MiRNA marker related to ovarian granular cell proliferation of small tailed han sheep as well as detection primer and application of miRNA marker

Abstract

The invention discloses a miRNA (micro Ribonucleic Acid) marker related to ovarian granular cell proliferation of small tailed han sheep as well as a detection primer and application of the miRNA marker. The marker is novel-m0298-5p, and the sequence of the novel-m0298-5p is as shown in SEQ ID NO. 1. According to the invention, a novel-m0298-5p targeted WNT5A gene is predicted through bioinformatics, and then technologies such as a dual luciferase report system, an overexpression and knock-down test, RT-qPCR, Western blot, CCK-8, EdU and the like are utilized to further verify that the miRNA marker can inhibit the proliferation of ovarian granular cells of small tailed han sheep, so that the miRNA marker can inhibit the proliferation of ovarian granular cells of small tailed han sheep. The provided novel-m0298-5p can be used as a biomarker to be applied to identification of proliferation of ovarian granular cells of the small tailed han sheep.

Description

Technical Field

[0001] The invention relates to a miRNA marker related to the proliferation of ovarian granulosa cells of small-tail Han sheep and a detection primer and application thereof, in particular to the application of novel-m0298-5p in the proliferation process of ovarian granulosa cells of small-tail Han sheep, and belongs to the technical field of animal husbandry and veterinary medicine. Background Art

[0002] Fertility is one of the key factors restricting the development of the mutton sheep industry. Analyzing the regulatory mechanism of ewes' reproductive traits is an important means to increase the number of lambs, improve the production efficiency of mutton sheep, and improve the economic benefits of breeding. As a local sheep breed in my country, the Small-Tailed Han sheep is known for "year-round estrus, multiple births, and suitable for confinement feeding". It has been widely introduced to various parts of the country for the cultivation of high-fertility maternal breeds. Therefore, fully exploring the molecular biological mechanism of the high fertility of the Small-Tailed Han sheep is of great reference significance for improving the fertility of other sheep breeds.

[0003] The multi-birth trait of livestock is closely related to follicular development, and the essence of follicular development is the proliferation and differentiation of granulosa cells. Specifically, granulosa cells can not only promote the activation of primordial follicles, regulate the development of growing follicles, respond to ovulation signals, regulate the production of estrogen, but also induce follicular atresia. In short, the normal function of granulosa cells is closely related to the quality of oocytes and follicular development, and is a prerequisite for female animals to complete conception and production.

[0004] MiRNAs exist in many animals and are a type of non-coding small RNA with a length of about 20-25bp, which is highly conserved in the process of biological evolution. The 2nd to 8th bases of miRNAs are called "seed" sequences, which can bind to the 3'UTR region of the target gene, causing mRNA degradation or transcription inhibition, thereby affecting gene expression. In addition, more and more studies have shown that the complementary binding site of miRNA can be located in the entire transcription region of the target gene, rather than being limited to the 3'UTR region. miRNAs can participate in multiple processes such as growth and development, cell differentiation, and disease occurrence, especially in regulating the development and atresia of follicles, steroidogenesis, proliferation and apoptosis of cumulus cells and granulosa cells.

[0005] The differential expression of novel-m0298-5p was screened out by whole transcriptome sequencing data in the early stage. Therefore, the present invention uses novel-m0298-5p as a research clue, predicts and screens the target gene WNT5A through online bioinformatics software, and uses RT-qPCR, dual luciferase reporter system, overexpression and knockdown experiments and other technologies for in-depth verification, revealing the molecular regulatory mechanism of novel-m0298-5p in the proliferation of ovarian granulosa cells. Summary of the invention

[0006] The first object of the present invention is to provide a miRNA marker associated with the proliferation of ovarian granulosa cells of small-tailed Han sheep in order to solve the above problems.

[0007] The second object of the present invention is to provide the application of miRNA, and the application of the above miRNA in identifying the proliferation process of granulosa cells.

[0008] In order to achieve the above purpose, the present invention adopts the following technical solutions:

[0009] The invention provides a miRNA marker related to the proliferation of ovarian granulosa cells of small-tail Han sheep. The miRNA marker is novel-m0298-5p, and its nucleotide sequence is shown in SEQ ID NO.1.

