Use of a reagent for detecting FOXA2 in the manufacture of a kit for the diagnosis or differentiation assessment, prognosis assessment of head and neck squamous cell carcinoma

Abstract

The application discloses application of a reagent for detecting FOXA2 in preparation of a kit for diagnosis or differentiation degree evaluation, prognosis evaluation of head and neck squamous cell carcinoma. The reagent comprises a primer pair for amplifying FOXA2, wherein the primer pair comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 2. By using the kit, diagnosis, differentiation degree evaluation and prognosis evaluation of head and neck squamous cell carcinoma and oral squamous cell carcinoma can be effectively realized, and the kit has high accuracy and good repeatability.

Description

Technical Field

[0001] This invention relates to the field of head and neck squamous cell carcinoma technology, specifically to the application of reagents for detecting FOXA2 in the preparation of kits for the diagnosis, differentiation assessment, and prognostic evaluation of head and neck squamous cell carcinoma. Background Technology

[0002] Head and neck squamous cell carcinoma (HNSCC) is a malignant tumor originating from the mucosal epithelium of the oral cavity, nasopharynx, oropharynx, hypopharynx, and larynx. Statistics show that HNSCC is the sixth most common cancer worldwide, with 890,000 new cases and 450,000 deaths in 2018. Its incidence rate continues to rise, and it is projected that the number of patients will increase by 30% to 1.08 million by 2030. More than 90% of head and neck malignancies are oral squamous cell carcinoma (OSCC). Global cancer statistics show approximately 377,000 new cases of OSCC and 177,000 deaths annually, with a five-year survival rate of 50-60%. OSCC can cause disfigurement and impair physiological functions such as swallowing, speech, and tasting. The causes of OSCC are complex, including excessive smoking, alcohol abuse, betel nut chewing, and gene mutations. In the early stages of OSCC, the survival rate after completing treatment can exceed 90%, but almost half of patients are diagnosed with OSCC at a later stage. Therefore, identifying key biomarkers associated with the development of HNSCC or OSCC is of great significance for early diagnosis, prognosis prediction, and even future treatment. Summary of the Invention

[0003] This invention aims to at least partially address one of the technical problems in related technologies. Therefore, one object of this invention is to provide a biomarker highly associated with head and neck squamous cell carcinoma, and further to propose the application of reagents for detecting this biomarker in the preparation of kits for the diagnosis, differentiation assessment, and prognostic evaluation of head and neck squamous cell carcinoma.

[0004] Therefore, this invention conducted a series of explorations and studies, and the results showed that pioneer transcription factors are a class of cancer biomarkers worthy of attention. Specifically, research indicates that transcription factors are proteins that bind to DNA in a sequence-specific manner, controlling gene expression by regulating gene transcription. Transcription factors participate in the regulation of multiple pathways, including cell cycle, apoptosis, differentiation, cell homeostasis and stress, and inflammatory responses. Among them, pioneer transcription factors are a unique class of transcription factors; they possess the unique ability to initiate the opening of closed chromatin and are key regulators of the epigenome and cell fate, playing important regulatory roles in cell development, organogenesis, and disease occurrence. Disorders in their expression or structural abnormalities can lead to cancer progression. Forkhead box A2 (FOXA2) is an important member of the pioneer FOXA transcription factor family. Its gene aliases include HNF-3-beta, HNF3B, and TCF3B. Its gene ID in NCBI is 3170, its gene length is 4493 bp, and its chromosomal location is chr20:22580998-chr20:22585490. FOXA2 plays a role in regulating tumor development, organogenesis and differentiation, inflammation and immunity, and cellular energy metabolism, making it a cancer biomarker with significant prognostic potential. Currently, its role in many tumors remains unclear, and its mechanism of action in HNSCC is insufficiently explored, but it still holds great significance for further exploration and research.

[0005] Furthermore, the inventors of this invention designed a series of rigorous scientific experiments: First, they analyzed the expression levels of FOXA2 in the transcriptome data of HNSCC and normal tissues from the TCGA database. Simultaneously, they performed survival analysis on the FOXA2 expression levels of multiple HNSCC patients. The results showed that compared to normal tissues, FOXA2 expression was higher in HNSCC tumor tissues, and HNSCC patients with higher FOXA2 expression levels had lower survival rates. Next, the inventors conducted experiments on FOXA2 knockdown of HN6 cell migration and invasion, diagnostic verification in actual patients, and FOXA2 expression. All results corroborated each other, demonstrating that high FOXA2 expression promotes the proliferation, migration, and invasion of HNSCC, such as oral squamous cell carcinoma and oral adenosquamous carcinoma, while downregulation of its expression can inhibit the occurrence and development of cancer. In other words, FOXA2 plays an important regulatory role in the occurrence and development of HNSCC, such as oral squamous cell carcinoma and oral adenosquamous carcinoma, and can serve as an effective clinical diagnostic biomarker for HNSCC, especially oral squamous cell carcinoma and oral adenosquamous carcinoma. Therefore, the inventors believe that FOXA2, as a biomarker for HNSCC, and reagents for detecting FOXA2 can be effectively used to prepare diagnostic kits for head and neck squamous cell carcinoma and oral squamous cell carcinoma. Furthermore, the diagnostic kits for head and neck squamous cell carcinoma prepared using reagents for detecting FOXA2 exhibit high diagnostic accuracy and good reproducibility.

