Nucleic acid detection composition, kit and method based on template and primer role exchange

Abstract

The present invention relates to capture oligonucleotides, compositions or kits and methods for nucleic acid amplification. Specifically, the capture oligonucleotide sequentially comprises a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a) and a binding capture sequence (2a) from the 5'end to the 3 'end, wherein (1) the folding sequence is at least partially the same as the 5'terminal sequence of the target molecule; (2) the binding capture sequence is complementary to the 3'terminal sequence of the target molecule; (3) the capture oligonucleotide further comprises nucleic acid extension blocking modification located at the 3'end of the binding capture sequence; and (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and a second universal sequence, and the universal sequence is irrelevant to the target molecule sequence. The product and the method provided by the invention can realize multiple nucleic acid detection with good specificity and high sensitivity.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a nucleic acid detection composition, a kit and a method based on the role interchange of template and primer. Background Art

[0002] Nucleic acid amplification has not only driven the development of basic biological research, but also revolutionized the analytical techniques of clinical science. In clinical research, due to the scarcity of samples, as the scale of the project expands, the detection method of single-reaction reaction is costly and inefficient. Therefore, it is particularly important to develop nucleic acid amplification detection reagents that can be used in clinical practice.

[0003] At the same time, with the deepening of research, the biological significance of various chemical modifications on DNA sequences has also received more and more attention, such as DNA methylation. DNA methylation is a form of DNA chemical modification that can change genetic expression without changing the DNA sequence. The so-called DNA methylation refers to the covalent bonding of a methyl group to the 5th carbon position of cytosine in the genomic CpG dinucleotide under the action of DNA methyltransferase. A large number of studies have shown that DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression. DNA methylation plays an important role in the occurrence and development of many human diseases, such as tumors, cardiovascular diseases, diabetes, etc., and is one of the hot spots in basic research and clinical application research.

[0004] Currently, the method based on bisulfite conversion is the mainstream choice for DNA methylation detection. However, since bisulfite conversion requires strict chemical conditions, it has many shortcomings: 1) incomplete conversion can lead to false positives; 2) the conversion process can cause DNA degradation and fragmentation, resulting in reduced sensitivity; 3) since the conversion process changes the base information in the sequence, this can cause the sequence to lose complexity and show amplification preference.

[0005] Therefore, developing a method that is simple, fast, highly sensitive, and highly specific for detecting trace amounts of nucleic acids and their methylation status is a pain point and difficulty that urgently needs to be addressed in this field. Summary of the invention

[0006] The present invention aims to provide a method for detecting trace nucleic acids and their methylation states, which is simple and quick to operate, highly sensitive and highly specific.

[0007] The inventors have developed a nucleic acid detection system that utilizes site-specific cutting nucleases and universal primer-based amplification, which can detect trace amounts of nucleic acid and its methylation status, and has the advantages of simple and fast operation, high sensitivity, and high specificity.

[0008] In the first aspect of the present invention, a capture oligonucleotide for nucleic acid amplification is provided, wherein the capture oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a) and a binding capture sequence (2a); wherein,

[0009] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0010] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0011] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and

[0012] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence,

[0013] The universal sequence is independent of the target molecule sequence.

[0014] In another preferred embodiment, the capture oligonucleotide further comprises a nucleic acid analog modification:

[0015] Preferably, (5) the 3' end of the binding capture sequence is modified with a nucleic acid analog;

[0016] Preferably, (6) the 3' end of the folding sequence is modified with a nucleic acid analog.

[0017] In another preferred embodiment, the capture oligonucleotide further comprises a nucleic acid analog modification:

[0018] (5) The 3' end of the binding capture sequence is modified with a nucleic acid analog; and / or

[0019] (6) The 3' end of the folding sequence is modified with a nucleic acid analog.

[0020] In another preferred embodiment, the 3' end of the folded sequence of the capture oligonucleotide is modified with a nucleic acid analog.

[0021] In another preferred embodiment, the 3' end of the capture sequence binding of the capture oligonucleotide contains a nucleic acid extension blocking modification and the 3' end has a nucleic acid analog modification.

[0022] In another preferred embodiment, the 3' end of the capture sequence of the capture oligonucleotide contains a nucleic acid extension blocking modification and the 3' end has a nucleic acid analog modification, and the capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence, and the 3' end of the folding sequence has a nucleic acid analog modification.

[0023] In another preferred embodiment, the capture oligonucleotide further comprises: (7) an enzyme recognition tag located at the 3' end of the universal sequence or bound to the 5' end of the capture sequence.

[0024] In another preferred embodiment, the capture oligonucleotide further comprises: (7) an enzyme recognition tag located at the 3' end of the second universal sequence or bound to the 5' end of the capture sequence.

[0025] In another preferred embodiment, the target molecule is a target molecule with clear sequences at the 3' end and the 5' end.

[0026] In another preferred embodiment, the target molecule is a cleavage product of a site-specific cutting nuclease, for example, a target molecule having clear sequences at both ends due to cleavage by a site-specific cutting nuclease.

[0027] In another preferred embodiment, the site-specific cutting nuclease is an exonuclease and / or an endonuclease.

[0028] In another preferred embodiment, the site-specific cutting nuclease is selected from the following group: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (such as nucleic acid restriction endonuclease MspⅠ, Xmal, etc.), methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0029] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0030] In another preferred embodiment, the CRISPR-Cas system comprises a guiding short RNA that matches the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0031] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the following group: Gla I, FspE I, MspJI, LpnPI, or a combination thereof.

[0032] In another preferred embodiment, the enzyme recognition marker is selected from the following group: / idsP / , RNA base modification, or a combination thereof.

[0033] In another preferred embodiment, the enzyme that recognizes the enzyme recognition tag is selected from the following group: 3'Tth endonuclease, high temperature stable RNase H, mismatch repair enzyme or a combination thereof.

[0034] In another preferred embodiment, the nucleic acid extension blocking modification is selected from the following group: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

[0035] In another preferred embodiment, the nucleic acid analog modification is selected from the following group: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

[0036] In a second aspect of the present invention, a composition or a kit for nucleic acid amplification is provided, wherein the composition or the kit comprises the capture oligonucleotide according to the first aspect of the present invention.

[0037] In another preferred embodiment, the composition or kit is a composition or kit for nucleic acid detection.

[0038] In another preferred embodiment, the composition or kit further comprises a target molecule pre-sequence pretreatment reagent.

[0039] In another preferred embodiment, the target molecule pre-sequence pretreatment reagent includes a site-specific cutting nuclease.

[0040] In another preferred embodiment, the site-specific cutting nuclease is selected from the following group: exonuclease, endonuclease, CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0041] In another preferred embodiment, the endonuclease is a restriction endonuclease.

[0042] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0043] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the following group: GlaI, FspEI, MspJI, LpnPI, or a combination thereof.

[0044] In another preferred embodiment, the composition or kit further comprises a universal primer.

[0045] In another preferred embodiment, the universal primer is unrelated to the target molecule sequence.

[0046] In another preferred embodiment, the composition or kit further comprises a detection probe.

[0047] In another preferred embodiment, the detection probe is labeled with a fluorescent group and / or a quencher group.

[0048] In another preferred embodiment, the fluorescent group is labeled at the 5' end of the detection probe; and the quencher group is labeled at the 3' end of the detection probe.

[0049] In another preferred embodiment, the fluorescent group is selected from the following group: FAM, VIC, JOE, TET, CY3, CY5, ROX, TexasRed, LC RED460, or a combination thereof; the quenching group is selected from the following group: BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.

[0050] In another preferred embodiment, the composition or kit further comprises DNA polymerase, dNTP, Mg 2+ , or a combination thereof.

[0051] In another preferred embodiment, the composition or kit further comprises an enzyme digestion buffer and / or a PCR buffer.

