Nucleic acid detection compositions, kits and methods based on template and primer role switching

Abstract

The present application relates to a kind of for nucleic acid amplification, composition or kit and method of capture oligonucleotide.It specifically, the capture oligonucleotide includes successively from 5' end to 3' end: first universal sequence (U2a), folding sequence (1s), second universal sequence (U1a) and binding capture sequence (2a);Wherein, (1) the folding sequence is at least partially identical with the 5' end sequence of target molecule;(2) the binding capture sequence is complementary with the 3' end sequence of target molecule;(3) the capture oligonucleotide further includes nucleic acid extension blocking modification located in the 3' end of binding capture sequence;And (4) the capture oligonucleotide further includes nucleic acid extension blocking modification between folding sequence and second universal sequence, the universal sequence is irrelevant with the sequence of target molecule.The product and method of the present application can realize specific, multiplex nucleic acid detection with high sensitivity.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of detection, in particular, the present application relates to a nucleic acid detection composition, kit and method based on template and primer role interchanging. BACKGROUND

[0002] Nucleic acid amplification not only drives the development of biological basic theory research, but also innovates the analysis technology of clinical science. In clinical research, due to the scarcity of samples, as the project scale expands, the detection mode of single reaction has high cost and low efficiency. Therefore, it is particularly important to develop a nucleic acid amplification detection reagent that can be applied to clinical.

[0003] At the same time, with the deepening of research, the biological significance of various chemical modifications on DNA sequence has been paid more and more attention, such as DNA methylation. DNA methylation is a form of DNA chemical modification, which can change genetic expression without changing DNA sequence. DNA methylation refers to the covalent bond of a methyl group at the 5th carbon position of cytosine in the genomic CpG dinucleotide under the action of DNA methyltransferase. A large number of studies have shown that DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability and DNA-protein interaction mode, thereby controlling gene expression. DNA methylation plays an important role in the occurrence and development of many human diseases, such as tumors, cardiovascular diseases, diabetes, etc., and is one of the hotspots of current basic research and clinical application research.

[0004] At present, the method based on bisulfite conversion is the mainstream choice for DNA methylation detection. However, since bisulfite conversion needs strict chemical conditions to be carried out, there are many deficiencies: 1) incomplete conversion can lead to the appearance of false positives; 2) the conversion process can cause DNA degradation and fragmentation, resulting in decreased sensitivity; 3) since the conversion process can change the base information in the sequence, it will lead to loss of sequence complexity and appear amplification bias.

[0005] Therefore, it is an urgent problem and difficulty in the field to develop a method for detecting trace amounts of nucleic acid and its methylation state with simple and fast operation, high sensitivity and high specificity. SUMMARY

[0006] The present application aims to provide a method for detecting trace amounts of nucleic acid and its methylation state with simple and fast operation, high sensitivity and high specificity.

[0007] The present application aims to provide a method for detecting trace amounts of nucleic acid and its methylation state with simple and fast operation, high sensitivity and high specificity. The present application aims to provide a method for detecting trace amounts of nucleic acid and its methylation state with simple and fast operation, high sensitivity and high specificity.

[0008] In a first aspect of the application, there is provided a capture oligonucleotide for nucleic acid amplification, the capture oligonucleotide comprising, in order from the 5' end to the 3' end: a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a), and a binding capture sequence (2a); wherein,

[0009] (1) the folding sequence is at least partially identical to a 5' end sequence of the target molecule;

[0010] (2) the binding capture sequence is complementary to a 3' end sequence of the target molecule;

[0011] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located 3' to the binding capture sequence; and

[0012] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence,

[0013] the universal sequences are independent of the sequence of the target molecule.

[0014] In another preferred embodiment, the capture oligonucleotide further comprises a nucleic acid analogue modification:

[0015] Preferably, (5) the 3' end of the binding capture sequence has a nucleic acid analogue modification;

[0016] Preferably, (6) the 3' end of the folding sequence has a nucleic acid analogue modification.

[0017] In another preferred embodiment, the capture oligonucleotide further comprises a nucleic acid analogue modification:

[0018] (5) the 3' end of the binding capture sequence has a nucleic acid analogue modification; and / or

[0019] (6) the 3' end of the folding sequence has a nucleic acid analogue modification.

[0020] In another preferred embodiment, the 3' end of the folding sequence of the capture oligonucleotide has a nucleic acid analogue modification.

[0021] In another preferred embodiment, the 3' end of the binding capture sequence of the capture oligonucleotide contains a nucleic acid extension blocking modification and the 3' end has a nucleic acid analogue modification.

[0022] In another preferred embodiment, the 3' end of the binding capture sequence of the capture oligonucleotide contains a nucleic acid extension blocking modification and the 3' end has a nucleic acid analogue modification, the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence, and the 3' end of the folding sequence has a nucleic acid analogue modification.

[0023] In another preferred embodiment, the capture oligonucleotide further comprises: (7) an enzyme cleavage recognition marker located at the 3' end of the universal sequence or the 5' end of the binding capture sequence.

[0024] In another preferred embodiment, the capture oligonucleotide further comprises: (7) an enzyme cleavage recognition marker located at the 3' end of the second universal sequence or the 5' end of the binding capture sequence.

[0025] In another preferred embodiment, the target molecule is a 3' and 5' end sequence defined target molecule.

[0026] In another preferred embodiment, the target molecule is an enzyme cleavage product of a site-specific cleavage nuclease, for example, a target molecule having defined sequences at both ends due to enzyme cleavage by a site-specific cleavage nuclease.

[0027] In another preferred embodiment, the site-specific cleavage nuclease is an exonuclease and / or an endonuclease.

[0028] In another preferred embodiment, the site-specific cleavage nuclease is selected from the group consisting of AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., nucleic acid restriction endonuclease Msp I, Xma I, etc.), methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nicking enzyme, meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0029] In another preferred embodiment, the endonuclease is selected from the group consisting of methylation-dependent restriction endonuclease, methylation-sensitive restriction endonuclease, nicking enzyme, CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0030] In another preferred embodiment, the CRISPR-Cas system comprises a guide short RNA matching the target DNA fragment and an endonuclease that can recognize and cleave specific sequences, for example, a Cas9, Cas12, or Cas13-based CRISPR-Cas system.

[0031] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspE I, MspJI, LpnPI, or a combination thereof.

[0032] In another preferred embodiment, the enzyme cleavage recognition marker is selected from the group consisting of / idsP / , RNA base modification, or a combination thereof.

[0033] In another preferred embodiment, the enzyme recognizing the enzyme cleavage recognition marker is selected from the group consisting of 3' Tth endonuclease, thermostable RNase H, mismatch repair enzyme, or a combination thereof.

[0034] In another preferred embodiment, the nucleic acid extension blocking modification is selected from the group consisting of: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

[0035] In another preferred embodiment, the nucleic acid analog modification is selected from the group consisting of: peptide nucleic acid, locked nucleic acid, inverted base, Spacer, 2'-0,4'-C-methylated bridged RNA, 2'-methoxy modified base, 2'-0-methyl RNA, deoxyuridine nucleoside (2'-deoxyuridine), 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

[0036] In a second aspect of the present application, there is provided a composition or kit for nucleic acid amplification, the composition or kit comprising the capture oligonucleotide of the first aspect of the present application.

[0037] In another preferred embodiment, the composition or kit is a composition or kit for nucleic acid detection.

[0038] In another preferred embodiment, the composition or kit further comprises a target molecule pre-sequence pre-treatment reagent.

[0039] In another preferred embodiment, the target molecule pre-sequence pre-treatment reagent comprises a site-specific cleaving nuclease.

[0040] In another preferred embodiment, the site-specific cleaving nuclease is selected from the group consisting of: exonuclease, endonuclease, CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0041] In another preferred embodiment, the endonuclease is a restriction enzyme.

[0042] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction enzyme, methylation-sensitive restriction enzyme, nicking enzyme, CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0043] In another preferred embodiment, the methylation-dependent restriction enzyme is selected from the group consisting of: GlaI, FspEI, MspJI, LpnPI, or a combination thereof.

[0044] In another preferred embodiment, the composition or kit further comprises a universal primer.

[0045] In another preferred embodiment, the universal primer is independent of the target molecule sequence.

[0046] In another preferred embodiment, the composition or kit further comprises a detection probe.

[0047] In another preferred embodiment, the detection probe is labeled with a fluorescent group and / or a quencher group.

[0048] In another preferred embodiment, the fluorescent group is labeled at the 5' end of the detection probe; and the quencher group is labeled at the 3' end of the detection probe.

[0049] In another preferred embodiment, the fluorescent group is selected from the group consisting of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LC RED 460, or a combination thereof; and the quencher group is selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.

[0050] In another preferred embodiment, the composition or kit further comprises a DNA polymerase, dNTPs, Mg 2+ , or a combination thereof.

[0051] In another preferred embodiment, the composition or kit further comprises an enzyme digestion buffer and / or a PCR buffer.

