A nucleic acid composition, kit and detection method for detecting EZH2 gene mutations

Abstract

The present invention belongs to the field of biotechnology and relates to a nucleic acid composition, a kit and a detection method for detecting EZH2 gene mutations. The nucleic acid composition includes a forward primer, a reverse primer, a probe and a blocking primer. Among them, the binding position of the probe to the EZH2 gene covers the target mutation site of the EZH2 gene, and the 5'-end of the blocking primer has an overlapping part with the 3'-end of the forward primer. The nucleic acid composition of the present invention is used for detecting hot mutations of the EZH2 gene, including the detection of 7 mutation sites: Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V. It can genotype the mutation sites, and only 2 tubes of reactions are required to accurately analyze the mutation information of each site, and the sensitivity can reach 0.5%. It can meet the detection requirements of some more complex clinical samples.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically, to a nucleic acid composition, a kit, and a detection method for detecting EZH2 gene mutations. Background Art

[0002] Follicular Lymphoma (FL) is an indolent subtype of NHL, accounting for approximately 35% of all B-cell lymphomas. Some gene mutations in B cells can alter the gene expression profile and promote tumor transformation, including mutations in the Polycomb repressive complex 2 (PRC2) gene.

[0003] EZH2 and its highly related homologous gene EZH1 are considered epigenetic silencing factors. As core components of PRC2, they play a key role in cell growth and differentiation. Somatic mutations in EZH2 can cause epigenetic and transcriptional modifications and have currently become one of the popular targets for drug development. Multiple drugs have entered the clinical stage, such as the CPI-0209 drug and the CPI-1205 drug of Constellation Pharmaceuticals.

[0004] The most common mutation in FL is the amino acid mutation Y646 of the EZH2 gene, followed by mutations of amino acids A682 and A692. Among them, the incidence of A682 and A692 mutations in FL is as high as 25%. By molecular biology methods, such as quantitative PCR (qPCR), detecting EZH2 gene mutations can screen for beneficiary populations of EZH2 inhibitors such as tazemetostat and improve the clinical value of the drug.

[0005] Methods for detecting EZH2 gene mutations include the Sanger method and the qPCR method. Although the Sanger method has a lower cost, it has problems such as a long process and low detection sensitivity and cannot meet the requirements of companion diagnostics for EZH2 inhibitors. The qPCR method for detecting EZH2 includes the commercially available Roche cabas EZH2 Mutation Test. This method can detect the requirements of Y646, A682, and A692 amino acid mutations and can be used for the companion diagnosis of FL. However, there are still some problems. Among them, the most important one is that it is impossible to type the mutation sites, that is, it is impossible to confirm the specific mutation type.

[0006] Some related technologies are also disclosed in the prior art. For example, the methods and compositions for detecting mutations in the human EZH2 gene disclosed in CN105593378A, and a PCR method for amplifying and detecting low-content gene mutations and its application disclosed in CN109136345A. The probes disclosed therein also cannot accurately type the mutation sites. Summary of the Invention

[0007] The present invention provides a nucleic acid composition, a kit and a detection method for detecting EZH2 gene mutations. By optimizing the design of the probe position, sequence, and the position and sequence of the blocking primer, it can not only accurately genotype the mutation site, but also has excellent detection sensitivity.

[0008] The present invention adopts the following technical solutions:

[0009] In the first aspect of the present invention, there is provided a nucleic acid composition for detecting EZH2 gene mutations, comprising a forward primer, a reverse primer, a probe and a blocking primer. Among them, the binding position of the probe to the EZH2 gene covers the target mutation site of the EZH2 gene, and the 5' end of the blocking primer has an overlapping part with the 3' end of the forward primer.

[0010] In the art, the probe position is usually designed in the middle of the amplified sequence, that is, far from the binding positions of the forward primer and the reverse primer, and does not cover the mutation site. Just like the probe in the prior patent disclosure technology mentioned in the background art, because the fluorescent reporter group of the probe can only emit a detectable fluorescent signal after being cleaved by DNA polymerase (usually thermostable Taq DNA polymerase). To ensure that the probe can be effectively cleaved, it should be located inside the amplified fragment so that the polymerase can encounter and cleave the probe during the extension process. Therefore, it is generally considered that if the probe is too close to the 5' end or 3' end of the amplified product, it may affect its cleavage efficiency. Especially when approaching the positions of the forward and reverse primers, the probe may be affected by incompletely annealed primers or other secondary structures, thereby reducing the possibility of the probe being cleaved. Furthermore, it affects the generation of fluorescent signals.