[0052] In another preferred embodiment, the composition or kit comprises a capture oligonucleotide and a universal primer, wherein the capture oligonucleotide comprises (in order from 5' to 3') a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a) and a binding capture sequence (2a); wherein,

[0053] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0054] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0055] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence;

[0056] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence; and

[0057] (5) The 3' end of the folded sequence of the capture oligonucleotide is modified with a nucleic acid analog;

[0058] The universal sequence and universal primer are independent of the target molecule sequence.

[0059] In another preferred embodiment, the composition or kit comprises a capture oligonucleotide and a universal primer, wherein the capture oligonucleotide comprises (in order from 5' to 3'): a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a) and a binding capture sequence (2a); wherein,

[0060] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0061] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0062] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence;

[0063] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence,

[0064] (5) the 3' end of the folded sequence of the capture oligonucleotide is modified with a nucleic acid analog; and

[0065] (6) The capture oligonucleotide further includes an enzyme recognition tag located at the 3' end of the second universal sequence or bound to the 5' end of the capture sequence;

[0066] The universal sequence and universal primer are independent of the target molecule sequence.

[0067] In the third aspect of the present invention, a method for amplifying or detecting a nucleic acid for non-diagnostic purposes is provided, the method comprising the step of using a capture oligonucleotide to bind to a target molecule, the capture oligonucleotide being as described in the first aspect of the present invention.

[0068] In another preferred embodiment, the method comprises the steps of:

[0069] (a) using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule);

[0070] (b) Linear extension of target molecules;

[0071] (d) Universal primer exponential amplification,

[0072] The capture oligonucleotide comprises a first universal sequence (U2a), a folding sequence 1s, a second universal sequence (U1a) and a binding capture sequence (2a) from 5' to 3'; wherein,

[0073] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0074] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0075] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and

[0076] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence;

[0077] Optionally, the 3' end of the folding sequence has a nucleic acid analog modification;

[0078] The universal sequence and universal primer are independent of the target molecule sequence.

[0079] In another preferred embodiment, the capture oligonucleotide is the capture oligonucleotide described in the first aspect of the present invention.

[0080] In another preferred embodiment, the method (direct method) comprises:

[0081] (1) The capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence.

[0082] (2) the target molecule is extended using the capture oligonucleotide as a template, and a sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule;

[0083] (3) The second universal primer (U1a) binds to the linear extension product of the target molecule, uses the linear extension product of the target molecule as a template, extends and terminates at the 5' end of the target molecule, and obtains the second universal primer linear extension product;

[0084] (4) The linear extension product of the second universal primer binds to the folded sequence of the capture oligonucleotide and extends, and a complementary sequence of the first universal sequence (U2a) is added to the 3' end to obtain a linear extension product of the first universal primer,

[0085] (5) Based on the first universal primer and the second universal primer, exponential amplification is performed to obtain an amplification product having the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle.

[0086] In another preferred embodiment, the method further comprises the step of: (6) using the probe and detecting the probe signal.

[0087] In another preferred embodiment, the method comprises the steps of:

[0088] (a) using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule);

[0089] (b) Linear extension of target molecules;

[0090] (c) Enzyme-specific recognition and cleavage;

[0091] (d) Universal primer exponential amplification;

[0092] The capture oligonucleotide comprises a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a) and a binding capture sequence (2a) from 5' to 3'; wherein,

[0093] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0094] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule,

[0095] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence;

[0096] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence;

[0097] Optionally, the 3' end of the folding sequence is modified with a nucleic acid analog; and

[0098] (5) The capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the second universal sequence or bound to the 5' end of the capture sequence,

[0099] The universal sequence and universal primer are independent of the target molecule sequence.

[0100] In another preferred embodiment, the method (cutting method) comprises the steps of:

[0101] (1) The capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence;

[0102] (2) the target molecule is extended using the capture oligonucleotide as a template, and a sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule;

[0103] (3) The enzyme specifically recognizes the restriction site in the linear extension product of the target molecule and the capture oligonucleotide binding dimer and cuts it to obtain a capture oligonucleotide cleavage product containing a free 3' end;

[0104] (4) The capture oligonucleotide cleavage product containing a free 3' end is subjected to an extension reaction using the linear extension product of the target molecule as a template, a sequence complementary to the target molecule is added to the 3' end of the capture oligonucleotide cleavage product containing a free 3' end and terminated at the 5' end of the target molecule to obtain a capture oligonucleotide extension product;

[0105] (5) The capture oligonucleotide extension product binds to the folded sequence in the capture oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule to form a semi-hairpin structure product;

[0106] (6) The semi-hairpin structure product undergoes an extension reaction under the action of a polymerase, and a nucleotide complementary to the first universal sequence in the molecule is added to the 3' end to form a complete hairpin structure product;

[0107] (7) Using the complete hairpin structure product as a template, amplification is performed using universal primers to obtain an amplification product having the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle.

[0108] In another preferred embodiment, the method further comprises the step of: (8) using a probe and detecting a probe signal.

[0109] In another preferred embodiment, the universal sequence and universal primer are unrelated to the target molecule sequence.

[0110] In another preferred embodiment, the target molecule is a target molecule with clear sequences at the 3' end and the 5' end.

[0111] In another preferred embodiment, the target molecule with clear sequences at the 3' and 5' ends is a DNA cleavage product of a site-specific nuclease, preferably a target molecule with clear sequences at both ends due to cleavage by a site-specific nuclease.

[0112] In another preferred embodiment, the site-specific cutting nuclease is an exonuclease and / or an endonuclease.

[0113] In another preferred embodiment, the endonuclease is a restriction endonuclease.

[0114] In another preferred embodiment, the endonuclease is selected from any one or more of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system or a mismatch repair enzyme.

[0115] In another preferred embodiment, the methylation-dependent restriction endonuclease includes any one or two or more selected from Gla I, FspEI, MspJI and LpnPI.

[0116] In another preferred embodiment, the enzyme that recognizes the enzyme-cutting recognition tag contained in the capture oligonucleotide is selected from one or more of the following: 3'Tth endonuclease, thermostable mismatch repair enzyme and thermostable RNase H.

[0117] In the fourth aspect of the present invention, a nucleic acid detection system is provided, which comprises the capture oligonucleotide described in the first aspect of the present invention or the composition or kit described in the second aspect of the present invention, Taq polymerase, dNTP, MgCl2 and PCR buffer.

[0118] In another preferred embodiment, the system includes 1-100 nM capture oligonucleotide according to the first aspect of the present invention, 1-5 U (preferably 1-2 U) Taq polymerase, 50-500 μM (preferably 100-300 μM) dNTP, 1-5 mM (preferably 1-3 mM) MgCl2 and PCR buffer.

[0119] In another preferred embodiment, the system further comprises a primer (universal primer) and a probe.

[0120] In another preferred embodiment, the probe includes a specific probe, a universal probe, or a combination thereof.

[0121] In another preferred embodiment, the system further comprises 100-800 nM (preferably 100-400 nM) universal primers.

[0122] In another preferred embodiment, the system further comprises 100-600 nM (preferably 100-300 nM) probe.

[0123] In another preferred embodiment, the system further comprises at least 20 U (preferably 1-10 U) of 3'Tth endonuclease, a thermostable mismatch repair enzyme and / or a thermostable RNase H enzyme.

[0124] In another preferred embodiment, the system further comprises 1-20U (preferably 5-15U) of site-specific cutting nuclease; preferably exonuclease and / or endonuclease.

[0125] In another preferred embodiment, the universal primers and probes are as described in the second aspect of the present invention.

[0126] In another preferred embodiment, the endonuclease is a restriction endonuclease.