[0052] In another preferred embodiment, the composition or kit comprises a capture oligonucleotide and a universal primer, the capture oligonucleotide comprising (in order from 5' to 3') a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a), and a binding capture sequence (2a); wherein,

[0053] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0054] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0055] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence;

[0056] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence; and

[0057] (5) the folding sequence of the capture oligonucleotide has a nucleic acid analogue modification at the 3' end;

[0058] The universal sequences, the universal primer are independent of the sequence of the target molecule.

[0059] In another preferred embodiment, the composition or kit comprises a capture oligonucleotide and a universal primer, the capture oligonucleotide comprises from 5' to 3' (in order) a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a), and a binding capture sequence (2a); wherein,

[0060] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0061] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0062] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence;

[0063] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence,

[0064] (5) the folding sequence of the capture oligonucleotide has a nucleic acid analogue modification at the 3' end; and

[0065] (6) the capture oligonucleotide further comprises an enzyme cleavage recognition marker at the 3' end of the second universal sequence or the 5' end of the binding capture sequence;

[0066] the universal sequences, the universal primer is independent of the sequence of the target molecule.

[0067] In a third aspect of the present application, there is provided a method for nucleic acid amplification or detection for non-diagnostic purposes, the method comprising the step of binding a target molecule with a capture oligonucleotide, the capture oligonucleotide being as described in the first aspect of the present application.

[0068] In another preferred embodiment, the method comprises the steps of:

[0069] (a) binding a target molecule with a capture oligonucleotide (i.e. binding of a target molecule with a capture oligonucleotide);

[0070] (b) linear extension of the target molecule;

[0071] (d) exponential amplification of the universal primer,

[0072] the capture oligonucleotide comprises from 5' to 3' a first universal sequence (U2a), a folding sequence 1s, a second universal sequence (U1a), and a binding capture sequence (2a); wherein,

[0073] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0074] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0075] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence; and

[0076] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence;

[0077] Optionally, the 3' end of the folding sequence has a nucleic acid analogue modification.

[0078] The universal sequence, the universal primer is independent of the sequence of the target molecule.

[0079] In another preferred embodiment, the capture oligonucleotide is the capture oligonucleotide of the first aspect of the present application.

[0080] In another preferred embodiment, the method (direct method) comprises:

[0081] (1) the capture oligonucleotide binds to the specific target molecule through the binding capture sequence and the 3' end sequence,

[0082] (2) the target molecule is extended with the capture oligonucleotide as a template, adding a sequence complementary to the second universal sequence at the 3' end of the target molecule, obtaining a target molecule linear extension product;

[0083] (3) the second universal primer (U1a) binds to the target molecule linear extension product, and is extended with the target molecule linear extension product as a template and terminated at the 5' end of the target molecule, obtaining a second universal primer linear extension product;

[0084] (4) the second universal primer linear extension product binds to the folding sequence of the capture oligonucleotide and is extended, adding a complementary sequence of the first universal sequence (U2a) at the 3' end, obtaining a first universal primer linear extension product,

[0085] (5) exponential amplification based on the first universal primer and the second universal primer, obtaining an amplification product containing the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the sequence of the target molecule in the middle.

[0086] In another preferred embodiment, the method further comprises the step of: (6) using a probe and detecting the probe signal.

[0087] In another preferred embodiment, the method comprises the steps of:

[0088] (a) using the capture oligonucleotide to bind to the target molecule (i.e. using the capture oligonucleotide to bind to the target molecule);

[0089] (b) linear extension of the target molecule;

[0090] (c) enzyme specific recognition and cleavage;

[0091] (d) universal primer exponential amplification;

[0092] The capture oligonucleotide comprises, from 5' to 3', a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a) and a binding capture sequence (2a); wherein,

[0093] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0094] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule,

[0095] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence;

[0096] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence;

[0097] Optionally, the 3' end of the folding sequence has a nucleic acid analogue modification; and

[0098] (5) the capture oligonucleotide further comprises an enzyme cleavage recognition marker at the 3' end of the second universal sequence or the 5' end of the binding capture sequence,

[0099] The universal sequence, universal primer is independent of the sequence of the target molecule.

[0100] In another preferred embodiment, the method (cleavage method) comprises the steps of:

[0101] (1) the capture oligonucleotide binds to the specifically targeted molecule through the binding capture sequence and the 3' end sequence;

[0102] (2) the target molecule is extended with the capture oligonucleotide as a template, adding a sequence complementary to the second universal sequence at the 3' end of the target molecule to obtain a linear extension product of the target molecule;

[0103] (3) the enzyme specifically recognizes the enzyme cleavage site in the target molecule linear extension product and the capture oligonucleotide binding dimer and cleaves to obtain a capture oligonucleotide cleavage product containing a free 3' end;

[0104] (4) the capture oligonucleotide cleavage product containing a free 3' end is extended with the target molecule linear extension product as a template, adding a sequence complementary to the target molecule at the 3' end of the capture oligonucleotide cleavage product and terminating at the 5' end of the target molecule to obtain a capture oligonucleotide extension product;

[0105] (5) The capture oligonucleotide extension product binds to the folded sequence within the capture oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule, forming a half-hairpin structure product;

[0106] (6) The half-hairpin structure product is subjected to extension reaction under the action of polymerase, adding nucleotides complementary to the first universal sequence within the molecule at the 3' end, forming a complete hairpin structure product;

[0107] (7) The complete hairpin structure product is used as a template to perform amplification using universal primers, obtaining an amplification product containing the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the sequence of the target molecule in the middle.

[0108] In another preferred embodiment, the method further comprises the step of: (8) using a probe and detecting the probe signal.

[0109] In another preferred embodiment, the universal sequence and the universal primer are irrelevant to the sequence of the target molecule.

[0110] In another preferred embodiment, the target molecule is a 3' end and 5' end sequence-defined target molecule.

[0111] In another preferred embodiment, the 3' end and 5' end sequence-defined target molecule is a DNAase cleavage product of a site-specific cleavage nuclease, preferably a target molecule having a defined sequence at both ends due to cleavage by a site-specific cleavage nuclease.

[0112] In another preferred embodiment, the site-specific cleavage nuclease is an exonuclease and / or an endonuclease.

[0113] In another preferred embodiment, the endonuclease is a restriction enzyme.

[0114] In another preferred embodiment, the endonuclease is selected from any one or more of a methylation-dependent restriction enzyme, a methylation-sensitive restriction enzyme, a nicking enzyme, a CRISPR-Cas system, or a mismatch repair enzyme.

[0115] In another preferred embodiment, the methylation-dependent restriction enzyme comprises any one or two or more of Gla I, FspEI, MspJI, and LpnPI.

[0116] In another preferred embodiment, the enzyme recognizing the cleavage recognition marker contained in the capture oligonucleotide is selected from one or more of 3' Tth endonuclease, high-temperature-tolerant mismatch repair enzyme, and high-temperature-stable RNase H.

[0117] In a fourth aspect of the present application, there is provided a nucleic acid detection system, the system comprising the capture oligonucleotide of the first aspect of the present application or the composition or kit of the second aspect of the present application, Taq polymerase, dNTPs, MgCl2and PCR buffer.

[0118] In another preferred embodiment, the system comprises 1-100 nM of the capture oligonucleotide of the first aspect of the present application, 1-5 U (preferably 1-2 U) of Taq polymerase, 50-500 μΜ (preferably 100-300 μΜ) of dNTPs, 1-5 mM (preferably 1-3 mM) of MgCl2and PCR buffer.

[0119] In another preferred embodiment, the system further comprises primers (universal primers) and probes.

[0120] In another preferred embodiment, the probes comprise specific probes, universal probes, or a combination thereof.

[0121] In another preferred embodiment, the system further comprises 100-800 nM (preferably 100-400 nM) of universal primers.

[0122] In another preferred embodiment, the system further comprises 100-600 nM (preferably 100-300 nM) of probes.

[0123] In another preferred embodiment, the system further comprises at least 20 U (preferably 1-10 U) of 3'Tthendonuclease, thermostable mismatch repair enzyme and / or thermostable RNase H enzyme.

[0124] In another preferred embodiment, the system further comprises 1-20 U (preferably 5-15 U) of site-specific cleaving nuclease; preferably exonuclease and / or endonuclease.

[0125] In another preferred embodiment, the universal primers, probes are as described in the second aspect of the present application.

[0126] In another preferred embodiment, the endonuclease is a restriction enzyme.

[0127] In another preferred embodiment, the endonuclease is selected from the group consisting of methylation-dependent restriction enzyme, methylation-sensitive restriction enzyme, nicking enzyme, CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0128] In another preferred embodiment, the methylation-dependent restriction enzyme is selected from the group consisting of Gla I, FspEI, MspJI, LpnPI, or a combination thereof.

[0129] In a fifth aspect of the present application, there is provided use of the capture oligonucleotide of the first aspect of the present application, the composition or kit of the second aspect of the present application, and / or the nucleic acid detection system of the fourth aspect of the present application in the manufacture of a nucleic acid detection product.