[0006] Therefore, in a first aspect, the present invention provides the application of a reagent for detecting FOXA2 in the preparation of a kit for the diagnosis, differentiation assessment, and prognostic evaluation of head and neck squamous cell carcinoma. The reagent for detecting FOXA2 enables the effective preparation of a kit for diagnosing head and neck squamous cell carcinoma, which exhibits high accuracy and reproducibility in the diagnosis, differentiation assessment, and prognostic evaluation of this carcinoma.

[0007] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. Kits for diagnosing oral squamous cell carcinoma and oral adenosquamous carcinoma can be efficiently prepared using reagents that detect FOXA2.

[0008] It should be noted that oral squamous cell carcinoma (OSCC) refers to a carcinoma with squamous differentiation that originates from the oral mucosal epithelium. The oral mucosa includes at least one of the buccal mucosa, gingival mucosa, retromolar triangle mucosa, tongue body (anterior 2 / 3 of the sulcus terminalis) mucosa, floor of mouth mucosa, hard palate mucosa, and labial mucosa.

[0009] In some embodiments, the reagent is one capable of detecting FOXA2 expression levels.

[0010] In some embodiments, the reagent comprises a primer pair for amplifying FOXA2. In some embodiments, the primer pair comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.

[0011] In some implementations, the reagent used to detect FOXA2 is the same reagent used to detect the expression level of FOXA2 in the sample.

[0012] In some implementations, the sample is at least one of cells, tissues, and body fluids.

[0013] In some implementations, the sample is at least one of oral mucosal tissue, blood, urine, and saliva.

[0014] In some implementations, for a kit for diagnosing head and neck squamous cell carcinoma, a subject is diagnosed with head and neck squamous cell carcinoma when the expression level of FOXA2 in the subject's sample is above a threshold.

[0015] In some implementations, the threshold is a cutoff value when the ROC curves constructed by comparing the OSCC patient group and the control group meet certain specificity and / or sensitivity, for example, the cutoff value when the sum of specificity and sensitivity is maximized.

[0016] In some implementations, the OSCC patient group and the control group are respectively the cancerous tissue and adjacent normal tissue of an OSCC patient. In other implementations, the OSCC patient group and the control group may also be respectively the cancerous tissue of an OSCC patient and the sample tissue of a normal person.

[0017] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene, such as β-Actin, GAPDH, or tubulin. In some implementations, the internal reference gene used to calculate the relative expression level is β-Actin.

[0018] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene calculated according to the formula 2-ΔΔCt, for example, the internal reference gene is β-Actin.

[0019] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to the internal reference gene β-Actin, calculated according to the formula 2-ΔΔCt. When the expression level of FOXA2 in the subject's sample is higher than the threshold, the subject is diagnosed with head and neck squamous cell carcinoma, and the threshold is 29.92.

[0020] In some implementations, the reagents for detecting FOXA2 include primer pairs for amplifying FOXA2. Specific primer pairs can be designed based on the aforementioned nucleotide sequence of FOXA2 using primer design software commonly used in the art, such as Prime 3.

[0021] In some implementations, the primer pairs for amplifying FOXA2 include:

[0022] The upstream primer with a nucleotide sequence of 5'-AGTTAAAGTATGCTGGGAGCG-3' (SEQ ID NO.1); and the downstream primer with a nucleotide sequence of 5'-TCATGTTGCTCACGGAGGAG-3' (SEQ ID NO.2).

[0023] In some implementations, the kit also includes RNA extraction reagents and reverse transcription reagents.

[0024] In some implementations, the RNA extraction reagent includes TRIzol total RNA extraction reagent.

[0025] In some implementations, the reverse transcription reagent includes reverse transcription polymerase, dNTPs, and RT primers.

[0026] In some implementations, the reverse transcription polymerase includes Evo M-MLV RTase.

[0027] In some implementations, the RT primers include at least one of random primers and oligo dT.

[0028] In some implementations, the reverse transcription reagent also includes an RNase inhibitor.

[0029] In some implementations, the reverse transcription reagent also includes a gDNA removal reagent.

[0030] In some implementations, the reverse transcription reagent also includes RNase-free water.