[0011] In the above solution of the present invention, first, by changing the probe position and designing the probe at the position covering the target mutation site of the EZH2 gene, specific mutated bases can be detected, so that the mutation site can be accurately genotyped.

[0012] On this basis, further design the 5' end of the blocking primer to have an overlapping part with the 3' end of the forward primer. In this way, in cooperation with the probe position, higher sensitivity can be achieved.

[0013] Preferably, the target mutation site is selected from any one mutation site or a combination of at least two mutation sites among Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V. Among them, the probe sequence corresponding to Y646N is shown in SEQ ID NO: 1; the probe sequence corresponding to Y646F is shown in SEQ ID NO: 2; the probe sequence corresponding to Y646C is shown in SEQ ID NO: 3; the probe sequence corresponding to Y646S is shown in SEQ ID NO: 4; the probe sequence corresponding to Y646H is shown in SEQ ID NO: 5; the probe sequence corresponding to A682G is shown in SEQ ID NO: 6; the probe sequence corresponding to A692V is shown in SEQ ID NO: 7.

[0014] Preferably, the Tm value of the probe corresponding to each mutation site is 3°C to 5°C higher than the Tm values of the forward primer and the reverse primer corresponding to this mutation site. For example, the Tm value of the probe corresponding to the mutation site Y646N is 3°C to 5°C higher than the Tm values of the forward primer and the reverse primer corresponding to Y646N.

[0015] Preferably, the Tm value of each blocking primer is 5°C to 10°C higher than the Tm value of the corresponding forward primer. For example, the Tm value of the blocking primer corresponding to Y646N is 5°C to 10°C higher than the Tm value of the forward primer corresponding to Y646N.

[0016] Preferably, the blocking primers corresponding to Y646N, Y646F, Y646C, Y646S, and Y646H are shown in SEQ ID NO: 8.

[0017] Preferably, the blocking primer corresponding to A682G is shown in SEQ ID NO: 9.

[0018] Preferably, the blocking primer corresponding to A692V is shown in SEQ ID NO: 10.

[0019] Preferably, the 5' end of the blocking primer overlaps with the 3' end of the forward primer by 4 to 12 bases.

[0020] Preferably, the forward primers corresponding to Y646N, Y646F, Y646C, Y646S, and Y646H are shown in SEQ ID NO: 11, and the reverse primers are shown in SEQ ID NO: 12.

[0021] Preferably, the forward primer corresponding to A682G is shown in SEQ ID NO: 13, and the reverse primer is shown in SEQ ID NO: 14.

[0022] Preferably, the forward primer corresponding to A692V is as shown in SEQ ID NO:15, and the reverse primer is as shown in SEQ ID NO:16.

[0023] In the above preferred embodiment, for the detection of 7 hotspot mutation sites of the EZH2 gene, including Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V, by analyzing the probe sequence, the sequence of the blocking primer, and the relationship of the Tm value between the probe and other primers, it is ensured that the detection of 3 mutation sites can be achieved in one tube and the detection of 4 sites can be achieved in another tube, that is, the detection of 7 sites can be achieved in two tubes without mutual interference and with good specificity. In contrast, the commercially available Roche cabas EZH2 Mutation Test in the prior art requires three tubes to complete. On this basis, the sequences of the forward and reverse primers are further optimized to achieve a sensitivity of 0.5%, while the Roche cabas EZH2 Mutation Test can only reach 5%.

[0024] In the second aspect of the present invention, a kit for detecting EZH2 gene mutations is provided, which contains the above nucleic acid composition.

[0025] Preferably, the kit includes reagent A and / or reagent B. Reagent A includes forward primers, reverse primers, probes, and blocking primers for simultaneously detecting the target mutation sites Y646N, Y646F, and A682G; reagent B includes forward primers, reverse primers, probes, and blocking primers for simultaneously detecting the target mutation sites Y646C, Y646S, Y646H, and A692V.