[0127] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0128] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspEI, MspJI, LpnPI, or a combination thereof.

[0129] In the fifth aspect of the present invention, there is provided an application of the capture oligonucleotide described in the first aspect of the present invention, the composition or kit described in the second aspect of the present invention, and / or the nucleic acid detection system described in the fourth aspect of the present invention in the preparation of a nucleic acid detection product.

[0130] In another preferred example, the nucleic acid detection product is a DNA methylation detection product.

[0131] In another preferred embodiment, the product is selected from the group consisting of a kit, a device, a computer-readable medium, or a combination thereof.

[0132] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0133] The accompanying drawings herein are incorporated into and constitute a part of the specification, illustrate embodiments consistent with the present invention, and together with the specification are used to explain the principles of the present invention. Obviously, the accompanying drawings described below are only some embodiments of the present invention, and for those of ordinary skill in the art, other accompanying drawings can be obtained based on these accompanying drawings without creative work.

[0134] Figure 1 It shows (A) the amplification principle of the capture oligonucleotide containing an enzyme recognition tag; (B) the amplification principle of the capture oligonucleotide without an enzyme recognition tag; (C) the amplification results of the two methods involved in this study, i.e., the amplification curve (Amplification Plot), ΔRn is the difference in fluorescence intensity between the two amplifications. Among them, 1 is the amplification result of the method 1 of the present invention (cutting method, containing an enzyme recognition tag) combined with the target sequence after treatment; 2 is the amplification result of the method 2 of the present invention (direct method, not containing an enzyme recognition tag) combined with the target sequence after treatment, 3 is the method 1 of the present invention (cutting method, containing an enzyme recognition tag) combined with the target sequence without treatment, and 4 is the amplification result of the method 2 of the present invention (direct method, not containing an enzyme recognition tag) combined with the target sequence without treatment.

[0135] Figure 2 The difference comparison between the capture oligonucleotides involved in the present invention and the reference document (CN114717298A) is shown. (A) The capture oligonucleotide design involved in the present invention; (B) The capture oligonucleotide design involved in the reference document (CN114717298A).

[0136] Figure 3Shows the addition of a universal probe sequence to the capture oligonucleotide; 1 / 3 / 5 are target molecule specific probe detection; 2 / 4 / 6 are universal probe detection. 1 / 2 is 2000 copies / reaction; 3 / 4 is 200 copies / reaction; 5 / 6 are negative controls.

[0137] Figure 4 The sensitivity test results are shown. The target molecule concentrations of 1 / 2 / 3 / 4 are 2000 copies / reaction, 200 copies / reaction, 20 copies / reaction, and negative control, respectively.

[0138] Figure 5 Methylation detection of locked nucleic acid modified capture oligonucleotides is shown. The target molecule concentrations of 1 / 2 / 3 / 4 are 2000 copies / reaction, 200 copies / reaction, 20 copies / reaction, and negative control, respectively.

[0139] Figure 6 The results of LINE-1 gene unmethylation based on methylation-sensitive restriction endonuclease treatment are shown.

[0140] Figure 7 The detection of Mycobacterium tuberculosis based on methylation-sensitive restriction endonuclease treatment is shown. The target molecule concentrations of 1 / 2 / 3 / 4 are 2000 copies / reaction, 200 copies / reaction, 20 copies / reaction, and negative control, respectively. DETAILED DESCRIPTION

[0141] Example embodiments will now be described more fully with reference to the accompanying drawings. However, example embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that the present invention will be comprehensive and complete and fully convey the concept of the example embodiments to those skilled in the art.

[0142] Unless otherwise defined, all terms and phrases used herein include the meanings that the terms and phrases have in the art, unless explicitly stated to the contrary or clearly apparent from the context in which the terms and phrases are used. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, specific methods and materials are now described.

[0143] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a preferred technical solution.

[0144] After extensive and in-depth research, the inventor unexpectedly discovered for the first time that the target molecule is first captured using a capture oligonucleotide, and then the target molecule is extended using the capture oligonucleotide as a template, and then linearly amplified by combining with a universal primer, to obtain a sequence containing different universal primer sequences at both ends that can be exponentially amplified by the universal primer, and an intermediate sequence of the target molecule sequence in the middle; then, the intermediate sequence obtained by linear amplification is subjected to exponential amplification guided by the universal primer and / or the capture oligonucleotide. Based on this, the present invention was completed.

[0145] Capture oligonucleotides

[0146] The present invention provides a capture oligonucleotide for nucleic acid amplification, wherein the capture oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a) and a binding capture sequence (2a); wherein:

[0147] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0148] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0149] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and

[0150] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence,

[0151] The universal sequence is independent of the target molecule sequence.

[0152] Typically, the capture oligonucleotides of the present invention further include nucleic acid analog modifications:

[0153] Preferably, (5) the 3' end of the binding capture sequence is modified with a nucleic acid analog; and / or

[0154] Preferably, (6) the 3' end of the folding sequence is modified with a nucleic acid analog.

[0155] Typically, there are two options for the capture oligonucleotides described herein.

[0156] In a preferred embodiment of the present invention, the first selection of the capture oligonucleotide can be from 5' to 3' including a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence; wherein the folding sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, the capture oligonucleotide also includes an enzyme recognition label located at the 3' end of the second universal sequence or the 5' end of the binding capture sequence, the capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence, the 3' end of the folding sequence of the capture oligonucleotide has a nucleic acid analog modification, and the universal primer is unrelated to the target molecule sequence.

[0157] In another preferred embodiment of the present invention, the second selection of the capture oligonucleotide can be from 5' to 3' including a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence, wherein the folding sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, the capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence, the folding sequence 3' end of the capture oligonucleotide has a nucleic acid analog modification, and the universal primer is unrelated to the target molecule sequence.

[0158] The complementarity described herein includes complete complementarity and partial complementarity. Generally, for the nucleic acid chain that needs to be extended, its 3' end sequence is at least 90% complementary on the corresponding complementary chain, for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or completely complementary, as long as it does not affect the extension of the nucleic acid chain. For example, in the complementarity of the target molecule and the combined capture sequence of the capture oligonucleotide, the target molecule is the nucleic acid chain that needs to be extended, and its 3' end sequence is at least 90% complementary or completely complementary to the combined capture sequence (that is, the 3' end nucleic acid of the target molecule has a paired base on the capture oligonucleotide). For another example, in the complementarity of the universal primer and the linear extension product of the target molecule, the universal primer is the nucleic acid chain that needs to be extended, and its 3' end sequence is at least 90% complementary or completely complementary to the sequence of the linear extension product of the target molecule.

[0159] The target molecule with clear sequence information at the 3' and 5' ends is complementary to the capture sequence of the capture oligonucleotide, and then the capture oligonucleotide is used as a template for extension to add the complementary chain of the second universal sequence at the 3' end of the target molecule (such as Figure 1As shown). In order to prevent the capture oligonucleotide itself from being extended, the capture oligonucleotide may also optionally include a nucleic acid extension blocking modification. The nucleic acid extension blocking modification is usually located at the 3' end of the binding capture sequence. The nucleic acid extension blocking modification has a substance that can block the extension of DNA polymerase, so that the capture oligonucleotide will not extend to the 3' end, thereby forming a complementary chain of the target molecule and affecting the subsequent binding and extension of the capture oligonucleotide. The modification that can block the extension of DNA polymerase includes: Spacer, thio group, sulfhydryl group, amino group or uracil base.

[0160] In an embodiment of the present invention, the capture oligonucleotide with the nucleic acid extension modification is modified at the Spacer of the binding capture sequence. In order to further enhance the effect of nucleic acid extension blocking, the 3' end of the capture oligonucleotide binding capture sequence may also include a nucleic acid analog modification. The nucleic acid analog includes one or more selected from the following: peptide nucleic acid, locked nucleic acid, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine or 2'-fluoro RNA.