[0031] In some implementations, the kit also includes an internal reference primer pair.

[0032] In some implementations, the internal reference primer pair is a β-Actin primer pair.

[0033] In some implementations, the internal reference primer pair includes:

[0034] The upstream primer with the nucleotide sequence shown as 5'-AAACTGGAACGGTGAAGGTG-3' (SEQ ID NO.3); and

[0035] The downstream primer has a nucleotide sequence as shown in 5'-AGTGGGGTGGCTTTTAGGAT-3' (SEQ ID NO.4).

[0036] In a second aspect, the present invention provides a computer-readable storage medium storing computer-executable instructions for causing a computer to perform the following operations: Step 1: Obtaining information on the expression level of FOXA2 in a subject's sample; Step 2: Comparing the expression level with a threshold and indicating whether the subject has head and neck squamous cell carcinoma based on the comparison result. Using this computer-readable storage medium, the diagnostic accuracy for head and neck squamous cell carcinoma is high and the reproducibility is good.

[0037] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. This computer-readable storage medium enables effective diagnosis of oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0038] In some implementations, information on the expression level of FOXA2 in the subject's sample is obtained by detecting FOXA2 in the sample.

[0039] In some implementations, the sample is at least one of cells, tissues, and body fluids.

[0040] In some implementations, the sample is at least one of oral mucosal tissue, blood, urine, and saliva.

[0041] In some implementations, when the expression level of FOXA2 in a subject's sample is above a threshold, it indicates that the subject has head and neck squamous cell carcinoma.

[0042] In some implementations, the threshold is a cutoff value when the ROC curves constructed by comparing the OSCC patient group and the control group meet certain specificity and / or sensitivity, for example, the cutoff value when the sum of specificity and sensitivity is maximized.

[0043] In some implementations, the OSCC patient group and the control group are respectively the cancerous tissue and adjacent tissue of the OSCC patient, or respectively the cancerous tissue of the OSCC patient and the sample tissue of a normal person.

[0044] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene, such as β-Actin, GAPDH, or tubulin. In some implementations, the internal reference gene used to calculate the relative expression level is β-Actin.

[0045] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene calculated according to the formula 2-ΔΔCt, for example, the internal reference gene is β-Actin.

[0046] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to the internal reference gene β-Actin, calculated according to the formula 2-ΔΔCt. When the expression level of FOXA2 in the subject's sample is higher than a threshold, it indicates that the subject has head and neck squamous cell carcinoma, and the threshold is 29.92.

[0047] In some implementations, the reagents for detecting FOXA2 include primer pairs for amplifying FOXA2.

[0048] In some implementations, the primer pairs for amplifying FOXA2 include:

[0049] The upstream primer with the nucleotide sequence 5'-AGTTAAAGTATGCTGGGAGCG-3' (SEQ ID NO.1); and

[0050] The downstream primer has a nucleotide sequence as shown in 5'-TCATGTTGCTCACGGAGGAG-3' (SEQ ID NO.2).

[0051] In some implementations, the kit also includes RNA extraction reagents and reverse transcription reagents.

[0052] In some implementations, the RNA extraction reagent includes TRIzol total RNA extraction reagent.

[0053] In some implementations, the reverse transcription reagent includes reverse transcription polymerase, dNTPs, and RT primers.

[0054] In some implementations, the reverse transcription polymerase includes Evo M-MLV RTase.

[0055] In some implementations, the RT primers include at least one of random primers and oligo dT.

[0056] In some implementations, the reverse transcription reagent also includes an RNase inhibitor.

[0057] In some implementations, the reverse transcription reagent also includes a gDNA removal reagent.

[0058] In some implementations, the reverse transcription reagent also includes RNase-free water.

[0059] In some implementations, the kit also includes an internal reference primer pair.

[0060] In some implementations, the internal reference primer pair is a β-Actin primer pair.

[0061] In some implementations, the internal reference primer pair includes:

[0062] The upstream primer with the nucleotide sequence shown as 5'-AAACTGGAACGGTGAAGGTG-3' (SEQ ID NO.3); and

[0063] The downstream primer has a nucleotide sequence as shown in 5'-AGTGGGGTGGCTTTTAGGAT-3' (SEQ ID NO.4).

[0064] In a third aspect, the present invention provides an apparatus comprising a processor and a memory storing a computer program executable on the processor, the processor performing the following operations when running the computer program: Step 1: Obtaining information on the expression level of FOXA2 in a subject's sample; Step 2: Comparing the expression level with a threshold, and indicating whether the subject has head and neck squamous cell carcinoma based on the comparison result. Using this apparatus, the accuracy and reproducibility of diagnosis, differentiation assessment, and prognostic evaluation of head and neck squamous cell carcinoma are high.