[0130] In another preferred embodiment, the nucleic acid detection product is a DNA methylation detection product.

[0131] In another preferred embodiment, the product is selected from the group consisting of a kit, a device, a computer readable medium, or a combination thereof.

[0132] It should be understood that the general description above and the following detailed description are only exemplary and explanatory, and are not limiting of the present disclosure. BRIEF DESCRIPTION OF DRAWINGS

[0133] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and serve to explain the principles of the present application. It is readily apparent to one of ordinary skill in the art that the drawings described below are merely some embodiments of the present application, and other drawings can be obtained from these drawings without creative effort.

[0134] Figure 1 (A) shows the amplification principle of the capture oligonucleotide containing the enzyme digestion recognition marker; (B) shows the amplification principle of the capture oligonucleotide not containing the enzyme digestion recognition marker; (C) shows the amplification results of the two methods involved in the present study, i.e. the amplification plot, ΔRn is the difference in fluorescence intensity of the two amplifications. Among them, 1 is the amplification result of the present method 1 (cutting method, containing enzyme digestion recognition marker) combined with the target sequence after treatment; 2 is the amplification result of the present method 2 (direct method, not containing enzyme digestion recognition marker) combined with the target sequence after treatment, 3 is the amplification result of the present method 1 (cutting method, containing enzyme digestion recognition marker) combined with the target sequence without treatment, and 4 is the amplification result of the present method 2 (direct method, not containing enzyme digestion recognition marker) combined with the target sequence without treatment.

[0135] Figure 2 (A) shows the design of the capture oligonucleotide involved in the present application; (B) shows the design of the capture oligonucleotide involved in the comparative document (CN114717298A).

[0136] Figure 3The addition of a universal probe sequence in the capture oligonucleotide is shown; 1 / 3 / 5 is target molecule specific probe detection; 2 / 4 / 6 is universal probe detection. 1 / 2 is 2000 copies / reaction; 3 / 4 is 200 copies / reaction; 5 / 6 is negative control.

[0137] Figure 4 The sensitivity test results are shown. The target molecule concentrations of 1 / 2 / 3 / 4 are 2000 copies / reaction, 200 copies / reaction, 20 copies / reaction, and negative control, respectively.

[0138] Figure 5 The methylation detection of the locked nucleic acid modified capture oligonucleotide is shown. The target molecule concentrations of 1 / 2 / 3 / 4 are 2000 copies / reaction, 200 copies / reaction, 20 copies / reaction, and negative control, respectively.

[0139] Figure 6 The LINE-1 gene non-methylation results based on methylation sensitive restriction enzyme treatment are shown.

[0140] Figure 7 The Mycobacterium tuberculosis detection after methylation sensitive restriction enzyme treatment is shown. The target molecule concentrations of 1 / 2 / 3 / 4 are 2000 copies / reaction, 200 copies / reaction, 20 copies / reaction, and negative control, respectively. DETAILED DESCRIPTION

[0141] Example implementations will now be described more fully with reference to the accompanying drawings. Example implementations, however, can be implemented in many different forms and should not be construed as limited to the implementations set forth herein; rather, these implementations are provided so that this disclosure will be thorough and complete, and will fully convey the scope of example implementations to those skilled in the art.

[0142] Unless otherwise defined, all terms and phrases used herein, including technical and scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs, unless expressly defined otherwise or the context clearly indicates otherwise. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, particular methods and materials are now described.

[0143] It should be understood that all technical features of the present disclosure described above and technical features specifically described below (e.g., in the examples) can be combined with each other within the scope of the present disclosure, thereby constituting preferred technical solutions.

[0144] The present inventors have made extensive and in-depth research and for the first time accidentally discovered that linear amplification of target molecules using a capture oligonucleotide as a template for extension and then combining with a universal primer is performed, to obtain an intermediate sequence containing different universal primer sequences at both ends and a target molecule sequence in the middle, which can be triggered by the universal primer for exponential amplification. Then, the intermediate sequence obtained by linear amplification is subjected to exponential amplification guided by the universal primer and / or the capture oligonucleotide. Based on this, the present application is completed.

[0145] capture oligonucleotide

[0146] The present application provides a capture oligonucleotide for nucleic acid amplification, which comprises, in order from 5' end to 3' end, a first universal sequence (U2a), a folding sequence (1s), a second universal sequence (U1a) and a binding capture sequence (2a); wherein,

[0147] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0148] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0149] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and

[0150] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence,

[0151] the universal sequence is independent of the sequence of the target molecule.

[0152] Typically, the capture oligonucleotide described in the present application further comprises a nucleic acid analogue modification:

[0153] Preferably, (5) the 3' end of the binding capture sequence has a nucleic acid analogue modification; and / or

[0154] Preferably, (6) the 3' end of the folding sequence has a nucleic acid analogue modification.

[0155] Typically, the capture oligonucleotide described herein has two options.

[0156] In one preferred embodiment of the present application, the first selection of the capture oligonucleotide can comprise, from 5' to 3', a first universal sequence, a folding sequence, a second universal sequence, and a binding capture sequence; wherein the folding sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence, the capture oligonucleotide further comprises an enzyme cleavage recognition marker at the 3' end of the second universal sequence or the 5' end of the binding capture sequence, the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence, the folding sequence of the capture oligonucleotide has a nucleic acid analogue modification at its 3' end, and the universal primer is independent of the sequence of the target molecule.

[0157] In another preferred embodiment of the present application, the second selection of the capture oligonucleotide can comprise, from 5' to 3', a first universal sequence, a folding sequence, a second universal sequence, and a binding capture sequence; wherein the folding sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence, the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence, the folding sequence of the capture oligonucleotide has a nucleic acid analogue modification at its 3' end, and the universal primer is independent of the sequence of the target molecule.

[0158] Complementarity described herein includes perfect complementarity and partial complementarity. Generally, for a nucleic acid strand that needs to be extended, its 3' end sequence is at least 90% complementary, e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or perfectly complementary, to the corresponding complementary strand, as long as it does not affect the extension of the nucleic acid strand. For example, in the complementarity between the target molecule and the binding capture sequence of the capture oligonucleotide, the target molecule is the nucleic acid strand that needs to be extended, and its 3' end sequence is at least 90% complementary or perfectly complementary to the binding capture sequence (i.e., the 3' end nucleic acid of the target molecule has a pairing base on the capture oligonucleotide). For another example, in the complementarity between the universal primer and the linear extension product of the target molecule, the universal primer is the nucleic acid strand that needs to be extended, and its 3' end sequence is at least 90% complementary or perfectly complementary to the sequence of the linear extension product of the target molecule.

[0159] The target molecule with clear 3' end and 5' end sequence information is complementarily bound to the binding capture sequence of the capture oligonucleotide, and then extended with the capture oligonucleotide as a template to add the complementary strand of the second universal sequence at the 3' end of the target molecule (e.g., the 3' end of the target molecule is extended with the capture oligonucleotide as a template to add the complementary strand of the second universal sequence at the 3' end of the target molecule, and the 5' end of the target molecule is extended with the universal primer as a template to add the complementary strand of the first universal sequence at the 5' end of the target molecule). Figure 1The capture oligonucleotide can further comprise a nucleic acid extension blocking modification in order to prevent the capture oligonucleotide from extending itself. The nucleic acid extension blocking modification is usually located at the 3' end of the binding capture sequence. The nucleic acid extension blocking modification is a substance that can block the extension of DNA polymerase, so that the capture oligonucleotide cannot extend to the 3' end, thereby forming a complementary strand of the target molecule affecting the binding and extension of the subsequent capture oligonucleotide. The modification that can block the extension of DNA polymerase includes Spacer, thio group, thiol, amino or uracil base.

[0160] In embodiments of the present application, the capture oligonucleotide with the nucleic acid extension modification is a Spacer modification at the 3' end of the binding capture sequence. In order to further enhance the effect of nucleic acid extension blocking, a nucleic acid analogue modification can also be included at the 3' end of the binding capture sequence of the capture oligonucleotide. The nucleic acid analogue includes one or more selected from the following: peptide nucleic acid, locked nucleic acid, 2'-O, 4'-C-methyl bridged RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuracil nucleoside or 2'-fluoro RNA.

[0161] In embodiments of the present application, in the case of amplification by recognition and cleavage of enzymes, an enzyme cleavage recognition marker modification can also be added at the 3' end of the second universal sequence of the capture oligonucleotide or the 5' end of the binding capture sequence, so as to generate a free end by recognition and cleavage of enzymes, thereby extending and amplifying. The enzyme cleavage recognition marker modification includes / idsP / and RNA base modification. The recognition enzyme includes 3'Tth endonuclease, high-temperature stable mismatch repair enzyme and high-temperature stable RNase H.

