two lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, standardized to GAPDH expression, and expressed as a score for the vehicle control group. For comparison, male ICR mice were given D5W vehicles (used as controls) or about 5 mg / kg of RNAi agents AD04025 prepared with D5W on the 1st and 2nd days of the study via a micro-spray device (Penn Century, Philadelphia, PA). (For chemical structure information about the chemically modified duplex of AD04025, see, for example, Table 3-6). Mice were similarly sacrificed on day 9, and total RNA was isolated from both lungs after collection and homogenization.α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group.

[0546] For ND-9201, approximately 25% inhibition of mENaC mRNA expression was achieved in mice when dosed at 10 mg / kg on days 1 and 2.

[0547] For AD04025, approximately 65% ​​inhibition of mENaC mRNA expression was achieved in mice when dosed at only 5 mg / kg on days 1 and 2, thus showing a substantial improvement in inhibitory activity over the known prior art duplex ND-9201.

[0548] In addition, stability studies were performed on human sputum taken from patients diagnosed with COPD using ND-9201 and AD04858 (see, e.g., Tables 3-6 for chemical structural information of chemically modified duplexes of AD04858). A solution containing 50 μL sputum and 350 μL lysis buffer was vortexed, and 12.5 μL ND-9201 or AD04858 was added and vortexed briefly every hour. LCMS was performed on the sample to determine the remaining full-length product of both the sense strand and the antisense strand of each molecule over time. After 6 hours, AD04858 showed improved stability because the full-length product present increased by about 20-30% for both the sense strand and the antisense strand.

[0549] Example 19. In vivo study of oropharyngeal aspiration administration of α-ENaC RNAi agents conjugated to epithelial cell targeting ligands in rats

[0550] Male Sprague Dawley rats were dosed with 200 microliters of the following dosing groups as described in Table 30 on Study Day 1 and Study Day 2, using a pipette for transoral ("OP") aspiration:

[0551] Table 30. Rats administered in Example 19

[0552]

[0553] (See, e.g., Tables 3-6 for chemical structure information of the chemically modified duplexes used in this example).

[0554] A tridentate small molecule αvβ6 epithelial cell targeting ligand called Tri-SM6.1 in Group 2-7 has Figure 6 The structure shown.

[0555] Four (4) rats (n=7) were dosed per group. Rats were sacrificed on day 9 of the study and total RNA was isolated from both lungs after collection and homogenization. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0556] Table 31. Average relative expression of rENaC mRNA at the time of sacrifice (day 9) in Example 19

[0557]

[0558]

[0559] In Table 31 above, α-ENaC RNAi agents AD05625 and AD05453 each comprise an antisense strand designed to start targeting the α-ENaC gene at position 972 (see SEQ ID NO: 1); AD05829 comprises an antisense strand designed to start targeting the α-ENaC gene at position 944; AD05831 comprises an antisense strand designed to start targeting the α-ENaC gene at position 973; and AD01289 comprises an antisense strand designed to start targeting the α-ENaC gene at position 1289. Each α-ENaC RNAi agent exhibited an inhibitory effect on gene expression, and RNAi agent AD05453 exhibited a relatively effective inhibitory effect on α-ENaC.

[0560] Example 20. In vivo topical ocular administration of α-ENaC RNAi agents in mice

[0561] To evaluate the ability of α-ENaC RNAi agents to inhibit α-ENaC RNAi expression in the ocular epithelium, CB57Bl / 6 mice (n=3 / group) received topical ocular instillations of saline vehicle or 400 micrograms of AD04858 (in a two microliter volume) twice daily in both eyes for 5 days. (For chemical structure information on the chemically modified duplex of AD04858, see, e.g., Tables 3-6). Mice were sacrificed on day 5 of the study, conjunctival epithelial samples were collected, and total RNA was isolated from tissue homogenates. α-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a fraction of the vehicle control group.

[0562] Following twice daily topical administration of AD048585 for 5 days, conjunctival samples from treated mice expressed significantly less (approximately 24%) α-ENaC mRNA compared to samples from vehicle-treated controls.

[0563] Other Implementations

[0564] It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing description is intended to illustrate rather than limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are within the scope of the appended claims.

Claims

1. A RNAi agent for inhibiting α-ENaC gene expression, comprising: An antisense strand comprising at least 17 consecutive nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 3; and The sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one sequence provided in Table 2 or Table 3.

3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 consecutive nucleotides that differs by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity to the antisense strand over 17 consecutive nucleotides.

4. The RNAi agent of any one of claims 1-3, wherein at least one nucleotide of the α-ENaC RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

5. The RNAi agent of any one of claims 1-3, wherein all or substantially all nucleotides are modified nucleotides.

6. The RNAi agent of any one of claims 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-split ring nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides and 3'-O-methyl nucleotides.

7. The RNAi agent of claim 5, wherein all or substantially all nucleotides are modified with 2'-O-methyl nucleotides or 2'-fluoro nucleotides.

8. The RNAi agent of any one of claims 1-7, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences provided in Table 3.

9. The RNAi agent of any one of claims 1-8, wherein the sense strand comprises a nucleotide sequence of any one of the modified sequences provided in Table 4.

10. The RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any one modified sequence provided in Table 3, and the sense strand comprises a nucleotide sequence of any one modified sequence provided in Table 4.

Images