[0065] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. This device can effectively diagnose both oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0066] In some implementations, information on the expression level of FOXA2 in the subject's sample is obtained by detecting FOXA2 in the sample.

[0067] In some implementations, the sample is at least one of cells, tissues, and body fluids.

[0068] In some implementations, the sample is at least one of oral mucosal tissue, blood, urine, and saliva.

[0069] In some implementations, when the expression level of FOXA2 in a subject's sample is above a threshold, it indicates that the subject has head and neck squamous cell carcinoma.

[0070] In some implementations, the threshold is a cutoff value when the ROC curves constructed by comparing the OSCC patient group and the control group meet certain specificity and / or sensitivity, for example, the cutoff value when the sum of specificity and sensitivity is maximized.

[0071] In some implementations, the OSCC patient group and the control group are respectively the cancerous tissue and adjacent tissue of the OSCC patient, or respectively the cancerous tissue of the OSCC patient and the sample tissue of a normal person.

[0072] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene, such as β-Actin, GAPDH, or tubulin. In some implementations, the internal reference gene used to calculate the relative expression level is β-Actin.

[0073] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene calculated according to the formula 2-ΔΔCt, for example, the internal reference gene is β-Actin.

[0074] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to the internal reference gene β-Actin, calculated according to the formula 2-ΔΔCt. When the expression level of FOXA2 in the subject's sample is higher than a threshold, it indicates that the subject has head and neck squamous cell carcinoma, and the threshold is 29.92.

[0075] In some embodiments, the reagent for detecting FOXA2 includes a primer pair for amplifying FOXA2. In some embodiments, the primer pair includes: an upstream primer with a nucleotide sequence such as 5'-AGTTAAAGTATGCTGGGAGCG-3' (SEQ ID NO.1); and a downstream primer with a nucleotide sequence such as 5'-TCATGTTGCTCACGGAGGAG-3' (SEQ ID NO.2).

[0076] In some implementations, the kit also includes RNA extraction reagents and reverse transcription reagents.

[0077] In some implementations, the RNA extraction reagent includes TRIzol total RNA extraction reagent.

[0078] In some implementations, the reverse transcription reagent includes reverse transcription polymerase, dNTPs, and RT primers.

[0079] In some implementations, the reverse transcription polymerase includes Evo M-MLV RTase.

[0080] In some implementations, the RT primers include at least one of random primers and oligo dT.

[0081] In some implementations, the reverse transcription reagent also includes an RNase inhibitor.

[0082] In some implementations, the reverse transcription reagent also includes a gDNA removal reagent.

[0083] In some implementations, the reverse transcription reagent also includes RNase-free water.

[0084] In some implementations, the kit also includes an internal reference primer pair.

[0085] In some embodiments, the internal reference primer pair is a β-Actin primer pair. In some embodiments, the internal reference primer pair includes: an upstream primer with a nucleotide sequence such as 5'-AAACTGGAACGGTGAAGGTG-3' (SEQ ID NO.3); and a downstream primer with a nucleotide sequence such as 5'-AGTGGGGTGGCTTTTAGGAT-3' (SEQ ID NO.4).

[0086] In a fourth aspect, the present invention provides a head and neck squamous cell carcinoma risk assessment system, comprising: an acquisition module for acquiring information on the expression level of FOXA2 in a subject's sample; and an assessment module for comparing the expression level with a threshold and indicating whether the subject has head and neck squamous cell carcinoma based on the comparison result. Using this system, the risk assessment of head and neck squamous cell carcinoma has high accuracy and good reproducibility.

[0087] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. This system provides high accuracy and reproducibility in assessing the risk of oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0088] In some implementations, a detection module is also included for detecting the expression level of FOXA2 based on the subject's sample.

[0089] It is understood that the acquisition module can obtain information on the expression level of FOXA2 in the subject's sample by directly or indirectly based on the FOXA2 detection results.

[0090] In some implementations, the sample is at least one of cells, tissues, and body fluids.

[0091] In some implementations, the sample is at least one of oral mucosal tissue, blood, urine, and saliva.

[0092] In some implementations, the detection module includes reagents for detecting FOXA2.

[0093] In some implementations, the reagents for detecting FOXA2 include primer pairs for amplifying FOXA2.

[0094] In some embodiments, the primer pair includes: an upstream primer with a nucleotide sequence such as 5'-AGTTAAAGTATGCTGGGAGCG-3' (SEQ ID NO.1); and a downstream primer with a nucleotide sequence such as 5'-TCATGTTGCTCACGGAGGAG-3' (SEQ ID NO.2).

[0095] In some implementations, the kit also includes RNA extraction reagents and reverse transcription reagents.

[0096] In some implementations, the RNA extraction reagent includes TRIzol total RNA extraction reagent.