[0162] In the present application, the first universal sequence and the second universal sequence can be artificially synthesized sequences. Therefore, when detecting different target molecules, only the binding capture sequence of the capture oligonucleotide needs to be designed according to the target molecule, while the first universal sequence and the second universal sequence can remain unchanged. In some embodiments, in order to reduce non-specific amplification, the binding capture sequence of the capture oligonucleotide is designed according to different target molecules, while the first universal sequence and the second universal sequence remain unchanged, thereby achieving multiplex amplification detection. The length or base ratio of the universal sequence (universal primer) can be routinely adjusted according to the composition, length, required specificity, etc. of the sequence to be amplified.

[0163] Target molecule

[0164] In the present application, the target molecule can be a target molecule with clear 3' end and 5' end sequence information (i.e. sequence clear), or a target molecule with clear 3' end and 5' end sequence information generated after biological treatment. The types of nucleic acid sequences with clear 3' end and 5' end sequence information include normal nucleic acid sequences, nucleic acid sequences with modifications, single nucleotide mutations, sequence transpositions, sequence deletions, sequence recombination, etc.

[0165] The target molecule with clear 3' end and 5' end sequence information can be a target molecule with clear 3' end and 5' end sequence information itself, such as microRNA mature body, microRNA precursor, cfDNA, etc.

[0166] The intermediate product of the target molecule with clear 3' end and 5' end sequence information can be obtained by biological methods, including the use of site-specific nucleic acid cleavage enzymes, such as AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), nucleic acid restriction endonuclease, methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nicking enzyme, meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, etc. Methylation-dependent restriction endonucleases such as GlaI, FspEI, MspJI and LpnPI; methylation-sensitive restriction endonucleases such as HpaII, SmaI, etc.; restriction endonucleases such as MspI, Xmal, etc.; CRISPR-Cas system includes guide short RNA matching the target DNA fragment and endonuclease that can recognize and cut specific sequences, such as Cas9, Cas12 or Cas13-based CRISPR-Cas system.

[0167] Composition, kit

[0168] The present application provides a composition or kit for nucleic acid amplification, which comprises the capture oligonucleotide described above in the present application.

[0169] Typically, the present application provides a composition or kit comprising a capture oligonucleotide as described in any of the embodiments herein for amplifying or detecting a nucleic acid. Exemplary capture oligonucleotides are shown in capture oligonucleotide 1 (BH1, SEQ ID NO: 1-spacer18-SEQ ID NO: 2), capture oligonucleotide 3 (BH3, SEQ ID NO: 1-spacer18-SEQ ID NO: 9), capture oligonucleotide 4 (BH4, SEQ ID NO: 1-spacer18-SEQ ID NO: 11), capture oligonucleotide 5 (BH5, SEQ ID NO: 12-spacer18-SEQ ID NO: 13), or capture oligonucleotide 6 (BH6, SEQ ID NO: 16-spacer18-SEQ ID NO: 17). Exemplary modified capture oligonucleotides are shown in capture oligonucleotide 1, capture oligonucleotide 3, or capture oligonucleotide 4. The kit further comprises reagents for generating a target molecule with explicit 3' end and 5' end sequence information (e.g., target molecule pre-sequence pretreatment reagents), such as any one or more of the above-mentioned site-specific cleavage nucleases. The kit further comprises any one or more of a DNA polymerase, dNTPs, Mg 2+

[0170] In addition, the kit further comprises a universal primer. Specifically, the kit further comprises a universal primer as previously described herein. Exemplary universal primers are shown in SEQ ID NOs: 2 and 3.

[0171] In detecting different target molecules, only the binding capture sequence portion of the specific capture oligonucleotide needs to be designed according to the target molecule, while the universal primer can remain unchanged.

[0172] For detecting a nucleic acid, the kit can further comprise a probe. In some embodiments, the probe is labeled with a fluorescent group and / or a quenching group. Typically, the fluorescent group is labeled at the 5' end of the detection probe, and the quenching group is labeled at the 3' end of the detection probe. The fluorescent group comprises any one or more of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; and the quenching group comprises any one or more of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra. Exemplary probes are shown in SEQ ID NOs: 4, 8, or 19.

[0173] The kit can further comprise reagents required for sequencing, which are well known to those skilled in the art, such as a polymerase, sequencing primers, etc.

[0174] Nucleic acid amplification or detection method

[0175] ​The present application provides a nucleic acid amplification or detection method, the method comprising the step of binding a target molecule with a capture oligonucleotide, the capture oligonucleotide being as described in the first aspect of the present application.

[0176] Typically, the present application provides a nucleic acid amplification or detection method, the method comprising the steps of:

[0177] (a) binding a target molecule with a capture oligonucleotide (i.e. binding a target molecule with a capture oligonucleotide);

[0178] (b) linear extension of the target molecule;

[0179] (d) exponential amplification of the universal primer,

[0180] the capture oligonucleotide comprising from 5' to 3' a first universal sequence (U2a), a folding sequence 1s, a second universal sequence (U1a) and a binding capture sequence (2a); wherein,

[0181] (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule;

[0182] (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule;

[0183] (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located 3' to the binding capture sequence; and

[0184] (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence;

[0185] Optionally, the folding sequence has a nucleic acid analogue modification 3' to the folding sequence;

[0186] Optionally, the capture oligonucleotide further comprises an enzyme cleavage recognition marker located 3' to the second universal sequence or 5' to the binding capture sequence;

[0187] the universal sequences, the universal primers are independent of the sequence of the target molecule.

[0188] In a preferred embodiment of the present application, the nucleic acid amplification or detection method is a nucleic acid amplification or detection method for non-diagnostic purposes.

[0189] The nucleic acid amplification or detection method can be further divided into a cleavage method comprising the enzyme specific recognition and cleavage step (c) and a direct method not comprising step (c).

[0190] In a preferred embodiment of the present application, the cleavage method comprises the steps of binding of the capture oligonucleotide to the target molecule, linear extension of the target molecule, enzyme specific recognition and cleavage, and exponential amplification using universal primers. Specifically, the method comprises the steps of:

[0191] (1) binding of the capture oligonucleotide to the 3' end sequence-defined target molecule via the capture sequence;

[0192] (2) extension of the target molecule using the capture oligonucleotide as a template, adding a sequence complementary to the second universal sequence to the 3' end of the target molecule, to obtain a linear extension product of the target molecule;

[0193] (3) enzyme specific recognition and cleavage of the enzyme cleavage site in the capture oligonucleotide-binding dimer of the linear extension product of the target molecule, to obtain a capture oligonucleotide cleavage product containing a free 3' end;

[0194] (4) extension of the capture oligonucleotide cleavage product containing a free 3' end using the linear extension product of the target molecule as a template, adding a sequence complementary to the target molecule to the 3' end of the capture oligonucleotide cleavage product containing a free 3' end and terminating at the 5' end of the target molecule, to obtain a capture oligonucleotide extension product;

[0195] (5) binding of the capture oligonucleotide extension product to the folded sequence within the capture oligonucleotide via the extended sequence complementary to the 5' end sequence of the target molecule, to form a half-hairpin structure product;

[0196] (6) extension of the half-hairpin structure product under the action of a polymerase, adding nucleotides complementary to the first universal sequence within the molecule to the 3' end, to form a complete hairpin structure product;

[0197] (7) amplification using universal primers using the complete hairpin structure product as a template, to obtain an amplification product containing the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle.

[0198] The amplification optionally further comprises the use of a probe.

[0199] In a preferred embodiment of the present application, the direct method comprises the steps of binding of the capture oligonucleotide to the target molecule, linear extension of the target molecule, and exponential amplification using universal primers. Specifically, the method comprises:

[0200] (1) binding of the capture oligonucleotide to the 3' end sequence-defined target molecule via the capture sequence;

[0201] (2) the target molecule is extended with the capture oligonucleotide as a template, adding a sequence complementary to the second universal sequence at the 3' end of the target molecule, obtaining a target molecule linear extension product;

[0202] (3) the second universal primer binds to the target molecule linear extension product, and is extended with the target molecule linear extension product as a template and terminated at the 5' end of the target molecule, obtaining a second universal primer linear extension product;

[0203] (4) the second universal primer linear extension product binds to the folded sequence of the capture oligonucleotide and is extended, adding a sequence complementary to the first universal sequence (U2a) at the 3' end, obtaining a first universal primer linear extension product;

[0204] (5) exponential amplification based on the first universal primer and the second universal primer, obtaining an amplification product containing the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle.

[0205] The amplification optionally further comprises the use of a probe.

[0206] Detection system

[0207] The present application provides a nucleic acid detection system, which comprises the capture oligonucleotide of the first aspect of the present application or the composition or kit of the second aspect of the present application, Taq polymerase, dNTP, MgCl2 and PCR buffer.

[0208] Typically, the detection system further comprises primers (universal primers) and probes (specific probes, universal probes).