[0161] In the present invention, in the embodiment where the recognition and cleavage of the enzyme is required for amplification, an enzyme recognition tag modification can also be added to the 3' end of the second universal sequence of the capture oligonucleotide or the 5' end of the capture sequence, and free ends are generated by the recognition and cleavage of the enzyme to extend and amplify. The enzyme recognition tag modification includes / idsP / and RNA base modification. The recognition enzyme includes 3'Tth endonuclease, thermostable mismatch repair enzyme and thermostable RNase H.

[0162] In the present invention, the first universal sequence and the second universal sequence can be artificially synthesized sequences. Therefore, when detecting different target molecules, it is only necessary to design the combined capture sequence of the capture oligonucleotide according to the target molecule, while the first universal sequence and the second universal sequence can remain unchanged. In some embodiments, in order to reduce nonspecific amplification, the combined capture sequence of the capture oligonucleotide is designed according to different target molecules, while the first universal sequence and the second universal sequence remain unchanged, thereby realizing multiple amplification detection. The length or base ratio of the universal sequence (universal primer) can be conventionally adjusted according to the composition, length, required specificity, etc. of the sequence to be amplified.

[0163] Target molecule

[0164] In the present invention, the target molecule can be a target molecule with clear sequence information at its 3' end and 5' end (i.e., clear sequence), or a target molecule with clear sequence information at its 3' end and 5' end generated after being treated by a biological method. The types of nucleic acid sequences with clear sequence information at the 3' end and 5' end include normal nucleic acid sequences, nucleic acid sequences with modifications, single nucleotide mutations, sequence transpositions, sequence deletions, sequence recombination, and other different types.

[0165] Target molecules with clear sequence information at their 3' and 5' ends, such as mature microRNA, microRNA precursor, cfDNA, etc.

[0166] The target molecule intermediate with clear sequence information at the 3' end and 5' end can be obtained by cutting or blocking by biological methods, including products cut by site-specific cutting nucleases, such as AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), nucleic acid restriction endonuclease, methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, etc. Methylation-dependent restriction endonucleases such as GlaI, FspEI, MspJI and LpnPI; methylation-sensitive restriction endonucleases such as HpaⅡ, SmaⅠ, etc.; restriction endonucleases such as MspⅠ, Xmal, etc.; CRISPR-Cas system includes a guide short RNA matching the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0167] Composition, kit

[0168] The present invention provides a composition or a kit for nucleic acid amplification, wherein the composition or the kit comprises the capture oligonucleotide described above in the present invention.

[0169] Typically, the present invention provides a composition or kit comprising a capture oligonucleotide as described in any embodiment of the present invention for amplifying or detecting nucleic acids. Exemplary capture oligonucleotides are shown as capture oligonucleotide 1 (BH1, SEQ ID NO: 1-spacer18-SEQ ID NO: 2), capture oligonucleotide 3 (BH3, SEQ ID NO: 1-spacer18-SEQ ID NO: 9), capture oligonucleotide 4 (BH4, SEQ ID NO: 1-spacer18-SEQ ID NO: 11), capture oligonucleotide 5 (BH5, SEQ ID NO: 12-spacer18-SEQ ID NO: 13) or capture oligonucleotide 6 (BH6, SEQ ID NO: 16-spacer18-SEQ ID NO: 17). Exemplary modified capture oligonucleotides are capture oligonucleotide 1, capture oligonucleotide 3 or capture oligonucleotide 4. The kit also includes a reagent for generating a target molecule with clear 3' end and 5' end sequence information (e.g., a target molecule pre-sequence pretreatment reagent), such as the above-mentioned site-specific cutting nuclease. The kit also includes a DNA polymerase, dNTP, Mg 2+ , enzyme digestion buffer, PCR buffer, any one or more thereof.

[0170] In addition, the kit also includes universal primers. Specifically, the kit also includes universal primers as described above. Exemplary universal primers are shown in SEQ ID NOs: 2 and 3.

[0171] When detecting different target molecules, it is only necessary to design the binding capture sequence portion of the specific capture oligonucleotide according to the target molecule, while the universal primer can remain unchanged.

[0172] In order to detect nucleic acids, the kit may further include a probe. In some embodiments, the probe is labeled with a fluorescent group and / or a quencher group. Typically, the fluorescent group is labeled at the 5' end of the detection probe, and the quencher group is labeled at the 3' end of the detection probe. The fluorescent group includes any one or more of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; the quencher group includes any one or more of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra. Exemplary probes are shown in SEQ ID NO: 4, 8, or 19.

[0173] The kit may also include reagents required for sequencing, which are well known to those skilled in the art, such as polymerase, sequencing primers, etc.

[0174] Nucleic acid amplification or detection methods

[0175] The present invention provides a method for amplifying or detecting nucleic acid, which comprises the step of using a capture oligonucleotide to bind to a target molecule, wherein the capture oligonucleotide is as described in the first aspect of the present invention.

[0176] Typically, the present invention provides a method for nucleic acid amplification or detection, the method comprising the steps of:

[0177] (a) using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule);

[0178] (b) Linear extension of target molecules;

[0179] (d) Universal primer exponential amplification,

[0180] The capture oligonucleotide comprises a first universal sequence (U2a), a folding sequence 1s, a second universal sequence (U1a) and a binding capture sequence (2a) from 5' to 3'; wherein,

[0181] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0182] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0183] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and

[0184] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence;

[0185] Optionally, the 3' end of the folding sequence has a nucleic acid analog modification;

[0186] Optionally, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the second universal sequence or at the 5' end of the combined capture sequence;

[0187] The universal sequence and universal primer are independent of the target molecule sequence.

[0188] In a preferred embodiment of the present invention, the nucleic acid amplification or detection method is a nucleic acid amplification or detection method for non-diagnostic purposes.

[0189] The nucleic acid amplification or detection method can be further divided into a cleavage method including an enzyme step (c) an enzyme-specific recognition and cleavage step and a direct method not including step (c).

[0190] In a preferred embodiment of the present invention, the cleavage method comprises the steps of using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule), linear extension of the target molecule, enzyme-specific recognition and cleavage, and universal primer exponential amplification. Specifically, the method comprises the steps of:

[0191] (1) The capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence;

[0192] (2) the target molecule is extended using the capture oligonucleotide as a template, and a sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule;

[0193] (3) The enzyme specifically recognizes the restriction site in the linear extension product of the target molecule and the capture oligonucleotide binding dimer and cuts it to obtain a capture oligonucleotide cleavage product containing a free 3' end;

[0194] (4) The capture oligonucleotide cleavage product containing a free 3' end is subjected to an extension reaction using the linear extension product of the target molecule as a template, a sequence complementary to the target molecule is added to the 3' end of the capture oligonucleotide cleavage product containing a free 3' end and terminated at the 5' end of the target molecule to obtain a capture oligonucleotide extension product;

[0195] (5) The capture oligonucleotide extension product binds to the folded sequence in the capture oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule to form a semi-hairpin structure product;

[0196] (6) The semi-hairpin structure product undergoes an extension reaction under the action of a polymerase, and a nucleotide complementary to the first universal sequence in the molecule is added to the 3' end to form a complete hairpin structure product;

[0197] (7) Using the complete hairpin structure product as a template, amplification is performed using universal primers to obtain an amplification product having the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle.

[0198] The amplification optionally further comprises the use of a probe.