[0097] In some implementations, the reverse transcription reagent includes reverse transcription polymerase, dNTPs, and RT primers.

[0098] In some implementations, the reverse transcription polymerase includes Evo M-MLV RTase.

[0099] In some implementations, the RT primers include at least one of random primers and oligo dT.

[0100] In some implementations, the reverse transcription reagent also includes an RNase inhibitor.

[0101] In some implementations, the reverse transcription reagent also includes a gDNA removal reagent.

[0102] In some implementations, the reverse transcription reagent also includes RNase-free water.

[0103] In some implementations, the kit also includes an internal reference primer pair.

[0104] In some implementations, the internal reference primer pair is a β-Actin primer pair.

[0105] In some embodiments, the internal reference primer pair includes: an upstream primer with a nucleotide sequence such as 5'-AAACTGGAACGGTGAAGGTG-3' (SEQ ID NO.3); and a downstream primer with a nucleotide sequence such as 5'-AGTGGGGTGGCTTTTAGGAT-3' (SEQ ID NO.4).

[0106] In some implementations, in the assessment module, when the expression level of FOXA2 in a subject's sample is higher than a threshold, it indicates that the subject has head and neck squamous cell carcinoma.

[0107] In some implementations, the threshold is a cutoff value when the ROC curves constructed by comparing the OSCC patient group and the control group meet certain specificity and / or sensitivity, for example, the cutoff value when the sum of specificity and sensitivity is maximized.

[0108] In some implementations, the OSCC patient group and the control group are respectively the cancerous tissue and adjacent tissue of the OSCC patient, or respectively the cancerous tissue of the OSCC patient and the sample tissue of a normal person.

[0109] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene, such as β-Actin, GAPDH, or tubulin. In some implementations, the internal reference gene used to calculate the relative expression level is β-Actin.

[0110] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene calculated according to the formula 2-ΔΔCt, for example, the internal reference gene is β-Actin.

[0111] In some implementations, the expression level of FOXA2 is the relative expression level of FOXA2 relative to the internal reference gene β-Actin, calculated according to the formula 2-ΔΔCt. When the expression level of FOXA2 in the subject's sample is higher than a threshold, it indicates that the subject has head and neck squamous cell carcinoma, and the threshold is 29.92.

[0112] In a fifth aspect, the present invention also provides the use of substances that specifically inhibit FOXA2 expression in the preparation of a1 to a2: a1. a drug for treating head and neck squamous cell carcinoma; a2. a drug for inhibiting the proliferation, migration, or invasion of head and neck squamous cell carcinoma cells.

[0113] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. Using the substance of the present invention that specifically inhibits FOXA2 expression, it is possible to effectively prepare drugs for treating head and neck squamous cell carcinoma, as well as drugs for inhibiting the proliferation, migration, or invasion of head and neck squamous cell carcinoma cells.

[0114] In some embodiments, the substance includes any one of the following: FOXA2 antisense oligonucleotide (ASO), small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), clustered regularly interspaced short palindromic repeats (CRSIPR) system, transcription activator-like effector nucleases (TALEN) system, and zinc finger nuclease (ZFN) system. The ASO may be, for example, GapmeR, and the CRSIPR system may be, for example, the CRISPR-Cas13 system.

[0115] In some embodiments, the substance comprises shRNA of FOXA2. In some embodiments, the nucleotide sequences of the topstrand and bottom strand of the shRNA are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively;

[0116] in:

[0117] GATCCGAACGGCATGAACACGTACATCTCGAGATGTACGTGTTCATGCCGTTC TTTTTTG(SEQ ID NO.7)(SEQ ID NO.7);

[0118] AATTCAAAAAAGAACGGCATGAACACGTACATCTCGAGATGTACGTGTTCATG CCGTTCG (SEQ ID NO. 8).

[0119] In some embodiments, the substance also includes a vector loaded with the aforementioned ASO, siRNA, shRNA, miRNA, CRSIPR system, TALEN system, or ZFN system.

[0120] In some implementations, the carrier is any one of an inorganic carrier, an organic carrier, or an inorganic-organic composite carrier.

[0121] In some implementations, the vector includes any one of plasmid, lentivirus, adenovirus, and adeno-associated virus.

[0122] In some implementations, oral squamous cell carcinoma cells are tongue squamous cell carcinoma cells.

[0123] In some embodiments, oral squamous cell carcinoma cells include at least one of HSC-3, HN6, and CAL-27.

[0124] Based on the above applications, embodiments of the present invention also relate to a drug combination comprising a substance that specifically inhibits FOXA2 expression. This drug combination can be used to effectively treat head and neck squamous cell carcinoma.