[0209] Methylation detection system

[0210] In specific embodiments, the present application relates to a methylation detection system, which mainly comprises two parts of methylation-dependent restriction enzyme treatment and / or methylation-sensitive restriction enzyme treatment, and fluorescent PCR technology based on capture oligonucleotide and / or universal primer amplification. The methylation detection system involves the use of methylation-dependent restriction enzyme treatment and / or methylation-sensitive restriction enzyme treatment on the target gene sequence; it involves fluorescent PCR amplification of the enzyme digestion product of methylation-dependent restriction enzyme treatment and / or methylation-sensitive restriction enzyme. Preferably, the methylation detection system comprises a capture oligonucleotide, a probe and a universal primer, and the above components are as described elsewhere herein.

[0211] The methylation detection system involves two choices of capture oligonucleotides:

[0212] The first option can be from 5' to 3' comprising a first universal sequence, a folding sequence, a second universal sequence, and a binding capture sequence, wherein the folding sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence, the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence, preferably the folding sequence of the capture oligonucleotide has a nucleic acid analogue modification at the 3' end, the capture oligonucleotide further comprises an enzyme cleavage recognition marker at the 3' end of the second universal sequence or the 5' end of the binding capture sequence, and the universal primer is independent of the sequence of the target molecule.

[0213] In a preferred embodiment of the application, the binding capture sequence has a nucleic acid analogue modification at the 3' end.

[0214] In another preferred embodiment of the application, the binding capture sequence has a nucleic acid analogue modification at the 3' end and the folding sequence has a nucleic acid analogue modification at the 3' end.

[0215] The second option can be from 5' to 3' comprising a first universal sequence, a folding sequence, a second universal sequence, and a binding capture sequence, wherein the folding sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence, the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence, preferably the folding sequence of the capture oligonucleotide has a nucleic acid analogue modification at the 3' end, and the universal primer is independent of the sequence of the target molecule.

[0216] In a preferred embodiment of the application, the binding capture sequence has a nucleic acid analogue modification at the 3' end.

[0217] In another preferred embodiment of the application, the binding capture sequence has a nucleic acid analogue modification at the 3' end and the folding sequence has a nucleic acid analogue modification at the 3' end.

[0218] Typically, the capture oligonucleotide involved in the methylation detection system has a nucleic acid analogue modification; preferably, the nucleic acid analogue comprises any one or a combination of at least two of a peptide nucleic acid, a locked nucleic acid, a transposed base, a Spacer, a 2'-0, 4'-C-methylated bridged RNA, a 2'-methoxy modified base, a 2'-0-methyl RNA, a deoxyuracil nucleoside (2'-deoxyuridine), a 2-fluoro RNA, or a 2'-fluoro RNA. The above preferred nucleic acid analogue modification is at the 3' end sequence of the binding capture sequence or the 3' end sequence of the folding sequence of the capture oligonucleotide.

[0219] In the embodiments of the present application, the probes (including specific probes, universal probes) involved in the methylation detection system are labeled with fluorescent groups and quenching groups at both ends, respectively.

[0220] The preferred fluorescent detection group is selected from the group consisting of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LCRED460, or a combination thereof.

[0221] The preferred quenching group is selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.

[0222] The present application provides two methods for the above-mentioned fluorescence-based PCR amplification detection:

[0223] The first method comprises the steps of capturing oligonucleotide binding to target molecules (i.e. capturing oligonucleotide binding to target molecules), linear extension of target molecules, enzyme-specific recognition and cleavage, and exponential amplification of universal primers.

[0224] Specifically, the method comprises: (1) the capturing oligonucleotide binds to the target molecule with a clear 3' end sequence through the binding of the capturing sequence, (2) the target molecule is extended with the capturing oligonucleotide as a template, adding a sequence complementary to the second universal sequence to the 3' end of the target molecule to obtain a linear extension product of the target molecule, (3) the enzyme specifically recognizes and cleaves the enzyme cleavage site in the capturing oligonucleotide binding dimer of the linear extension product of the target molecule to obtain a capturing oligonucleotide cleavage product containing a free 3' end, (4) the capturing oligonucleotide cleavage product containing a free 3' end is extended with the linear extension product of the target molecule as a template, adding a sequence complementary to the target molecule to the 3' end of the capturing oligonucleotide cleavage product containing a free 3' end and terminating at the 5' end of the target molecule to obtain an extension product of the capturing oligonucleotide, (5) the extension product of the capturing oligonucleotide binds to the folding sequence in the capturing oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule to form a semi-hairpin structure product, (6) the semi-hairpin structure product is extended under the action of the polymerase to add nucleotides complementary to the first universal sequence in the molecule to the 3' end to form a complete hairpin structure product, (7) the complete hairpin structure product is used as a template to perform amplification with a universal primer to obtain an amplification product containing the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle. The amplification optionally further comprises the use of a probe.

[0225] The second method involves steps including capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of target molecules, and exponential amplification using universal primers.

[0226] Specifically, the method includes: (1) capturing oligonucleotides by binding the capture sequence to a target molecule with a clearly defined 3' end sequence; (2) extending the target molecule using the capture oligonucleotide as a template, adding a sequence complementary to the second universal sequence to the 3' end of the target molecule to obtain a linear extension product of the target molecule; (3) binding the second universal primer to the linear extension product of the target molecule, extending it using the linear extension product of the target molecule as a template, and terminating at the 5' end of the target molecule to obtain a linear extension product of the second universal primer; (4) binding the linear extension product of the second universal primer to the folded sequence of the capture oligonucleotide and extending it, adding a complementary sequence of the first universal sequence (U2a) to the 3' end to obtain a linear extension product of the first universal primer; and (5) performing exponential amplification based on the first universal primer and the second universal primer to obtain an amplification product containing the first universal primer sequence (U2a) and the complementary sequence of the second universal primer (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle. The amplification optionally also includes the use of a probe.

[0227] In a specific embodiment of the present invention, methylation sites in the Septine 9 gene, as described in SEQ ID NO:5, are detected using the following two methods:

[0228] Option 1: As Figure 1 As shown in Figure A, capturing oligonucleotide 1 (BH1) is contacted with GlaI-digested DNA. Capturing oligonucleotide 1 (BH1) binds complementary to target molecule 1 as shown in SEQ ID NO:7. Target molecule 1 extends using capturing oligonucleotide 1 (BH1) as a template by adding a sequence complementary to SEQ ID NO:2 of capturing oligonucleotide 1 (BH1) to its 3' end, obtaining the extended target molecule (i.e., the linear extension product of the target molecule). The dimer of the extended target molecule and capturing oligonucleotide 1 (BH1) as shown in SEQ ID NO:1-spacer18-SEQ ID NO:2 can be recognized and cleaved by 3'Tth endonuclease, thermostable mismatch repair enzyme, and thermostable RNase H. The cleaved product can then undergo linear extension using the extended target molecule as a template. The extended product folds due to the presence of the complementary sequence, forming a product with a complete hairpin structure. This hairpin structure product can be extended using universal primers as shown in SEQ ID NO:3 and SEQ ID NO:4 and primers as shown in SEQ ID NO:7. The probe shown in NO:5 was amplified, and the probe signal was detected.

[0229] Option 2: AsFigure 1 As shown in B, the capture oligonucleotide shown in capture oligonucleotide 1 (BH1) is contacted with the GlaI enzyme-cleaved DNA, the capture oligonucleotide 1 (BH1) is complementary to the target molecule 1 shown in SEQ ID NO: 7, the target molecule 1 is extended with the capture oligonucleotide 1 (BH1) as a template to add a sequence complementary to SEQ ID NO: 2 in the capture oligonucleotide 1 (BH1) at the 3' end of the target molecule, obtaining an extended target molecule (i.e. target molecule linear extension product); the extended target molecule is complementary to the second universal primer SEQ ID NO: 4; the second universal primer SEQ ID NO: 4 is extended with the extended target molecule as a template to obtain a sequence complementary to the extended target molecule (i.e. 5'U1a-2a-1a 3'); the sequence can be extended with the capture oligonucleotide 1 (BH1) complementary to SEQ ID NO: 1 (i.e. 1a: 1s complementary) to form a single-stranded product containing the second universal primer sequence (U1a) and the first universal primer complementary sequence (U2s) at the 5' and 3' ends, respectively, and the target molecule sequence in the middle (i.e. 5'U1a-2a-1a-U2s 3'); finally, the universal primer shown in SEQ ID NO: 3 and SEQ ID NO: 4 and the probe shown in SEQ ID NO: 5 are used for amplification, and the probe signal is detected.

[0230] The main advantages of the present application include:

[0231] Compared with the existing methylation detection technology based on bisulfite conversion, the present application has the following beneficial effects:

[0232] (1) The cfDNA methylation detection technology involved in the present application does not require cumbersome chemical treatment, purification and other processes, and only the 3' end and 5' end mediated by the methylation site can initiate amplification in the present application scheme, which can effectively inhibit the amplification false positive caused by the random fragmentation of cfDNA, improve the specificity of amplification, and is more suitable for the methylation detection of cfDNA with high fragmentation degree.