[0199] In a preferred embodiment of the present invention, the direct method comprises the steps of using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule), linear extension of the target molecule, and exponential amplification of a universal primer. Specifically, the method comprises:

[0200] (1) The capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence;

[0201] (2) the target molecule is extended using the capture oligonucleotide as a template, and a sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule;

[0202] (3) the second universal primer binds to the linear extension product of the target molecule, uses the linear extension product of the target molecule as a template, extends the target molecule, and terminates at the 5' end of the target molecule to obtain the second universal primer linear extension product;

[0203] (4) the linear extension product of the second universal primer binds to and extends the folded sequence of the capture oligonucleotide, and adds a complementary sequence of the first universal sequence (U2a) to the 3' end to obtain a linear extension product of the first universal primer;

[0204] (5) Based on the first universal primer and the second universal primer, exponential amplification is performed to obtain an amplification product having the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle.

[0205] The amplification optionally further comprises the use of a probe.

[0206] Detection system

[0207] The present invention provides a nucleic acid detection system, which comprises the capture oligonucleotide described in the first aspect of the present invention or the composition or kit described in the second aspect of the present invention, Taq polymerase, dNTP, MgCl2 and PCR buffer.

[0208] Typically, the detection system further includes primers (universal primers) and probes (specific probes, universal probes).

[0209] Methylation detection system

[0210] In a specific embodiment, the present invention relates to a methylation detection system, which mainly comprises two parts: methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonuclease treatment, and fluorescent PCR technology based on capture oligonucleotides and / or universal primer amplification. The methylation detection system involves treating the target gene sequence with methylation-dependent restriction endonucleases and / or methylation-sensitive restriction endonucleases for enzyme digestion; and involves fluorescent PCR amplification of the enzyme digestion products of methylation-dependent restriction endonucleases and / or methylation-sensitive restriction endonucleases. Preferably, the methylation detection system includes capture oligonucleotides, probes and universal primers, and the above components are as described elsewhere herein.

[0211] There are two options for the capture oligonucleotides involved in the methylation detection system:

[0212] The first choice can be from 5' to 3' including a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence, wherein the folding sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, the capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence, preferably, the folding sequence 3' end of the capture oligonucleotide has a nucleic acid analog modification, the capture oligonucleotide also includes an enzyme recognition label located at the 3' end of the second universal sequence or the 5' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0213] In a preferred embodiment of the present invention, the 3' end of the binding capture sequence is modified with a nucleic acid analog.

[0214] In another preferred embodiment of the present invention, the 3' end of the binding capture sequence is modified with a nucleic acid analog, and the 3' end of the folding sequence is modified with a nucleic acid analog.

[0215] The second option can be to include a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence from 5' to 3', wherein the folding sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, the capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence, preferably, the folding sequence 3' end of the capture oligonucleotide has a nucleic acid analog modification, and the universal primer is unrelated to the target molecule sequence.

[0216] In a preferred embodiment of the present invention, the 3' end of the binding capture sequence is modified with a nucleic acid analog.

[0217] In another preferred embodiment of the present invention, the 3' end of the binding capture sequence is modified with a nucleic acid analog, and the 3' end of the folding sequence is modified with a nucleic acid analog.

[0218] Typically, the capture oligonucleotide involved in the methylation detection system is modified with a nucleic acid analog; preferably, the nucleic acid analog includes any one or a combination of at least two of peptide nucleic acid, locked nucleic acid, transposed base, spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoro RNA or 2'-fluoro RNA. The above preferred nucleic acid analogs are modified on the 3' end sequence of the capture oligonucleotide binding capture sequence or on the 3' end sequence of the folding sequence.

[0219] In an embodiment of the present invention, the probes (including specific probes and universal probes) involved in the methylation detection system are respectively labeled with a fluorescent group and a quenching group at both ends.

[0220] Preferred fluorescent detection groups are selected from the group consisting of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LCRED460, or combinations thereof.

[0221] Preferred quenching groups are selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.

[0222] The present invention provides two methods for the above-mentioned fluorescence PCR amplification detection:

[0223] The first method includes the steps of using a capture oligonucleotide to bind to a target molecule (ie, using a capture oligonucleotide to bind to a target molecule), linear extension of the target molecule, specific enzyme recognition and cleavage, and exponential amplification with a universal primer.

[0224] Specifically, the method comprises: (1) the capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence; (2) the target molecule is extended using the capture oligonucleotide as a template, and a sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule; (3) the enzyme specifically recognizes the restriction site in the linear extension product of the target molecule and the capture oligonucleotide binding dimer and cuts it to obtain a capture oligonucleotide cleavage product containing a free 3' end; (4) the capture oligonucleotide cleavage product containing the free 3' end is extended using the target molecule linear extension product as a template, and a sequence complementary to the target molecule is added to the 3' end of the capture oligonucleotide cleavage product containing the free 3' end. The capture oligonucleotide is extended by a sequence complementary to the target molecule and terminates at the 5' end of the target molecule to obtain a capture oligonucleotide extension product, (5) the capture oligonucleotide extension product is combined with the folded sequence in the capture oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule to form a semi-hairpin structure product, (6) the semi-hairpin structure product is extended under the action of a polymerase, and a nucleotide complementary to the first universal sequence in the molecule is added to the 3' end to form a complete hairpin structure product, (7) the complete hairpin structure product is used as a template and amplified using a universal primer to obtain an amplification product containing the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends respectively, and containing the target molecule sequence in the middle. The amplification optionally also includes the use of a probe.

[0225] The second method includes the steps of using a capture oligonucleotide to bind to a target molecule (ie, using a capture oligonucleotide to bind to a target molecule), linear extension of the target molecule, and exponential amplification using a universal primer.

[0226] Specifically, the method includes: (1) the capture oligonucleotide binds to the target molecule with a clear 3' terminal sequence by binding to the capture sequence, (2) the target molecule is extended with the capture oligonucleotide as a template, and a sequence complementary to the second universal sequence is added to the 3' terminal of the target molecule to obtain a linear extension product of the target molecule, (3) the second universal primer binds to the linear extension product of the target molecule, and uses the linear extension product of the target molecule as a template and extends and terminates at the 5' terminal of the target molecule to obtain a second universal primer linear extension product, (4) the second universal primer linear extension product binds to the folding sequence of the capture oligonucleotide and extends, and a complementary sequence of the first universal sequence (U2a) is added to the 3' terminal to obtain a first universal primer linear extension product, (5) exponential amplification is performed based on the first universal primer and the second universal primer to obtain an amplification product containing the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' terminals respectively, and containing the target molecule sequence in the middle. The amplification optionally also includes the use of a probe.

[0227] In a specific embodiment of the present invention, the methylation sites in the sequence of SEQ ID NO: 5 of the Septine 9 gene are detected by the following two methods:

[0228] Solution 1: If Figure 1 As shown in A, capture oligonucleotide 1 (BH1) is contacted with DNA digested by GlaI, and capture oligonucleotide 1 (BH1) is complementary to target molecule 1 shown in SEQ ID NO:7; target molecule 1 is extended using capture oligonucleotide 1 (BH1) as a template, and a sequence complementary to SEQ ID NO:2 in capture oligonucleotide 1 (BH1) is added to the 3' end of the target molecule to obtain an extended target molecule (i.e., a linear extension product of the target molecule); the extended target molecule and capture oligonucleotide 1 (BH1) shown in SEQ ID NO:1-spacer18-SEQ ID NO:2 are bound to a dimer, which can be recognized and cut by 3'Tth endonuclease, a thermostable mismatch repair enzyme and a thermostable RNase H, and the cut product can be linearly extended using the extended target molecule as a template; the extended product is folded due to the presence of the complementary sequence to form a product with a complete hairpin structure; the product of the hairpin structure can be prepared using universal primers as shown in SEQ ID NO:3 and SEQ ID NO:4 and a primer as shown in SEQ ID The probe shown in NO:5 is amplified and the probe signal is detected.