[0125] In some embodiments, the drug combination also includes at least one of the following: chemotherapeutic drugs for head and neck squamous cell carcinoma, photosensitizers, photothermal agents, and immunotherapeutic drugs. The chemotherapeutic drugs may be, for example, at least one of paclitaxel, camptothecin, 5-fluorouracil, cisplatin, doxorubicin, mitomycin, and epirubicin; the photosensitizers may be, for example, at least one of borodipyrrole, dihydroporphyrin, and Bengal red; the photothermal agents may be, for example, at least one of noble metal nanoparticles, organic polymers, carbon-based nanomaterials, magnetic nanomaterials, and semiconductor nanomaterials; and the immunotherapeutic drugs may be, for example, at least one of immune cell therapy drugs and immune checkpoint inhibitors. It is understood that the combination drugs and FOXA2 or substances that reduce FOXA2 expression may be used simultaneously or sequentially.

[0126] In some implementations, the drug combination also includes a targeted delivery system.

[0127] Embodiments of the present invention also relate to the use of substances that specifically inhibit FOXA2 expression in the treatment of head and neck squamous cell carcinoma or in inhibiting the proliferation, migration or invasion of head and neck squamous cell carcinoma cells.

[0128] Embodiments of the present invention also relate to a method for treating squamous cell carcinoma of the head and neck, comprising administering to a patient an effective dose of a substance that specifically inhibits FOXA2 expression.

[0129] Embodiments of the present invention also relate to methods for inhibiting the proliferation, migration, or invasion of head and neck squamous cell carcinoma cells, including mixing an effective dose of a substance that specifically inhibits FOXA2 expression with head and neck squamous cell carcinoma cells.

[0130] In a sixth aspect, the present invention also provides a kit for the diagnosis, differentiation assessment, and prognostic evaluation of head and neck squamous cell carcinoma, comprising a reagent for detecting FOXA2. Using this kit, the accuracy and reproducibility for the diagnosis, differentiation assessment, and prognostic evaluation of head and neck squamous cell carcinoma are high.

[0131] In some embodiments, the reagent is capable of detecting FOXA2 expression levels. In some embodiments, the reagent comprises a primer pair for amplifying FOXA2; said primer pair comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.

[0132] In some embodiments, the aforementioned head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. The drug combination or diagnostic and evaluation kit of the present invention can effectively achieve the diagnosis, differentiation assessment, prognostic evaluation, and even treatment of oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0133] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0134] Figure 1 The bioinformatics analysis results of TCGA-HNSCC patient tissues and healthy tissues in the examples are shown. Figure 1 A represents the expression level analysis results of FOXA2 in HNSCC patients and normal tissues. The Mann-Whitney test was used for statistical significance analysis, and *P<0.05; Figure 1 B represents the survival analysis of HNSCC patients. The statistical significance analysis was performed using the Log-rank test, with P < 0.001 and HR = 1.789.

[0135] Figure 2 The results of FOXA2 expression level detection in clinical OSCC tissues in this example are shown. Figure 2 A represents the expression level analysis results of FOXA2 in OSCC patients and healthy tissues. The statistical significance analysis was performed using the Wilcoxon test, *P<0.05; Figure 2 B is the ROC curve.

[0136] Figure 3 The results of FOXA2 expression detection in the HNSCC cell line in the examples are shown. Multiple t-tests were used for significance analysis, with *Padj<0.05 and **Padj<0.01.

[0137] Figure 4The knockdown efficiency detection results of FOXA2 in the examples are shown. The independent samples t-test was used for significance analysis, and **P<0.01.

[0138] Figure 5 The scratch assay results of the HN6 cell line with FOXA2 knockdown in the examples are shown. Significance analysis was performed using an independent samples t-test; ***P < 0.05, scale bar = 50 μm.

[0139] Figure 6 The migration and invasion results of the HN6 cell line with FOXA2 knockdown in the examples are shown. Significance analysis was performed using independent samples t-tests, with ***P < 0.001 and scale bar = 250 μm.

[0140] Figure 7 The results of Western blotting analysis of EMT-related protein expression levels in shNC and shFOXA2 cells are shown in the examples. Detailed Implementation

[0141] The following will clearly and completely describe the concept and technical effects of this application in conjunction with embodiments, so as to fully understand the purpose, features and effects of this application. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are all within the scope of protection of this application.

[0142] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.

[0143] Example 1: FOXA2 is highly expressed in HNSCC patient tissues and HNSCC cell lines.

[0144] The inventors downloaded transcriptome data from 523 HNSCC tissues and 44 normal tissues from The Cancer Genome Atlas (TCGA) and used Graphpad Prism to analyze the expression level of FOXA2. At the same time, they performed survival analysis on the FOXA2 expression levels of the 523 patients.