[0026] Preferably, in reagent A of the kit, the probe corresponding to Y646N is as shown in SEQ ID NO:1, the probe corresponding to Y646F is as shown in SEQ ID NO:2, and the probe corresponding to A682G is as shown in SEQ ID NO:6; the blocking primers corresponding to Y646N and Y646F are as shown in SEQ ID NO:8; the blocking primer corresponding to A682G is as shown in SEQ ID NO:9; the forward primers corresponding to Y646N and Y646F are as shown in SEQ ID NO:11, and the reverse primers are as shown in SEQ ID NO:12; the forward primer corresponding to A682G is as shown in SEQ ID NO:13, and the reverse primer is as shown in SEQ ID NO:14.

[0027] Preferably, in Reagent B of the kit, the probe corresponding to Y646C is as shown in SEQ ID NO:3, the probe corresponding to Y646S is as shown in SEQ ID NO:4, the probe corresponding to Y646H is as shown in SEQ ID NO:5, and the probe corresponding to A692V is as shown in SEQ ID NO:7; the blocking primers corresponding to Y646C, Y646S, and Y646H are as shown in SEQ ID NO:8; the blocking primer corresponding to A692V is as shown in SEQ ID NO:10; the forward primers corresponding to Y646C, Y646S, and Y646H are as shown in SEQ ID NO:11, and the reverse primers are as shown in SEQ ID NO:12; the forward primer corresponding to A692V is as shown in SEQ ID NO:15, and the reverse primer is as shown in SEQ ID NO:16.

[0028] In the third aspect of the present invention, a method for detecting EZH2 gene mutations is provided, using the above-mentioned kit.

[0029] By implementing the above technical solutions, compared with the prior art, the present invention has the following advantages:

[0030] 1. The present invention can genotype mutation sites and accurately determine mutant bases.

[0031] 2. The primers and probes of the present invention can achieve multiplex fluorescence reaction in one tube and have excellent sensitivity.

[0032] 3. The present invention is used to detect 7 mutation sites of EZH2 gene hot-spot mutations, including Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V. Only 2 tubes of reaction are required to accurately analyze the mutation information of each site, and the sensitivity can reach 0.5%. It can meet the detection needs of some more complex clinical samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is a schematic diagram for detecting the EZH2 gene mutation site by the nucleic acid composition of the present invention.

[0034] Figure 2 It is the PCR amplification curve of 1% standard product in the reaction system of Tube 1 in the examples of the present invention.

[0035] Figure 3 It is the PCR amplification curve of 1% standard product in the reaction system of Tube 2 in the examples of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0036] To more clearly illustrate the technical content of the present invention, specific embodiments are described in detail herein. Obviously, the listed embodiments are only the preferred implementation schemes of the technical solution, and other technical solutions that can be obviously obtained by those skilled in the art based on the disclosed technical content still fall within the protection scope of the present invention.

[0037] Those skilled in the art should understand that unless otherwise specified, the primers or probes used in the following examples are all synthesized by biotechnology companies according to conventional nucleotide synthesis techniques, and the reagents for the PCR reaction system can be purchased from reagent companies.

[0038] Example 1

[0039] This example provides a kit for detecting EZH2 gene mutations to detect 7 mutation sites of Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V of the EZH2 gene. The components of the kit include: mixed enzyme solution (DNA polymerase, buffer, magnesium chloride, dNTPs), primer-probe mixture in tube 1, primer-probe mixture in tube 2, negative control, positive control, and water.

[0040] The forward and reverse primers, probes, and blocking primers involved in the kit of this example are shown in Table 1 below and are synthesized by a biological company.

[0041] Table 1 Forward and reverse primers, probes, and blocking primers used in this example