[0229] Solution 2: If Figure 1 As shown in FIG. 2 , the capture oligonucleotide shown in capture oligonucleotide 1 (BH1) is contacted with the DNA digested by GlaI, and the capture oligonucleotide 1 (BH1) is complementary to the target molecule 1 shown in SEQ ID NO: 7; the target molecule 1 is extended using the capture oligonucleotide 1 (BH1) as a template, and a sequence complementary to SEQ ID NO: 2 in the capture oligonucleotide 1 (BH1) is added to the 3' end of the target molecule to obtain an extended target molecule (i.e., a linear extension product of the target molecule); the extended target molecule is complementary to the second universal primer SEQ ID NO: 4; the second universal primer SEQ ID NO: 4 performs an extension reaction using the extended target molecule as a template to obtain a sequence complementary to the extended target molecule (i.e., 5'U1a-2a-1a 3'); the sequence can be complementary to SEQ ID NO: 1 in the capture oligonucleotide 1 (BH1). NO:1 complementary (i.e., 1a:1s complementary) combined and extended to form a single-stranded product whose 5' and 3' ends respectively contain the second universal primer sequence (U1a) and the first universal primer complementary sequence (U2s), and the middle contains the target molecule sequence (i.e., 5'U1a-2a-1a-U2s 3'); finally, amplification is performed using the universal primers shown in SEQ ID NO:3 and SEQ ID NO:4 and the probe shown in SEQ ID NO:5, and the probe signal is detected.

[0230] The main advantages of the present invention include:

[0231] Compared with the existing methylation detection technology based on bisulfite conversion, the present invention has the following beneficial effects:

[0232] (1) The cfDNA methylation detection technology involved in the present invention does not require complicated chemical treatment, purification and other processes. The scheme of the present invention can only trigger amplification when both the 3' end and the 5' end are mediated by methylation sites, which can effectively inhibit the amplification false positive caused by random breakage of cfDNA, improve the specificity of amplification, and is more suitable for methylation detection of cfDNA with a high degree of fragmentation.

[0233] (2) The capture oligonucleotides and universal primers in the present invention are specially designed. When the target molecules are present in the environment, the extension reaction mediated by the capture oligonucleotide can be triggered, and the signal can be amplified through subsequent exponential amplification to meet the sensitivity requirements for cfDNA methylation detection.

[0234] Compared with the existing methylation-dependent restriction endonuclease technology (ZL 202111389443.0) and multiple amplification method (CN114717298A), the present invention has the following beneficial effects:

[0235] (1) The amplification method of the present invention only requires a terminal extension-blocked capture oligonucleotide and a pair of universal primers to detect methylation. This unique design structure not only eliminates the problem of the simultaneous presence of oligonucleotide adapters and capture oligonucleotides required by the comparative document (ZL202111389443.0), reduces the number of primers required, and forms a hairpin structure and USER enzyme treatment during the amplification process, making the operation simpler. Compared with the comparative document (CN114717298A), the 3'-blocked capture oligonucleotide designed by the present invention can only start the extension of the target molecule when the target molecule with clear 3' and 5' terminal sequences exists, thereby improving the detection specificity. In addition, the capture oligonucleotide modified with enzyme recognition sites and universal primers mediated by 3'Tth endonuclease, high temperature mismatch repair enzyme and high temperature stable RNase H can be directly used for exponential amplification, thereby improving the efficiency of amplification and the sensitivity of detection.

[0236] (2) When the present invention performs methylation detection on different target molecules, it is only necessary to design the binding capture sequence and folding region of the specific capture oligonucleotide according to the target molecule, while keeping the universal primer part unchanged, thereby reducing the interference between multiple primers that is prone to occur during the amplification of multiple target molecules and improving the sensitivity of the reaction, thereby realizing methylation detection of multiple target molecules.

[0237] The long-term new coronary disease diagnostic biomarker group provided by the invention is further described below in conjunction with specific embodiments.

[0238] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples that do not specify detailed conditions are usually based on conventional conditions such as the conditions described in "Molecular Cloning Laboratory Guide" by Sambrook.J, USA (Huang Peitang, etc., Beijing: Science Press, 2002), or according to the conditions recommended by the manufacturer (e.g., product instructions). Unless otherwise specified, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial channels or can be prepared according to literature methods unless otherwise specified.

[0239] Example 1: Detection of DNA methylation of human Septine 9 gene by ultrasonic fragmentation based on the amplification principle of capture oligonucleotides containing enzyme recognition tags

[0240] (1) Obtain methylated Jurka genomic DNA and sequence to identify the methylation status of the Septine 9 gene.

[0241] (2) The DNA treated with ultrasonic fragments was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10 U GlaI, DNA (20,000 copies / reaction), and the total volume was 10 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction was completed, the system was heated to 85°C and incubated for 10 minutes to heat-inactivate GlaI.

[0242] (4) Septine 9 gene capture oligonucleotide and universal primers were added to the above enzyme digestion system for amplification. The reaction system was: ultrasonic fragmented DNA after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0243] The combinations of capture oligonucleotides, universal primers, and specific probes used include:

[0244] Capture oligonucleotide 1, referred to as BH1 (italics indicate 2' methoxy-modified bases)

[0245] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGGCGACC / idSp / GCT GCCCA -Spacer C3

[0246] Among them, the sequence on the left side of spacer18 is:

[0247] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC, The sequence number is SEQ ID NO: 1;

[0248] Sequence to the right of spacer18:

[0249] TCATCGCAGTGTCGCCGTGG GCGACC / idSp / GCT GCCCA -Spacer C3, sequence numbering is SEQ ID NO: 2;

[0250] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:2 are connected to spacer18 respectively.

[0251] First universal primer

[0252] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:3)

[0253] Second universal primer

[0254] TCATCGCAGTGTCGCCGTGG(SEQ ID NO:4)

[0255] Specific probe

[0256] 5'FAM-ACCAGCCATCATGTCGGAC-MGB(SEQ ID NO:5)

[0257] The partial sequence of human Septine 9 gene (target molecule pre-sequence 1) is as follows: / / is the restriction site, and the CG before and after it is the methylation site.

[0258] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGG GTCGC / / GCGGAGGGC (SEQ ID NO: 6, wherein positions 18 to 62 are the target molecule 1 sequence, and the target molecule 1 sequence number is SEQ ID NO: 7)

[0259] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. The enzyme recognition and cleavage is mediated by 3' Tth endonuclease, and the concentration used in amplification is 10U. Figure 1 C illustrates that the present invention can detect the Septine 9 gene of methylated DNA.

[0260] Example 2: Detection of DNA methylation of human Septine 9 gene based on the amplification principle of capture oligonucleotides containing enzyme recognition tags

[0261] (1) Obtain methylated Jurka genomic DNA and sequence to identify the methylation status of the Septine 9 gene.

[0262] (2) The DNA treated with ultrasonic fragments was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10 U GlaI, DNA (20,000 copies / reaction), and the total volume was 10 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction was completed, the system was heated to 85°C and incubated for 10 minutes to heat-inactivate GlaI.

[0263] (3) Septine 9 gene capture oligonucleotide and universal primers were added to the above enzyme digestion system for amplification. The reaction system was: ultrasonic fragmented DNA after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0264] The combinations of capture oligonucleotides, universal primers, and specific probes used include:

[0265] Capture oligonucleotide 1, referred to as BH1 (italics indicate 2' methoxy-modified bases)

[0266] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGGCGACC / idSp / GCT GCCCA -Spacer C3

[0267] Among them, the sequence on the left side of spacer18 is:

[0268] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC , the sequence number is SEQ ID NO: 1;

[0269] Sequence to the right of spacer18:

[0270] TCATCGCAGTGTCGCCGTGG GCGACC / idSp / GCT GCCCA -Spacer C3, sequence numbering is SEQ ID NO: 2;

[0271] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:2 are connected to spacer18 respectively.