[0233] (2) The capture oligonucleotide and universal primer in the present application are specially designed, and when the target molecule exists in the environment, the extension reaction mediated by the capture oligonucleotide can be initiated, and the signal can be amplified through subsequent exponential amplification, meeting the sensitivity requirement of cfDNA methylation detection.

[0234] Compared with the existing methylation-dependent restriction endonuclease technology (ZL 202111389443.0) and multiplex amplification method (CN114717298A), the present application has the following beneficial effects:

[0235] (1) The amplification method described in the present application only needs one end extension closed capture oligonucleotide and a pair of universal primers to realize the detection of methylation. This unique design structure, compared with the prior art (ZL202111389443.0), not only eliminates the problem of the simultaneous presence of the oligonucleotide adapter and the capture oligonucleotide required by the prior art, but also reduces the requirement for the number of primers. Moreover, the formation of the hairpin structure during the amplification process and the USER enzyme treatment make the operation more simple. Compared with the prior art (CN114717298A), the 3' closed capture oligonucleotide designed in the present application can only start the extension of the target molecule when the target molecule with clear 3' and 5' end sequences exists, which improves the detection specificity. Moreover, the 3'Tth endonuclease, high-temperature mismatch repair enzyme and high-temperature stable RNase H can be directly used for exponential amplification based on the capture oligonucleotide with enzyme cutting recognition site modification and universal primers, which improves the amplification efficiency and detection sensitivity.

[0236] (2) When detecting methylation of different target molecules, the present application only needs to design specific capture oligonucleotide binding capture sequences and folding region parts according to the target molecules, while keeping the universal primer part unchanged, which reduces the interference between multiple primers during the amplification of multiple target molecules, improves the reaction sensitivity, and thus realizes the methylation detection of multiple target molecules.

[0237] The long novel coronavirus diagnostic biomarker group provided by the application is further described below in combination with specific examples.

[0238] It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods not specified in the following examples are generally carried out according to the conventional conditions, such as the conditions described in Sambrook. J et al. Molecular Cloning: A Laboratory Manual (translated by Huang Peitang et al., Beijing: Science Press, 2002), or according to the conditions recommended by the manufacturer (for example, the product instruction). Unless otherwise specified, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples are commercially available or can be prepared according to the literature method unless otherwise specified.

[0239] Example 1: Methylation detection of ultrasonic fragment DNA of human Septine 9 gene based on the amplification principle of capture oligonucleotide containing enzyme cutting recognition marker

[0240] (1) Obtain methylated Jurka genomic DNA, and identify the methylation state of Septine 9 gene by sequencing.

[0241] (2) The DNA treated by ultrasonic fragmentation is subjected to enzyme cutting reaction by using methylation-dependent restriction enzyme GlaI, and the reaction system is as follows: 1x enzyme cutting buffer, 10 U GlaI, DNA (20000 copies per reaction), and the total volume is 10 μL; the reaction condition is incubation at 37°C for 1 hour; after the enzyme cutting reaction is completed, the system is heated to 85°C for incubation for 10 minutes to inactivate GlaI by heating.

[0242] (4) The capture oligonucleotide and the universal primer of Septine 9 gene are added to the above enzyme cutting system respectively for amplification, and the reaction system is as follows: the ultrasonic fragmentation DNA after enzyme cutting, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, and the final volume is 20 μL; the PCR reaction program is pre-denaturation at 95°C for 3 minutes; 10 s at 94°C, 90 s at 66°C, 5 cycles; 10 s at 95°C, 20 s at 65°C, 40 cycles; real-time fluorescent PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.

[0243] The combination of the capture oligonucleotide, the universal primer and the specific probe used includes:

[0244] Capture oligonucleotide 1, abbreviated as BH1 (2'-methoxy modified base is in italics)

[0245] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGGCGACC / idSp / GCT GCCCA -Spacer C3

[0246] The sequence on the left side of spacer18 is:

[0247] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC ， The sequence number is SEQ ID NO: 1;

[0248] The sequence on the right side of spacer18 is:

[0249] TCATCGCAGTGTCGCCGTGG GCGACC / idSp / GCT GCCCA -Spacer C3, the sequence number is SEQ ID NO: 2;

[0250] The 3' end C of SEQ ID NO: 1 and the 5' end T of SEQ ID NO: 2 are connected with spacer18 respectively.

[0251] First universal primer

[0252] ACGCTCACGCTCGCTGCTAC (SEQ ID NO: 3)

[0253] Second universal primer

[0254] TCATCGCAGTGTCGCCGTGG (SEQ ID NO: 4)

[0255] Specific probe

[0256] 5'FAM-ACCAGCCATCATGTCGGAC-MGB (SEQ ID NO: 5)

[0257] The partial sequence of human Septine 9 gene (target molecule pre-sequence 1) is as follows: / / is the enzyme cutting position, and the CGs before and after it are the methylation positions.

[0258] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC (SEQ ID NO: 6, wherein the 18th to 62nd positions are the sequence of target molecule 1, and the sequence of target molecule 1 is numbered as SEQ ID NO: 7)

[0259] The 3' end of the capture oligonucleotide has a Spacer C3 to block extension. The enzyme cutting recognition cutting is mediated by 3'Tth endonuclease, and the concentration used in amplification is 10 U. Figure 1 CIt is explained that the Septine 9 gene of the methylation DNA can be detected.

[0260] Example 2: Detection of human Septine 9 gene DNA methylation based on the principle of amplification of capture oligonucleotide containing enzyme cutting recognition marker

[0261] (1) Obtain the methylation Jurka genomic DNA, and identify the methylation state of Septine 9 gene by sequencing.

[0262] (2) Perform enzyme cutting reaction on the above ultrasonic fragment treated DNA by using methylation dependent restriction endonuclease GlaI, and the reaction system is: 1x enzyme cutting buffer, 10 U GlaI, DNA (20000 copies / reaction), and the total volume is 10 μL; the reaction condition is 37℃ incubation for 1 hour; after the enzyme cutting reaction is completed, the system is heated to 85℃ and incubated for 10 minutes to inactivate GlaI by heat.

[0263] (3) The capture oligonucleotide and the universal primer of the Septin 9 gene were added to the above enzyme digestion system for amplification, and the reaction system was as follows: the ultrasonic fragmented DNA after enzyme digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, and the final volume was 20 μl; the PCR reaction program was 95°C pre-denaturation for 3 min; 10 s at 94°C, 90 s at 66°C, 5 cycles; 10 s at 95°C, 20 s at 65°C, 40 cycles; real-time fluorescent PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values were collected.

[0264] The combination of the capture oligonucleotide, the universal primer and the specific probe used includes:

[0265] Capture oligonucleotide 1, abbreviated as BH1 (2' methoxy modified bases in italics)

[0266] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGGCGACC / idSp / GCT GCCCA -Spacer C3

[0267] The sequence on the left side of spacer18 is:

[0268] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC , and the sequence number is SEQ ID NO: 1;

[0269] The sequence on the right side of spacer18 is:

[0270] TCATCGCAGTGTCGCCGTGG GCGACC / idSp / GCT GCCCA -Spacer C3, sequence number SEQ ID NO: 2;

[0271] The 3' end C of SEQ ID NO: 1 and the 5' end T of SEQ ID NO: 2 are connected with spacer18 respectively.

[0272] Capture oligonucleotide 2 in the comparative document (CN114717298A), abbreviated as BH2 (2' methoxy modified bases in italics)

[0273] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGGCGACCCGCTGCCCA

[0274] The sequence on the left side of spacer 18 is:

[0275] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC , and the sequence number is SEQ ID NO: 1;

[0276] The sequence on the right side of spacer 18 is:

[0277] TCATCGCAGTGTCGCCGTGG GCGACCCGCTGCCCA, and the sequence number is SEQ ID NO: 8;

[0278] The 3' end C of SEQ ID NO: 1 and the 5' end T of SEQ ID NO: 8 are connected with spacer 18 respectively.

[0279] First universal primer

[0280] ACGCTCACGCTCGCTGCTAC (SEQ ID NO: 3)

[0281] Second universal primer

[0282] TCATCGCAGTGTCGCCGTGG (SEQ ID NO: 4)

[0283] Specific probe

[0284] 5'FAM-ACCAGCCATCATGTCGGAC-MGB (SEQ ID NO: 5)

[0285] The partial sequence of human Septine 9 gene (target molecule pre-sequence 1) is as follows: / / is the enzyme cutting position, and the CG before and after it is the methylation position.