[0042] Primer Name Primer Sequence (5' to 3') 5' Modification 3' Modification Sequence ID Forward Primer at Site 646 646-F CTGAATACAGGTTATCAGTGCC / / SEQ ID NO:11 Reverse Primer at Site 646 646-R CAGGCTGGGGGATTTTTATCA / / SEQ ID NO:12 Y646N Probe 646N-p CCTCTCCACAGTTTTCTGAGATG 5' 6-FAM 3' BHQ1 SEQ ID NO:1 Y646F Probe 646F-p CCTCTCCACAGAATTCTGAGATG 5' VIC 3' BHQ1 SEQ ID NO:2 Y646H Probe 646H-p CCTCTCCACAGTGTTCTGAGA 5' CY5 3' BHQ2 SEQ ID NO:5 Y646S Probe 646S-p CCTCTCCACAGGATTCTGAGATG 5' VIC 3' BHQ1 SEQ ID NO:4 Y646C Probe 646C-p CCTCTCCACAGCATTCTGAGATG 5' 6-FAM 3' BHQ1 SEQ ID NO:3 Blocking Primer at Site 646 646-blokcer GTGCCTTACCTCTCCACAGTATTCTGAGAAATTA / / SEQ ID NO:8 Forward Primer at Site 682 682-F TTTGCAAAACGAATTTTGTTACC / / SEQ ID NO:13 Reverse Primer at Site 682 682-R ATTATTCACTGGGCTGTGCTT / / SEQ ID NO:14 A682G Probe 682-p TGCGGGTTCCATCCACCA 5' CY5 3' BHQ2 SEQ ID NO:6 Blocking Primer at Site 682 682-blocker ACCCTTGCGGGTTGCATCCACCAATTTT / / SEQ ID NO:9 Forward Primer at Site 692 692-F GCAACCCGCAAGGGTAAC / / SEQ ID NO:15 Reverse Primer at Site 692 692-R GGACTGAAAAGGGAGTTCCAA / / SEQ ID NO:16 A692V Probe 692-p ATTCGTTTTGTAAATCATTCGGT 5' ROX 3' MGB SEQ ID NO:7 Blocking Primer at Site 692 692-blocker GGTAACAAAATTCGTTTTGCAAATCATTCGCCCTT / / SEQ ID NO:10 Reference Forward Primer EZH2C-F TTGAACCTCCTGAGAATGTGG / / SEQ ID NO:18 Reference Probe EZH2C-p TGGAGTGGTGCTGAAGCCT 5' TAMRA 3' BHQ2 SEQ ID NO:17 Reference Reverse Primer EZH2C-R GTAAGTGCCAATGAGGACTCT / / SEQ ID NO:19

[0043] The composition in tube 1 is as follows:

[0044] 2×Goldstar SNP Mastermix 10 μL, upstream primer (646-F) (10 μM) 0.4 μL, downstream primer (646-R) (10 μM) 0.4 μL, probe (646N-p) (10 μM) 0.16 μL, probe (646F-p) (10 μM) 0.16 μL, blocking primer (646-blocker) (100 μM) 0.4 μL, upstream primer (682) (10 μM) 0.4 μL, downstream primer (682) (10 μM) 0.4 μL, probe (682-p) (10 μM) 0.16 μL, blocking primer (682-blocker) (100 μM) 0.4 μL, upstream primer (EZH2C-F) (10 μM) 0.2 μL, downstream primer (EZH2C-R) (10 μM) 0.2 μL, probe (EZH2C-p) (10 μM) 0.08 μL, and add water to a total volume of 16 μL.

[0045] The composition in tube 2 is as follows:

[0046] 2×Goldstar SNP Mastermix 10 μL, upstream primer (646-F) (10 μM) 0.4 μL, downstream primer (646-R) (10 μM) 0.4 μL, probe (646H-p) (10 μM) 0.16 μL, probe (646S-p) (10 μM) 0.16 μL, probe (646C-p) (10 μM) 0.16 μL, blocking primer (646-blocker) (100 μM) 0.4 μL, upstream primer (692-F) (10 μM) 0.4 μL, downstream primer (692-R) (10 μM) 0.4 μL, probe (692) (10 μM) 0.16 μL, blocking primer (692-blocker) (100 μM) 0.4 μL, upstream primer (EZH2C-F) (10 μM) 0.2 μL, downstream primer (EZH2C-R) (10 μM) 0.2 μL, probe (EZH2C-p) (10 μM) 0.08 μL, add water to a total volume of 16 μL.

[0047] Example 2

[0048] This example provides a method for detecting EZH2 gene mutations in clinical samples. Using the kit in Example 1, the detection method specifically includes:

[0049] (1) Take 3 - 5 lymphoma paraffin sections (FFPE), and extract DNA using the Qiagen Tissue FFPE DNA Kit (product number: 56404).

[0050] (2) Use a Thermo NanoDrop instrument to measure the DNA purity, and the A260 / A280 should be in the range of 1.7 - 2.2. Use a Thermo Qubit instrument to measure the DNA concentration, and dilute the sample to 12.5 ng / μL according to the measured concentration.