[0272] The capture oligonucleotide 2 in the reference document (CN114717298A), referred to as BH2 (italics indicate 2' methoxy modified bases)

[0273] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGGCGACCCGCTGCCCA

[0274] Among them, the sequence on the left side of spacer18 is:

[0275] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC , the sequence number is SEQ ID NO: 1;

[0276] Sequence to the right of spacer18:

[0277] TCATCGCAGTGTCGCCGTGG GCGACCCGCTGCCCA, sequence numbering is SEQ ID NO: 8;

[0278] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:8 are connected to spacer18 respectively.

[0279] First universal primer

[0280] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:3)

[0281] Second universal primer

[0282] TCATCGCAGTGTCGCCGTGG(SEQ ID NO:4)

[0283] Specific probe

[0284] 5'FAM-ACCAGCCATCATGTCGGAC-MGB(SEQ ID NO:5)

[0285] The partial sequence of human Septine 9 gene (target molecule pre-sequence 1) is as follows: / / is the restriction site, and the CG before and after it is the methylation site.

[0286] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGG GTCGC / / GCGGAGGGC (SEQ ID NO: 6, wherein positions 18 to 62 are the target molecule 1 sequence, and the target molecule 1 sequence number is SEQ ID NO: 7)

[0287] The differences between the present invention and the comparative document are as follows: (1) the target molecule described in the present invention needs to be processed at both ends to obtain a target molecule with clear sequences at the 3' end and the 5' end, while the target molecule described in the comparative document is a target molecule with a clear sequence at the 5' end, and this design improves the specificity of detection; (2) the 3' end of the binding capture region of the capture oligonucleotide described in the present invention has Spacer C3 to block extension, and only when a specific target molecule binds to it can it cause linear extension of the target molecule, while the 3' end of the binding capture region of the capture oligonucleotide described in the comparative document has no modification, and only needs to bind to the target molecule to cause the extension of the capture oligonucleotide, and this design improves the specificity of detection; (3) the 3' end of the universal sequence contained in the capture oligonucleotide described in the present invention or the 5' end of the binding capture sequence has an enzyme recognition mark selected from one or more of the following: / idsP / and RNA base modification, and only when a specific target molecule binds to it can it cause specific enzyme recognition and cutting, thereby causing the extension of the capture oligonucleotide and subsequent exponential amplification, while the capture oligonucleotide described in the comparative document does not have a relevant design. Figure 2 It is explained that compared with the design of the comparative document, the present invention can only amplify after being treated with methylation-dependent restriction endonuclease, showing higher specificity; while the system described in the comparative document can also amplify target molecules that have not been treated with enzymes at a high level.

[0288] Example 3: Experiments with different probe selections

[0289] In order to improve the flexibility of capture oligonucleotide detection, this embodiment selected a universal probe sequence added between the universal primer sequence of a capture oligonucleotide and the binding capture sequence. The other capture oligonucleotides and universal primers used were the same as those in Example 1, and the enzyme digestion conditions and amplification conditions were the same as those in Example 1.

[0290] The capture oligonucleotides used included:

[0291] The capture oligonucleotide without universal probe sequence is the same as in Example 1

[0292] Capture oligonucleotide 3 containing universal probe sequence, referred to as BH3 (the underline is the self-folding region, the italicized 3' end of the folding sequence is the 2' methoxy modified base, and the italicized 3' end of the binding capture sequence is the 2' methoxy modified base)

[0293] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGCGATGGCTGAGGATTCTG GCGACC / idSp / GCT GCCCA-Spacer C3

[0294] Among them, the sequence on the left side of spacer18 is:

[0295] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC , the sequence number is SEQ ID NO: 1;

[0296] Sequence to the right of spacer18:

[0297] TCATCGCAGTGTCGCCGTGG CGATGGCTGAGGATTCTG GCGACC / idSp / GCT GCCCA -SpacerC3, sequence numbering is SEQ ID NO: 9;

[0298] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:9 are connected to spacer18 respectively.

[0299] Universal probe sequence

[0300] FAM-CGATGGCTGAGGATTCTG-MGB(SEQ ID NO:10)

[0301] The partial sequence of the human Septine 9 gene is shown in Example 1.

[0302] like Figure 3 As shown, using capture oligonucleotides without universal probe sequences and containing universal probe sequences, amplification curves appeared in the detection of 2000 copies and 200 copies of methylation-positive genomic DNA, showing positive results, indicating that using universal probe sequences or specific target molecule probe sequences can achieve highly sensitive methylation detection. However, there is no obvious difference between the two in this example.

[0303] Example 4: Sensitivity test

[0304] In order to test the sensitivity of the present invention in detecting NA methylation, the capture oligonucleotides, universal primers and specific probes used in this example are the same as those in Example 1, and the enzyme digestion conditions and amplification conditions are the same as those in Example 1. Figure 4 As shown, when there are 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction of methylation-positive genomic DNA in the reaction, positive results can be shown, and the negative control NC has no amplification.

[0305] Example 5: Methylation detection of locked nucleic acid modified capture oligonucleotides

[0306] (1) Obtain methylated Jurka genomic DNA and sequence to identify the methylation status of the Septine 9 gene.

[0307] (2) The DNA treated with ultrasonic fragments was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10 U GlaI, DNA (20,000 copies / reaction), and the total volume was 10 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction was completed, the system was heated to 85°C and incubated for 10 minutes to heat-inactivate GlaI.

[0308] (3) Septine 9 gene capture oligonucleotide and universal primers were added to the above enzyme digestion system for amplification. The reaction system was: ultrasonic fragmented DNA after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0309] The combination of universal primers, specific probes and target molecule sequences used is the same as that in Example 1, and the capture oligonucleotides include:

[0310] Capture oligonucleotide 4, referred to as BH4 (the base before the + is a locked nucleic acid modification, and the 3' end of the folded sequence is in italics and is a 2' methoxy modified base)

[0311] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGGCGACC / idSp / GCT G+C+C+CA -Spacer C3

[0312] Among them, the sequence on the left side of spacer18 is:

[0313] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC , the sequence number is SEQ ID NO: 1;

[0314] Sequence to the right of spacer18:

[0315] TCATCGCAGTGTCGCCGTGG GCGACC / idSp / GCT G+C+C+CA-Spacer C3, sequence numbering is SEQ ID NO: 11;

[0316] The 3' end C of SEQ ID NO: 1 and the 5' end T of SEQ ID NO: 11 are connected to spacer18 respectively.

[0317] The capture oligonucleotide has a Spacer C3 at the 3' end of the folded sequence to block extension. Figure 5 As shown, the positive templates of 200 copies and 100 copies showed amplification curves, indicating positive results, while the negative control NC had no amplification curve, indicating negative results. This indicates that the capture oligonucleotide modified with locked nucleic acid can be used in the present invention and perform DNA methylation detection.

[0318] Example 6: Detection of DNA methylation of human LINE-1 gene by ultrasonic fragmentation based on the amplification principle of capture oligonucleotides without enzyme recognition tags

[0319] (1) Obtain HELA genomic DNA and sequence to identify the methylation status.

[0320] (2) DNA was digested with methylation-sensitive restriction endonuclease HinP1I. The reaction system was: 1× digestion buffer, 10 U HinP1I, genomic DNA, and the total volume was 10 μL. The reaction conditions were incubation at 37°C for 1 hour.