[0286] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGG GTCGC / / GCGGAGGGC (SEQ ID NO: 6, wherein the 18th to 62nd are target molecule 1 sequence, and the sequence number of target molecule 1 is SEQ ID NO: 7)

[0287] The differences between the present application and the comparative document are as follows: (1) the target molecule of the present application needs to be treated at both ends to obtain a target molecule with a clear 3' end and 5' end sequence, while the target molecule of the comparative document is a target molecule with a clear 5' end sequence, which improves the specificity of detection; (2) the 3' end of the capture oligonucleotide binding capture region of the present application has a Spacer C3 to block extension, and only after the specific target molecule binds to it can it cause linear extension of the target molecule, while the 3' end of the capture oligonucleotide binding capture region of the comparative document is not modified, and only needs to bind to the target molecule to cause extension of the capture oligonucleotide, which improves the specificity of detection; (3) the 3' end of the universal sequence or the 5' end of the capture sequence in the capture oligonucleotide of the present application is enzymatically cleaved and labeled with one or more of the following: / idsP / and RNA base modification, and only after the specific target molecule binds to it can it cause specific enzymatic cleavage and cutting, thereby causing extension of the capture oligonucleotide and subsequent exponential amplification, while the capture oligonucleotide of the comparative document does not have the related design. Figure 2 The present application has higher specificity because it can only be amplified by methylation-dependent restriction enzymes, while the system described in the comparative document can also be amplified in the presence of highly uncut target molecules.

[0288] Example 3: Experiment of different probes

[0289] In order to improve the flexibility of capture oligonucleotide detection, this embodiment selects to add a universal probe sequence between the universal primer sequence and the capture sequence of a capture oligonucleotide. The capture oligonucleotide, universal primer, enzyme cleavage conditions and amplification conditions used are the same as in Example 1.

[0290] The capture oligonucleotide used includes:

[0291] The capture oligonucleotide without a universal probe sequence is the same as in Example 1

[0292] The capture oligonucleotide containing a universal probe sequence 3, referred to as BH3 (the underlined part is the self-folding region, the italicized 3' end of the folded sequence is a 2' methoxy modified base, and the italicized 3' end of the capture sequence is a 2' methoxy modified base)

[0293] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCG CCGTGGCGATGGCTGAGGATTCTG GCGACC / idSp / GCT GCCCA -Spacer C3

[0294] The sequence on the left side of spacer 18 is:

[0295] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC , and the sequence number is SEQ ID NO: 1.

[0296] The sequence on the right side of spacer 18 is:

[0297] TCATCGCAGTGTCGCCGTGG CGATGGCTGAGGATTCTG GCGACC / idSp / GCT GCCCA -Spacer C3, and the sequence number is SEQ ID NO: 9.

[0298] The 3' end C of SEQ ID NO: 1 and the 5' end T of SEQ ID NO: 9 are connected with spacer 18, respectively.

[0299] Universal probe sequence

[0300] FAM-CGATGGCTGAGGATTCTG-MGB (SEQ ID NO: 10)

[0301] The partial sequence of human Septine 9 gene is shown in Example 1.

[0302] As shown in Figure 3 , the capture oligonucleotide without universal probe sequence and the capture oligonucleotide containing universal probe sequence both appear amplification curve in the detection of 2000 copies, 200 copies of methylation positive genomic DNA, showing positive results, indicating that the use of universal probe sequence or specific target molecular probe sequence can realize high sensitivity methylation detection. However, there is no obvious difference between the two in this embodiment.

[0303] Example 4: Sensitivity test

[0304] In order to test the sensitivity of the detection of NA methylation of the present application, the capture oligonucleotide, universal primer and specific probe used in this embodiment are the same as those in Example 1, and the enzyme digestion conditions and amplification conditions are the same as those in Example 1. As shown in Figure 4 , when there are 2000 copies / reaction, 200 copies / reaction, 20 copies / reaction of methylation positive genomic DNA in the reaction, all can show positive results, and the negative control NC has no amplification.

[0305] Example 5: Methylation detection of capture oligonucleotide modified by locked nucleic acid

[0306] (1) Obtain methylated Jurka genomic DNA, and sequence to identify the methylation state of Septine 9 gene.

[0307] (2) Perform enzyme cleavage reaction on the above ultrasonic fragment-treated DNA using methylation-dependent restriction enzyme GlaI, and the reaction system is 1x enzyme cleavage buffer, 10 U GlaI, DNA (20000 copies per reaction), and a total volume of 10 μL; the reaction condition is incubation at 37°C for 1 hour; after the enzyme cleavage reaction is completed, the system is heated to 85°C for incubation for 10 minutes to inactivate GlaI.

[0308] (3) Add the capture oligonucleotide and the universal primer of Septine 9 gene to the above enzyme cleavage system for amplification, and the reaction system is the ultrasonic fragment DNA after enzyme cleavage, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2, and 1X PCR buffer, with a final volume of 20 μL; the PCR reaction program is pre-denaturation at 95°C for 3 minutes; 10 s at 94°C, 90 s at 66°C, 5 cycles; 10 s at 95°C, 20 s at 65°C, 40 cycles; real-time fluorescent PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.

[0309] The combination of the universal primer, the specific probe, and the target molecule sequence used is the same as in Example 1, and the capture oligonucleotide includes:

[0310] Capture oligonucleotide 4, abbreviated as BH4 (the bases in front are locked nucleic acid modifications, and the 3' end of the folded sequence in italics is a 2' methoxy modified base)

[0311] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC / spacer18 / TCATCGCAGTGTCGCCGTGGGCGACC / idSp / GCT G+C+C+CA -Spacer C3

[0312] The sequence on the left side of spacer18 is:

[0313] ACGCTCACGCTCGCTGCTACGTTGACCG CGGGGTC , and the sequence number is SEQ ID NO: 1;

[0314] The sequence on the right side of spacer18 is:

[0315] TCATCGCAGTGTCGCCGTGGGCGACC / idSp / GCT G+C+C+CA- Spacer C3, SEQ ID NO: 11;

[0316] The 3' end C of SEQ ID NO: 1 and the 5' end T of SEQ ID NO: 11 are connected with spacer 18, respectively.

[0317] The capture oligonucleotide has Spacer C3 at the 3' end of the folding sequence to block extension. As shown, 200 copies, 100 copies of the positive template appear amplification curve, showing positive results, negative control NC has no amplification curve, showing negative results. It shows that the capture oligonucleotide modified with locked nucleic acid can be used in the present application and DNA methylation detection. Figure 5

[0318] Example 6: Amplification principle based on capture oligonucleotide without enzyme cutting recognition mark for methylation detection of ultrasonic fragment DNA of human LINE-1 gene

[0319] (1) Obtain HELA genomic DNA, and identify the methylation state by sequencing.

[0320] (2) Perform enzyme cutting reaction on the DNA by using methylation-sensitive restriction endonuclease HinP1I, and the reaction system is: 1x enzyme cutting buffer, 10U HinP1I, genomic DNA, a total volume of 10μL; the reaction condition is 37℃ incubation for 1 hour.

[0321] (3) Add the treated gene capture oligonucleotide and universal primer to the above enzyme cutting system for amplification, and the reaction system is: enzyme-cutting genomic DNA, 5nM capture oligonucleotide, 0.5U Taq DNA polymerase, 200μM dNTPs, 2.5mM MgCl2 and 1X PCR buffer, a final volume of 20μl; the PCR reaction program is 95℃ pre-denaturation for 3min; 94℃ 10s, 66℃ 90s, 5 cycles; 95℃ 10s, 65℃ 20s, 40 cycles; real-time fluorescent PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.

[0322] The combination of the capture oligonucleotide, specific primer, universal primer, and specific probe used includes:

[0323] Capture oligonucleotide 5, abbreviated as BH5 (2'-methoxy modified bases are in italics)

[0324] ACGCTCACGCTCGCTGCTACCGCTTTT CAGACCGG / spacer18 / CGCAGTGTCGCCGT GGCGATGGCTGAGGATTCTG / idSp / AT CCGTTTCTT AAGCCG ​-Spacer C3

[0325] The sequence on the left side of spacer 18 is:

[0326] ACGCTCACGCTCGCTGCTAC CGCTTTT CAGACCGG , and the sequence number is SEQ ID NO: 12.

[0327] The sequence on the right side of spacer 18 is:

[0328] CGCAGTGTCGCCGTGG CGATGGCTGAGGATTCTG / idSp / AT CCGTTTCTT AAGCCG -Spacer C3, and the sequence number is SEQ ID NO: 13.

[0329] The 3' end G of SEQ ID NO: 12 and the 5' end C of SEQ ID NO: 13 are connected with spacer 18, respectively.

[0330] First universal primer

[0331] ACGCTCACGCTCGCTGCTAC (SEQ ID NO: 3)

[0332] Second universal primer

[0333] TCATCGCAGTGTCGCCGTGG (SEQ ID NO: 4)

[0334] Universal probe sequence

[0335] FAM-CGATGGCTGAGGATTCTG-MGB (SEQ ID NO: 10)

[0336] The partial sequence of human LINE-1 gene (target molecule pre-sequence 2) is as follows: / / is the enzyme cutting position, and the CGs before and after it are methylation positions.

[0337] CGAATATTGC / / GCTTTTCAGACCGGCTTAAGAAACGGC / / GCACCACGAGA (SEQ ID NO: 14, wherein the 11th to 37th positions are the sequence of target molecule 2, and the sequence number of target molecule 2 is SEQ ID NO: 15)

[0338] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 6 It is explained that the detection result can be detected for the non-methylation state based on the methylation-sensitive restriction enzyme treatment.