[0145] Based on the World Health Organization's diagnostic criteria for OSCC, and with the approval of the Ethics Committee of Peking University Shenzhen Hospital, and after obtaining informed consent from the patients or their families, cancerous and adjacent normal mucosal tissues were collected from 28 patients treated in the Department of Oral and Maxillofacial Surgery at Peking University Shenzhen Hospital. The patient selection criteria were: ① all patients were diagnosed based on histopathological results; ② all patients had complete postoperative follow-up data; ③ all patients underwent thorough primary tumor debridement surgery and selective neck lymph node dissection; ④ all patients had not received preoperative radiotherapy or chemotherapy, and had no history of rheumatoid arthritis, cardiovascular disease, diabetes, hyperthyroidism, or other systemic diseases or tumors. Patient pathology information is shown in Table 1.

[0146] After tissue homogenization, total RNA was extracted from patient tissues using TRIzol reagent. cDNA was obtained using reverse transcription reagent (Evo M-MLVRT Mix Kit with gDNAClean for qPCR, Cat.#AG11728). Finally, qRT-PCR reagent (SYBR Green Premix Pro Taq HS qPCR Kit II, Cat.#AG11702) and a Lightcycler 480 II real-time quantitative PCR instrument were used to detect the internal reference gene (β-Actin) and the cycling threshold (Ct) of FOXA2 in patient tissues. The relative expression levels of FOXA2 in each cancerous tissue and adjacent normal tissue were calculated using the 2-ΔΔCt formula. Primer sequences are shown in Table 2.

[0147] Similarly, TRIzol, along with the reagents and instruments described above, were used to detect the expression levels of FOXA2 in the normal human oral cell line HOK, the oral adenosquamous cell line CAL27, and the OSCC cell lines HSC3 and HN6. The qRT-PCR primer sequences are shown in Table 2.

[0148] Table 1. Clinical information of patients

[0149]

[0150] Table 2 qRT-PCR primer sequences

[0151]

[0152]

result

[0153] Analysis of TCGA data revealed that FOXA2 expression was significantly higher in HNSCC tumor tissue compared to normal tissue. Figure 1 A), among which, HNSCC patients with higher FOXA2 expression levels (262 cases) had lower survival rates. Figure 1 B).

[0154] In clinical tissue samples, compared with adjacent normal tissue, the expression level of FOXA2 in OSCC tissue was significantly increased ( Figure 2 A), the area under the ROC curve is 0.6171 ( Figure 2 B), HR=1.789, indicating that FOXA2 has certain diagnostic significance for OSCC. Consistently, FOXA2 is highly expressed in HNSCC cell lines (B). Figure 3 ).

[0155] Example 2: Knockdown of FOXA2 inhibits the migration and invasion of HN6 cells.

[0156] HN6 cells were infected with a lentivirus carrying a short hairpin RNA (shRNA) vector to construct a control cell line (shNC) and a stable cell line with knocked-down FOXA2 (shFOXA2). The knockdown efficiency of FOXA2 was detected by qRT-PCR using primers listed in Table 2 of Example 1. The interference vector was a lentiviral vector purchased from Hanheng Biotechnology (Shanghai) Co., Ltd., and the shRNA sequence is shown in Table 3 below.

[0157] Table 3. shRNA sequences of lentiviral vectors

[0158]

[0159] shNC and shFOXA2 cells were cultured in DMEM medium (Thermo Fisher Scientific) in 6-well plates (purchased from Corning). When the cell coverage reached 100%, uniformly wide scratches were made by perpendicularly scraping the bottom of the wells with a pipette tip. After 24 hours of culture, cell migration at the scratches was observed and photographed under a microscope. The scratch area was calculated using ImageJ, and the cell migration rate (%) was calculated as (initial scratch area - scratch area at time t) / initial scratch area × 100%. Statistical graphs were generated using Graphpad Prism software, and statistical analysis was performed.

[0160] shNC and shFOXA2 cells were seeded in serum-free DMEM in Transwell chambers (Corning, 8.0 μm pore size polycarbonate membrane). DMEM containing 10% serum was added below the chamber. After culturing for 24 h in an incubator (37°C, 5% CO2), the cells were washed 2-3 times with PBS, fixed with 10% paraformaldehyde, stained with 1% crystal violet solution, and finally rinsed off the dye, wiping away any residual dye inside the chamber with cotton swabs. Cells were photographed under a microscope (Leica, Germany), and the number of migrating cells was calculated using ImageJ software. Statistical graphs were plotted using Graphpad Prism software, and statistical analysis was performed.