[0051] (3) According to the number of samples, prepare the reaction solution. Prepare 2 wells (tube 1 and tube 2) for each sample, and at the same time, prepare the reaction systems for tube 1 and tube 2 for both the negative control and the positive control;

[0052] (4) Add 4 μL of the extracted sample DNA to each reaction system and mix well; (5) Turn on the Thermo Quantstudio 5 fluorescence PCR instrument and start PCR according to the following reaction program: 95°C for 5 min, 45 cycles (95°C for 10 sec, 60°C for 30 sec read).

[0053] (5)Result analysis

[0054] a) Open the data analysis software and set Baseline and Threshold to Auto; (2) Determine whether the 2 - well internal reference of the sample satisfies Ct ≤ 28. If the internal reference gene meets the standard, the quality control is normal; otherwise, the experiment fails and qPCR needs to be carried out again. If the internal reference quality control fails in the second qPCR, the sample needs to be re - sampled and analyzed.

[0055] b) Determine whether the △Ct of each target (site) meets the Cut - off value standard, and determine the EZH2 gene mutation status according to the rules shown in Table 2 below:

[0056] Table 2 Rules for determining the EZH2 gene mutation status

[0057]

[0058] Among them, △Ct = Ct target - Ct internal reference. For example, for Y646N, first calculate the difference △Ct between the Ct value of the Y646N site and the Ct value of the internal reference. If △Ct ≤ 10, the Y646N site is positive and the Y646N mutation occurs; if △Ct > 10, the Y646N site is negative and the Y646N mutation does not occur.

[0059] Example 3

[0060] Example of sensitivity verification of the detection method in Example 2

[0061] Purchase cell lines containing Y646N, Y646F, Y646H, Y646S, Y646C, A682G, and A692V mutations, extract DNA and dilute it to the same concentration, then mix them in equal proportions, and incorporate them into healthy human genomic DNA (HGD) at ratios of 0.5%, 1%, 2%, and 5% to prepare a series of sensitivity gradient standards.

[0062] According to the operation steps of Example 2, detect the sensitivity samples and negative samples (Table 3 below, set the gradient according to the performance of each tube).

[0063] Table 3 Sensitivity detection samples and negative samples

[0064]

[0065] The off-machine data was analyzed by software. The Ct values of each sample's EZH2 target (locus) corresponding to Tube 1, the Ct value of the internal reference, and △Ct are shown in Table 4 below. Combining with the Cut-off values (Y646N △Ct ≤ 10, Y646F △Ct ≤ 9, A682G △Ct ≤ 7) for positive and negative determination, it can be known that the lowest detection limit of the FAM target (Y646N locus) in Tube 1 is 0.5%, the lowest detection limit of the VIC target (Y646F locus) is 0.5%, and the lowest detection limit of the CY5 target (A682G locus) is also 0.5%. That is, the detection limit of Tube 1 is all 0.5%.

[0066] Table 4 Ct values of each sample's EZH2 target (locus) corresponding to Tube 1, Ct value of the internal reference, and △Ct

[0067]

[0068] Note 1: The Ct value of the internal reference is 26.33.

[0069] Note 2: The meaning of Undetermined is no amplification curve.

[0070] The Ct values of each sample's EZH2 target (locus) corresponding to Tube 2, the Ct value of the internal reference, and △Ct are shown in Table 5 below. Combining with the Cut-off values (FAM-Y646C △Ct ≤ 15, CY5-Y646H △Ct ≤ 9, VIC-Y646S △Ct ≤ 8, ROX-A692V △Ct ≤ 11) for positive and negative determination, it can be known that the lowest detection limit of the FAM target (Y646C locus) in Tube 2 is 2%, the lowest detection limit of the VIC target (Y646S locus) is 1%, the lowest detection limit of the CY5 target (Y646H locus) is 2%, and the lowest detection limit of the ROX target (A692V locus) is also 2%. That is, the detection limit of Tube 2 is 1% - 2%.

[0071] Table 5 Ct values of each sample's EZH2 target (locus) corresponding to Tube 2, Ct value of the internal reference, and △Ct

[0072]

[0073] Note: The Ct value of the internal reference is 25.53.

[0074] Example 4

[0075] In this example, taking the detection of the A682 locus as an example, experiments with different blocking primers were carried out.