[0339] Example 7: Detection based on IS6110 fragment of Mycobacterium tuberculosis according to the present application

[0340] (1) Obtain Mycobacterium tuberculosis genomic DNA.

[0341] (2) Perform enzyme digestion reaction on the DNA using restriction enzyme Fok I, with a reaction system of 1x enzyme digestion buffer, 10 U Fok I, Mycobacterium tuberculosis genomic DNA, a total volume of 10 μL; and a reaction condition of incubation at 37°C for 1 hour.

[0342] (3) Add the treated gene capture oligonucleotide and universal primer to the above enzyme digestion system for amplification, with a reaction system of enzyme-digested Mycobacterium tuberculosis genomic DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2, and 1X PCR buffer, a final volume of 20 μL; a PCR reaction program of 95°C pre-denaturation for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; and real-time fluorescent PCR performed on a ROCHE instrument (480) to collect the corresponding fluorescence values.

[0343] The combinations of the capture oligonucleotide, specific primer, universal primer, and specific probe used include:

[0344] Capture oligonucleotide 6, abbreviated as BH6 (2’-methoxy modified bases in italics)

[0345] ACGCTCACGCTCGCTGCTACCAGGTGG TTCATCGAG

[0346] / spacer18 / CGCAGTGTCGCCGTGGCGATGGCTGAGGATTCTG ctctgcg a / idSp / ca t ccgc -Spacer C3

[0347] The sequence on the left side of spacer18 is:

[0348] ACGCTCACGCTCGCTGCTACCAGGTGG TTCATCGAG , and the sequence number is SEQ ID NO: 16;

[0349] The sequence on the right side of spacer18 is:

[0350] CGCAGTGTCGCCGTGG CGATGGCTGAGGATTCTG ctctgcg a / idSp / ca tccgc- Spacer C3, SEQ ID NO: 17

[0351] The 3' end g of SEQ ID NO: 16 and the 5' end C of SEQ ID NO: 17 are linked to spacer 18, respectively.

[0352] First universal primer

[0353] ACGCTCACGCTCGCTGCTAC (SEQ ID NO: 3)

[0354] Second universal primer

[0355] TCATCGCAGTGTCGCCGTGG (SEQ ID NO: 4)

[0356] Specific probe

[0357] FAM-cgccggagctgcgtga-MGB (SEQ ID NO: 18)

[0358] A partial sequence of the IS6110 gene of Mycobacterium tuberculosis (presequence 3 of the target molecule) is as follows: / / is the cleavage site.

[0359] Gactccagttcttggaaa ggatg gggtcatgt / / caggtggttcatcgaggaggtaccc gccggagctgcgtgagcgggcggtgc ggatg gtcgcagag / / atc (SEQ ID NO: 19, wherein positions 33 to 97 are the sequence of the target molecule 3, SEQ ID NO: 20)

[0360] The 3' end of the capture oligonucleotide has Spacer C3 to block elongation. Figure 7 It is explained that after specific restriction enzyme treatment, the present application can be used for detection of pathogenic microorganisms.

[0361] Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the true scope and spirit of the application being indicated by the following claims.

Claims

1. A capture oligonucleotide for nucleic acid amplification, characterized in that, The capture oligonucleotide comprises, in order from 5' end to 3' end: a first universal sequence, a folding sequence, a second universal sequence, and a binding capture sequence; wherein, (1) the folding sequence is at least partially identical to the 5' end sequence of the target molecule; (2) the binding capture sequence is complementary to the 3' end sequence of the target molecule; (3) the capture oligonucleotide further comprises a nucleic acid extension blocking modification at the 3' end of the binding capture sequence; and (4) the capture oligonucleotide further comprises a nucleic acid extension blocking modification between the folding sequence and the second universal sequence, the universal sequence is irrelevant to the sequence of the target molecule.

2. The capture oligonucleotide of claim 1, wherein, The capture oligonucleotide further comprises a nucleic acid analogue modification: (5) the 3' end of the binding capture sequence has a nucleic acid analogue modification; and / or, (6) the 3' end of the folding sequence has a nucleic acid analogue modification.

3. The capture oligonucleotide of claim 1, wherein, The nucleic acid extension blocking modification is selected from the group consisting of: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

4. The capture oligonucleotide of claim 2, wherein, The nucleic acid analogue modification is selected from the group consisting of: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methyl bridged RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuracil nucleoside, 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

5. A composition or kit for nucleic acid amplification, characterized in that, The composition or kit comprises the capture oligonucleotide of any one of claims 1-4.

6. The composition or kit of claim 5, wherein, The composition or kit further comprises a target molecule pre-sequence pretreatment reagent to obtain a target molecule with clear 3' end and 5' end sequences, the pretreatment reagent comprising a methylation-dependent restriction enzyme, a methylation-sensitive restriction enzyme, a nicking enzyme, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

7. The composition or kit of claim 5 or 6, wherein, The composition or kit further comprises a universal primer and / or a detection probe.

8. A method for nucleic acid amplification or detection for non-diagnostic purposes, characterized in that, The method comprises the step of binding a target molecule with a capture oligonucleotide, the capture oligonucleotide being as claimed in claim 1.

9. The nucleic acid amplification or detection method according to claim 8, wherein, The method comprises the steps of: (1) the capture oligonucleotide binds to a target molecule with a clear 3' end sequence through the binding capture sequence; (2) the target molecule is extended with the capture oligonucleotide as a template, adding a sequence complementary to the second universal sequence at the 3' end of the target molecule to obtain a target molecule linear extension product; (3) the second universal primer binds to the target molecule linear extension product and is extended with the target molecule linear extension product as a template and terminated at the 5' end of the target molecule to obtain a second universal primer linear extension product; (4) the second universal primer linear extension product binds to the folding sequence of the capture oligonucleotide and is extended, adding a complementary sequence of the first universal sequence at the 3' end to obtain a first universal primer linear extension product; (5) exponential amplification is performed based on the first universal primer and the second universal primer to obtain an amplification product containing the first universal primer sequence and the second universal primer complementary sequence at the 5' and 3' ends, respectively, and the target molecule sequence in the middle; The capture oligonucleotide comprises, from 5' to 3', a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence; wherein, (i) the folding sequence is at least partially identical to the 5' end sequence of the target molecule; (ii) the binding capture sequence is complementary to the 3' end sequence of the target molecule; (iii) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and (iv) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence; the 3' end of the folding sequence has a nucleic acid analogue modification; the universal sequence, the universal primer is irrelevant to the sequence of the target molecule.

10. The nucleic acid detection method according to claim 8, wherein, The method comprises the steps of: (1) the capture oligonucleotide binds to the specific target molecule through the binding capture sequence and the 3' end sequence; (2) the target molecule is extended with the capture oligonucleotide as a template, adding a sequence complementary to the second universal sequence at the 3' end of the target molecule to obtain a linear extension product of the target molecule; (3) the enzyme specifically recognizes the enzyme cleavage site in the target molecule linear extension product and the capture oligonucleotide binding dimer and cleaves to obtain a capture oligonucleotide cleavage product containing a free 3' end; the enzyme is an enzyme that recognizes the enzyme cleavage recognition marker; (4) the capture oligonucleotide cleavage product containing a free 3' end is extended with the target molecule linear extension product as a template, adding a sequence complementary to the target molecule at the 3' end of the capture oligonucleotide cleavage product containing a free 3' end and terminating at the 5' end of the target molecule to obtain a capture oligonucleotide extension product; (5) the capture oligonucleotide extension product binds to the folding sequence in the capture oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule to form a half hairpin structure product; (6) the half hairpin structure product is extended under the action of the polymerase to add nucleotides complementary to the first universal sequence at the 3' end to form a complete hairpin structure product; (7) using the complete hairpin structure product as a template, universal primers are used for amplification to obtain an amplification product containing the first universal primer sequence and the second universal primer complementary sequence at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle; The capture oligonucleotide comprises, from 5' to 3', a first universal sequence, a folding sequence, a second universal sequence and a binding capture sequence; wherein, (i) the folding sequence is at least partially identical to the 5' end sequence of the target molecule; (ii) the binding capture sequence is complementary to the 3' end sequence of the target molecule, (iii) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; (iv) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located between the folding sequence and the second universal sequence; the 3' end of the folding sequence has a nucleic acid analogue modification; and the universal sequence, the universal primer is irrelevant to the sequence of the target molecule. (v) the capture oligonucleotide further comprises an enzyme cleavage recognition marker selected from the group consisting of / idsP / , an RNA base modification, or a combination thereof, located at the 3' end of the second universal sequence or at the 5' end of the binding capture sequence, and an enzyme recognizing the enzyme cleavage recognition marker selected from the group consisting of 3' Tth endonuclease, thermostable stable RNase H, mismatch repair enzyme, or a combination thereof; the universal sequence, the universal primer is independent of the sequence of the target molecule.

Images