[0161] Basement membrane matrix (purchased from Corning, 356234) was added to the bottom of the Transwell chamber. After drying the matrix gel, shNC and shFOXA2 cells suspended in serum-free DMEM were seeded, and DMEM containing 10% serum was added to the bottom of the chamber. After culturing in an incubator (37℃, 5% CO2) for 48 h, the cells were washed 2-3 times with PBS and fixed with 10% paraformaldehyde. They were then stained with 1% crystal violet solution, and finally the stain was rinsed off and residual stain in the chamber was wiped away with a cotton swab. Microscopic images were taken, and the number of migrating cells was calculated using ImageJ software. Statistical graphs were plotted using Graphpad Prism software, and statistical analysis was performed.

[0162]

result

[0163] like Figure 4 The expression level of FOXA2 was significantly reduced in the stable cell lines. In the scratch assay (… Figure 5 ) and Transwell experiment ( Figure 6 In the invasive assay, compared with the control group, knockdown of FOXA2 inhibited the migration ability of HN6 cells; in the invasion assay ( Figure 6 Compared with the control group, knockdown of FOXA2 inhibited the invasive ability of HN6 cells.

[0164] Example 3: Silent Suppression of EMT by FOXA2

[0165] Use a cell scraper to collect cultured shNC and shFOXA2 cells, transfer them to centrifuge tubes, centrifuge (1000 rpm, 3 min), discard the supernatant, add RIPA lysis buffer (Millipore) and protease inhibitor (Beyotime), incubate on ice for 30 min, then centrifuge (12000 rpm, 15 min); aspirate the supernatant total protein solution and transfer it to a new centrifuge tube, add SDS-PAGE protein loading buffer (Biosharp), and incubate at 100°C for 5 min to complete the protein sample preparation.

[0166] Protein samples were added to a precast protein gel (ACE) and electrophoresed using a Biorad apparatus at 180V. Electrophoresis was then performed using a 0.2μm PVDF membrane (Millipore), ACE electrophoresis buffer, and a Biorad apparatus at 400mA for 50min. The PVDF membrane was blocked with 5% skim milk powder (Sangon)-TBST solution and incubated with primary antibody overnight at 4°C. After washing away the primary antibody with TBST, the membrane was incubated with secondary antibody at room temperature for 1-2 hours. After washing away the secondary antibody with TBST (Solarbio), the PVDF membrane was developed and photographed using ECL chemiluminescent substrate (Biosharp) and an Amersham ImageQuant 800 developer (GE, USA).

[0167] Antibodies used: internal control GAPDH (Bioss, bs-10900R), FOXA2 (Proteintech, 22474-1-AP), MMP3 (Cell Signaling Technology, 14351), Slug (Proteintech, 12129-1-AP), Snail (Proteintech, 61367), Smad4 (Proteintech, 10231-1-AP), Smad2 / 3 (Cell Signaling Technology, 8685), and phosphorylated Smad2 / 3 (Cell Signaling Technology, 8828).

[0168]

result

[0169] Western blotting was used to detect the expression levels of proteins related to epithelial-mesenchymal transition (EMT). The results showed that, compared with the control group, the expression levels of MMP3, Slug, Snail, Smad4, Smad2 / 3, and phosphorylated Smad2 / 3 were decreased in FOXA2-silenced HN6 cells. This indicates that FOXA2 silencing inhibits the EMT process in HN6 cells, thereby suppressing the progression of OSCC. Specifically, MMP3 is matrix metalloproteinase 3; Slug is Snail Family Transcriptional Repressor 2; Snail is Snail Family Transcriptional Repressor 1; Smad is Mothers Against Decapentaplegic Homolog; P-Smad2 / 3 is phosphorylated Smad; and GAPDH is Glyceraldehyde-3-Phosphate Dehydrogenase.

[0170] The results above indicate that FOXA2 expression is tissue-specific, with significant upregulation in tumor tissues and OSCC cells of OSCC patients. Furthermore, FOXA2 regulates the proliferation, migration, and invasion of OSCC cells. Therefore, FOXA2 plays a crucial regulatory role in the development and progression of OSCC and HNSCC, and holds promise as an effective clinical diagnostic biomarker and targeted therapeutic agent for both conditions.

[0171] Example 4 Diagnostic Experiment

[0172] Following the methods and selection criteria in Example 1, several OSCC patients and healthy individuals were enrolled. Cancerous tissue samples from the patients and oral mucosal tissue samples from the healthy individuals were collected, and the relative expression levels of FOXA2 were detected. The results showed that the relative expression level in the patient group was significantly higher than that in the control group, with a statistically significant difference (p<0.05); the ROC curve showed an AUC value greater than 0.7. These results further demonstrate the diagnostic ability of FOXA2 for OSCC.

[0173] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature. In the description of this invention, "a plurality of" means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0174] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0175] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. The application of a substance that specifically inhibits FOXA2 expression in the preparation of a drug for treating oral squamous cell carcinoma, characterized in that, The substance is shRNA of FOXA2, and the nucleotide sequences of the top strand and bottom strand of the shRNA are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

Images