[0010] SEQ ID NO.1:ACAGGGCTTCCCTGGTGGCTCGGA

[0011] The present invention also provides a primer for detecting the above miRNA marker, wherein the detection primer is selected from the primer for specific amplification of novel-m0298-5p, and the sequence thereof is shown in SEQ ID NO.2-3.

[0012] The upstream primer AATTAACAGGGCTTCCCTGGTGG (SEQ ID NO. 2) and the downstream primer TCGCTCCACCAACTAAGAA (SEQ ID NO. 3) were used as a primer pair to amplify the novel-m0298-5p sequence.

[0013] The present invention further provides an application of a reagent for detecting novel-m0298-5p expression in accurately grasping the proliferation law of ovarian granulosa cells of small-tail Han sheep.

[0014] Furthermore, the reagent is selected from: primers for specific amplification of novel-m0298-5p.

[0015] The novel-m0298-5p sequence is shown in SEQ ID NO. 1, and the upstream and downstream primer sequences of the target gene WNT5A are shown in SEQ ID NO. 8 and 9. The upstream primer sequence of the target gene WNT5A is AGGGCAATGTCTTCCAAGTTCTTC (SEQ ID NO. 8), and the downstream primer sequence is GTTATTCATACCTAGCGACCACCAAG (SEQ ID NO. 9).

[0016] The present invention provides a product for identifying the proliferation law of ovarian granulosa cells of small-tailed Han sheep, wherein the product comprises detecting the expression level of novel-m0298-5p by nucleic acid amplification technology, wherein the product includes but is not limited to a chip, a preparation or a kit.

[0017] Furthermore, the nucleic acid amplification technique is selected from polymerase chain reaction, reverse transcription polymerase chain reaction, transcription-mediated amplification or nucleic acid sequence-based amplification.

[0018] The present invention provides application of the miRNA marker novel-m0298-5p in identifying the proliferation law of ovarian granulosa cells of small-tail Han sheep.

[0019] Furthermore, the pharmaceutical composition includes an up-regulator and a down-regulator of novel-m0298-5p, and both the up-regulator and the down-regulator are miRNA.

[0020] The up-regulator is selected from: a novel-m0298-5p double-stranded molecule, i.e., a novel-m0298-5p mimetic, constructed by chemical synthesis, which further enhances the function of novel-m0298-5p;

[0021] The down-regulator is selected from: novel-m0298-5p inhibitors which are also chemically synthesized, but are composed of single-stranded molecules, and their function is to specifically recognize and inhibit the miRNA molecules complementary thereto (e.g. novel-m0298-5p inhibitors will specifically recognize and inhibit novel-m0298-5p), thereby increasing the expression of the novel-m0298-5p target gene.

[0022] Preferably, the novel-m0298-5p mimetic sequence is a double-stranded molecular sequence consisting of a mature sequence and its complementary sequence, as shown in SEQ ID NO.4; the sequence of the novel-m0298-5p mimetic is as follows:

[0023] ACAGGGCUUCCCUGGUGGCUCGGAUCCGAGCCACCAGGGAAGCCCUGU (SEQ ID NO.4)

[0024] The novel-m0298-5p inhibitor sequence is a single-stranded molecular sequence composed of the complementary sequence of the mature body, as shown in SEQ ID NO. 6. The sequence of the novel-m0298-5p inhibitor is as follows:

[0025] UCCGAGCCACCAGGGAAGCCCUGU (SEQ ID NO.6)

[0026] The pharmaceutical composition also includes other drugs compatible with the down-regulator and pharmaceutically acceptable excipients, such as a dual-luciferase vector and the like.

[0027] The present invention also provides any one of the following applications:

[0028] 1) Application of reagents for detecting novel-m0298-5p expression in accurately understanding the proliferation rules of ovarian granulosa cells in small-tailed Han sheep;

[0029] 2) Application of novel-m0298-5p gene in identifying the proliferation pattern of ovarian granulosa cells in small-tail Han sheep;

[0030] 3) Application of miRNA marker (novel-m0298-5p) in identifying the proliferation process of ovarian granulosa cells in Small Tail Han sheep.