[0321] (3) The capture oligonucleotide and universal primer of the treated gene were added to the above enzyme digestion system for amplification. The reaction system was: genomic DNA after digestion, 5nM capture oligonucleotide, 0.5U Taq DNA polymerase, 200μM dNTPs, 2.5mM MgCl2 and 1X PCR buffer, with a final volume of 20μl; the PCR reaction program was pre-denaturation at 95℃ for 3min; 94℃ for 10s, 66℃ for 90s, 5 cycles; 95℃ for 10s, 65℃ for 20s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0322] The combinations of capture oligonucleotides, specific primers, universal primers, and specific probes used include:

[0323] Capture oligonucleotide 5, referred to as BH5 (italics indicate 2' methoxy modified bases)

[0324] ACGCTCACGCTCGCTGCTACCGCTTTCAGACCGG / spacer18 / CGCAGTGTCGCCGT GGCGATGGCTGAGGATTCTG / idSp / AT CCGTTTCTTAAGCCG-Spacer C3

[0325] Among them, the sequence on the left side of spacer18 is:

[0326] ACGCTCACGCTCGCTGCTAC CGCTTTTCAGACCGG, sequence numbering is SEQ ID NO: 12;

[0327] Sequence to the right of spacer18:

[0328] CGCAGTGTCGCCGTGG CGATGGCTGAGGATTCTG / idSp / AT CCGTTTCTTAAGCCG-SpacerC3, sequence numbering is SEQ ID NO: 13;

[0329] The 3' end G of SEQ ID NO:12 and the 5' end C of SEQ ID NO:13 are connected to spacer18 respectively.

[0330] First universal primer

[0331] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:3)

[0332] Second universal primer

[0333] TCATCGCAGTGTCGCCGTGG(SEQ ID NO:4)

[0334] Universal probe sequence

[0335] FAM-CGATGGCTGAGGATTCTG-MGB(SEQ ID NO:10)

[0336] The partial sequence of the human LINE-1 gene (target molecule pre-sequence 2) is as follows: / / is the restriction site, and the CG before and after it is the methylation site.

[0337] CGAATATTGC / / GCTTTTCAGACCGGCTTAAGAAACGGC / / GCACCACGAGA (SEQ ID NO: 14, wherein positions 11 to 37 are the target molecule 2 sequence, and the target molecule 2 sequence number is SEQ ID NO: 15)

[0338] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 6 This indicates that the results of the detection can be based on the non-methylated state based on the methylation-sensitive restriction endonuclease treatment.

[0339] Example 7: Detection of the IS6110 fragment of Mycobacterium tuberculosis based on the present invention

[0340] (1) Obtaining Mycobacterium tuberculosis genomic DNA.

[0341] (2) DNA was digested with restriction endonuclease FokI. The reaction system was: 1× digestion buffer, 10 U Fok I, Mycobacterium tuberculosis genomic DNA, and the total volume was 10 μL. The reaction conditions were incubation at 37° C. for 1 hour.

[0342] (3) The capture oligonucleotide and universal primer of the treated gene were added to the above-mentioned enzyme digestion system for amplification. The reaction system was: the Mycobacterium tuberculosis genome after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0343] The combinations of capture oligonucleotides, specific primers, universal primers, and specific probes used include:

[0344] Capture oligonucleotide 6, referred to as BH6 (italics indicate 2' methoxy-modified bases)

[0345] ACGCTCACGCTCGCTGCTACCAGGTGGTTCATCGAG

[0346] / spacer18 / CGCAGTGTCGCCGTGGCGATGGCTGAGGATTCTG ctctgcg a / idSp / cat ccgc-Spacer C3

[0347] Among them, the sequence on the left side of spacer18 is:

[0348] ACGCTCACGCTCGCTGCTACCAGGTGGTTCATCGAG, sequence numbering is SEQ ID NO: 16;

[0349] Sequence to the right of spacer18:

[0350] CGCAGTGTCGCCGTGG CGATGGCTGAGGATTCTG ctctgcg a / idSp / catccgc-Spacer C3, sequence numbering is SEQ ID NO: 17;

[0351] The 3' end g of SEQ ID NO: 16 and the 5' end C of SEQ ID NO: 17 are connected to spacer18, respectively.

[0352] First universal primer

[0353] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:3)

[0354] Second universal primer

[0355] TCATCGCAGTGTCGCCGTGG(SEQ ID NO:4)

[0356] Specific probe

[0357] FAM-cgccggagctgcgtga-MGB(SEQ ID NO:18)

[0358] The partial sequence of the IS6110 gene of Mycobacterium tuberculosis (target molecule presequence 3) is as follows: / / indicates the restriction enzyme cutting position.

[0359] Gactccagttcttggaaa ggatg gggtcatgt / / caggtggttcatcgaggaggtaccc gccggagctgcgtgagcgggcggtgc ggatg gtcgcagag / / atc (SEQ ID NO: 19, wherein positions 33 to 97 are the target molecule 3 sequence, and the target molecule 3 sequence number is SEQ ID NO: 20)

[0360] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 7 It is explained that after being treated with specific restriction endonucleases, the present invention can detect pathogenic microorganisms.

[0361] Those skilled in the art will readily appreciate other embodiments of the present invention after considering the specification and practicing the invention disclosed herein. This application is intended to cover any variations, uses or adaptations of the present invention, which follow the general principles of the present invention and include common knowledge or customary techniques in the art that are not disclosed by the present invention. The specification and examples are intended to be exemplary only, and the true scope and spirit of the present invention are indicated by the appended claims.

Claims

1. A capture oligonucleotide for nucleic acid amplification, characterized in that: The capture oligonucleotide includes, from the 5' end to the 3' end, a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence; wherein, (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule; (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule; (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence, The universal sequence is independent of the target molecule sequence.

2. The capture oligonucleotide according to claim 1, characterized in that The capture oligonucleotide also includes nucleic acid analog modifications: Preferably, (5) the 3' end of the binding capture sequence is modified with a nucleic acid analog; and / or, Preferably, (6) the 3' end of the folding sequence is modified with a nucleic acid analog.

3. The capture oligonucleotide according to claim 1, characterized in that The nucleic acid extension blocking modification is selected from the following group: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

4. The capture oligonucleotide according to claim 2, wherein The nucleic acid analog modification is selected from the following group: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine, 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

5. A composition or kit for nucleic acid amplification, characterized in that: The composition or kit comprises the capture oligonucleotide according to any one of claims 1-4.

6. The composition or kit according to claim 5, characterized in that The composition or kit also includes a target molecule pre-sequence pretreatment reagent to obtain a target molecule with clear 3' and 5' end sequences. Preferably, the pretreatment reagent comprises a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

7. The composition or kit according to claim 5 or 6, characterized in that: The composition or kit also includes universal primers and / or detection probes.

8. A method for amplifying or detecting nucleic acid for non-diagnostic purposes, characterized in that: The method comprises the step of using a capture oligonucleotide to bind to a target molecule, wherein the capture oligonucleotide is as described in claim 1.

9. The nucleic acid amplification or detection method according to claim 8, characterized in that: The method comprises the steps of: (a) using capture oligonucleotides to bind target molecules; (b) Linear extension of target molecules; (d) Universal primer exponential amplification, The capture oligonucleotide includes a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence from 5' to 3'; wherein, (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule; (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule; (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence; Optionally, the 3' end of the folding sequence has a nucleic acid analog modification; The universal sequence and universal primer are independent of the target molecule sequence.

10. The nucleic acid detection method according to claim 8, characterized in that: The method comprises the steps of: (a) using capture oligonucleotides to bind target molecules; (b) Linear extension of target molecules; (c) Enzyme-specific recognition and cleavage; (d) Universal primer exponential amplification; The capture oligonucleotide includes a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence from 5' to 3'; wherein, (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule; (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule, (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence; Optionally, the 3' end of the folding sequence is modified with a nucleic acid analog; and (5) The capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the second universal sequence or bound to the 5' end of the capture sequence, The universal sequence and universal primer are independent of the target molecule sequence.

Images