[0076] The primer, probe, and blocking primer sequences used to detect the A682 locus in this example are shown in Table 6 below.

[0077] Table 6 Primer, probe, and blocking primer sequences for detecting the A682 locus

[0078] Primer Name Primer Sequence (5' to 3') 5' Modification 3' Modification 682-F TTTGCAAAACGAATTTTGTTACC / / 682-R ATTATTCACTGGGCTGTGCTT / / 682-p TGCGGGTTCCATCCACCA 5' CY5 3' BHQ2 682-blocker-1 ACCCTTGCGGGTTGCATCCACATTTT / / 682-blocker ACCCTTGCGGGTTGCATCCACCAATTTT / /

[0079] Prepare 2 tubes of qPCR reaction system according to the following recipe.

[0080] Tube 1 - Reaction System 1

[0081] 2×Goldstar SNP Mastermix 10 μL, forward primer (646-F) (10 μM) 0.4 μL, reverse primer (646-R) (10 μM) 0.4 μL, probe (646N-p) (10 μM) 0.16 μL, probe (646F-p) (10 μM) 0.16 μL, blocking primer (646-blocker) (100 μM) 0.4 μL, forward primer (682-F) (10 μM) 0.4 μL, reverse primer (682-R) (10 μM) 0.4 μL, probe (682-p) (10 μM) 0.16 μL, blocking primer (682-blocker-1) (100 μM) 0.4 μL, add water to a total volume of 16 μL.

[0082] Tube 1 - Reaction System 2

[0083] In Reaction System 2, replace blocker (682-blocker-1) (100 μM) in Reaction System 1 with blocker (682-blocker) (100 μM), and the rest remains unchanged.

[0084] Add 4 μL of 1% standard product extraction to the reaction system. The standard product contains 1% A682G mutation.

[0085] Run on the machine according to the reaction program in the steps of Example 2.

[0086] The data after running on the machine shows that after replacing the blocking primer (Reaction System 2), the amplification Ct value at the A682 site (CY5 channel) remains basically unchanged, but the amplification noise in the FAM channel decreases. See Table 7. This optimization will significantly improve the detection sensitivity of the FAM channel (Y646) in Tube 1, indicating that optimizing the primer, probe, and blocking primer sequences is beneficial to improving the specificity of the reaction system, reducing background noise, and indirectly improving the reaction sensitivity.

[0087] Table 7 Results of detecting the A682 site using different blocking primers

[0088]

Claims

1. A kit for detecting EZH2 gene mutation, characterized in that: The kit includes reagent A and reagent B, wherein reagent A includes forward primers, reverse primers, probes and blocking primers for simultaneously detecting target mutation sites Y646N, Y646F and A682G; and reagent B includes forward primers, reverse primers, probes and blocking primers for simultaneously detecting target mutation sites Y646C, Y646S, Y646H and A692V; In reagent A, the probe corresponding to Y646N is shown in SEQ ID NO: 1, the probe corresponding to Y646F is shown in SEQ ID NO: 2, and the probe corresponding to A682G is shown in SEQ ID NO: 6; the blocking primers corresponding to Y646N and Y646F are shown in SEQ ID NO: 8; the blocking primer corresponding to A682G is shown in SEQ ID NO: 9; the forward primers corresponding to Y646N and Y646F are shown in SEQ ID NO: 11, and the reverse primer is shown in SEQ ID NO: 12; the forward primer corresponding to A682G is shown in SEQ ID NO: 13, and the reverse primer is shown in SEQ ID NO: 14; In reagent B, the probe corresponding to Y646C is shown in SEQ ID NO:3, the probe corresponding to Y646S is shown in SEQ ID NO:4, the probe corresponding to Y646H is shown in SEQ ID NO:5, and the probe corresponding to A692V is shown in SEQ ID NO:7; the blocking primers corresponding to Y646C, Y646S, and Y646H are shown in SEQ ID NO:8; the blocking primer corresponding to A692V is shown in SEQ ID NO:10; the forward primers corresponding to Y646C, Y646S, and Y646H are shown in SEQ ID NO:11, and the reverse primer is shown in SEQ ID NO:12; the forward primer corresponding to A692V is shown in SEQ ID NO:15, and the reverse primer is shown in SEQ ID NO:16.

Images