[0031] 4) The above-mentioned product for identifying the proliferation pattern of ovarian granulosa cells of Small Tail Han sheep is used in the process of identifying the proliferation of ovarian granulosa cells of Small Tail Han sheep, so as to be used for identifying follicular atresia in the future.

[0032] In one embodiment of the present invention, the target gene of the miRNA marker novel-m0298-5p is WNT5A.

[0033] The sequence of the WNT5A gene is shown in SEQ ID NO.10.

[0034] Preferably, the effect is exerted by inhibiting the expression of the miRNA marker novel-m0298-5p;

[0035] Preferably, the product is a medicine or a feed additive.

[0036] The present invention also provides a method for identifying the proliferation efficiency of ovarian granulosa cells of small-tailed Han sheep, the method comprising:

[0037] Treating a system expressing or containing the novel-m0298-5p gene with a candidate substance, wherein the system is selected from a cell system:

[0038] The expression of novel-m0298-5p gene in the system is detected; if the expression or activity of novel-m0298-5p gene is the lowest, it indicates that the proliferation efficiency of ovarian granulosa cells of small-tail Han sheep is the highest. In addition, if the candidate substance can reduce the expression or activity of novel-m0298-5p gene, it indicates that the candidate substance is a potential substance for identifying the proliferation efficiency of ovarian granulosa cells of small-tail Han sheep; preferably, the candidate substance reduces the expression or activity of novel-m0298-5p gene by more than 20%, preferably by more than 50%, and more preferably by more than 80%.

[0039] The candidate substances mentioned above include, but are not limited to: nucleic acid inhibitors, small molecule compounds, etc. designed for novel-m0298-5p gene or its upstream or downstream genes.

[0040] The present invention provides a method for studying the function of genes related to the proliferation of ovarian granulosa cells of small-tail Han sheep and / or identifying the proliferation process of ovarian granulosa cells of small-tail Han sheep and / or screening a drug for promoting the proliferation of ovarian granulosa cells of small-tail Han sheep and / or inhibiting the apoptosis of ovarian granulosa cells of small-tail Han sheep. The method comprises knocking out a miRNA marker novel-m0298-5p gene or reducing the expression of the miRNA marker novel-m0298-5p gene; the nucleotide sequence of the miRNA marker novel-m0298-5p gene is shown in SEQ ID NO.1;

[0041] In one embodiment of the present invention, the method of reducing the expression of the miRNA marker novel-m0298-5p gene includes using a miRNA marker novel-m0298-5p inhibitor; the nucleotide sequence of the miRNA marker novel-m0298-5p inhibitor is shown in SEQ ID NO.6.

[0042] The present invention provides the use of a miRNA marker novel-m0298-5p inhibitor in the preparation of a drug for promoting proliferation of small-tail Han sheep ovarian granulosa cells and / or inhibiting apoptosis of small-tail Han sheep ovarian granulosa cells. The nucleotide sequence of the miRNA marker novel-m0298-5p inhibitor is shown in SEQ ID NO.6.

[0043] In one embodiment of the present invention, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pills or solutions.

[0044] In one embodiment of the present invention, the drug further contains pharmaceutically acceptable excipients; the pharmaceutical excipients refer to conventional drug carriers in the pharmaceutical field.

[0045] In one embodiment of the present invention, the auxiliary materials include one or more of the following: adhesives such as cellulose derivatives, alginate, gelatin and polyvinyl pyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol; fillers such as starch, sucrose; wetting agents such as glycerol; disintegrants such as sodium carboxymethyl starch, cross-linked polyvinyl pyrrolidone and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbate, sorbitan fatty acid and glycerol fatty acid esters; colorants such as titanium dioxide, sunset yellow, methylene blue, medicinal iron oxide red; lubricants such as hydrogenated vegetable oil, talc and polyethylene glycol; coating materials such as acrylic resin, hydroxypropyl methylcellulose, povidone, cellulose acetate; in addition, other auxiliary materials such as flavoring agents and sweeteners can be added to the composition.

[0046] The present invention also provides a drug for promoting proliferation of ovarian granulosa cells of small-tail Han sheep and / or inhibiting apoptosis of ovarian granulosa cells of small-tail Han sheep. The drug can inhibit the expression of the miRNA marker novel-m0298-5p gene, and the nucleotide sequence of the miRNA marker novel-m0298-5p is shown in SEQ ID NO.1.

[0047] The present invention also provides a drug for promoting proliferation of ovarian granulosa cells of small-tail Han sheep and / or inhibiting apoptosis of ovarian granulosa cells of small-tail Han sheep. The drug is a miRNA marker novel-m0298-5p inhibitor, and the nucleotide sequence of the miRNA marker novel-m0298-5p inhibitor is shown in SEQ ID NO.6.

[0048] In one embodiment of the present invention, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pills or solutions.

[0049] In one embodiment of the present invention, the drug further contains pharmaceutically acceptable excipients; the pharmaceutical excipients refer to conventional drug carriers in the pharmaceutical field.

[0050] In one embodiment of the present invention, the auxiliary materials include one or more of the following: adhesives such as cellulose derivatives, alginate, gelatin and polyvinyl pyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol; fillers such as starch, sucrose; wetting agents such as glycerol; disintegrants such as sodium carboxymethyl starch, cross-linked polyvinyl pyrrolidone and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbate, sorbitan fatty acid and glycerol fatty acid esters; colorants such as titanium dioxide, sunset yellow, methylene blue, medicinal iron oxide red; lubricants such as hydrogenated vegetable oil, talc and polyethylene glycol; coating materials such as acrylic resin, hydroxypropyl methylcellulose, povidone, cellulose acetate; in addition, other auxiliary materials such as flavoring agents and sweeteners can be added to the composition. Beneficial Effects

[0051] (1) The present invention predicts the target gene WNT5A of novel-m0298-5p by bioinformatics, and further verifies the targeting relationship between novel-m0298-5p and WNT5A gene by using dual luciferase reporter system, RT-qPCR and Western blot technology. CCK-8 and EdU tests confirm that novel-m0298-5p significantly downregulates the expression of small-tail Han sheep ovarian granulosa cells during proliferation. Therefore, novel-m0298-5p proposed in the present invention can be used as a biomarker to identify the proliferation of small-tail Han sheep ovarian granulosa cells.

[0052] (2) The analysis of market implementation feasibility and economic benefit forecast found that fertility is an extremely important trait for the development of the sheep industry. The present invention provides a product for identifying the proliferation of ovarian granulosa cells in Small Tail Han sheep, which can be used to identify the development of ovarian follicles in Small Tail Han sheep and has good economic benefits.

[0053] (3) The Small-Tailed Han sheep is known for its high fertility and is considered an ideal sheep breed for studying the molecular mechanism of reproduction. The biomarkers provided by the present invention have guiding significance for improving the reproductive performance of other sheep breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 This is the identification of ovarian granulosa cells of Small Tail Han sheep (400×).

[0055] Figure 2 The effects of novel-m0298-5p overexpression and knockdown on granulosa cell proliferation and viability; Figure 2 A is the relative expression level of novel-m0298-5p in cells detected by RT-qPCR; Figure 2 B is the statistical results of cell viability detected by CCK-8; Figure 2C is the result of EdU detection of cell proliferation, EdU (red) fluorescence marks cell proliferation, and DAPI (blue) fluorescence marks cell nuclei; Figure 2 D is the statistical result of EdU stained cells.

[0056] Figure 3 This is a fluorescence activity diagram using the dual luciferase reporter system to detect novel-m0298-5p under overexpression and inhibition conditions.

[0057] Figure 4 The expression level of the target gene WNT5A was detected by RT-qPCR and Western blot; 4A was the relative expression of WNT5A gene mRNA detected by RT-qPCR; Figure 4 B is a Western blot image of the protein encoded by the WNT5A gene; Figure 4 C is the gray value analysis result of Western blot image. DETAILED DESCRIPTION

[0058] The technical solution of the present invention is further described in detail below in conjunction with the embodiments: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection right of the present invention is not limited to the following embodiments (except for special circumstances in the present invention, the "%" mentioned represents the mass volume percentage).

[0059] Through extensive and in-depth research in the early stage of the present invention, it has been found that novel-m0298-5p and WNT5A genes are both present in the ovarian granulosa cells of small-tailed Han sheep. Using a variety of bioinformatics prediction software analysis, it was found that novel-m0298-5p may have a site that binds to the WNT5A gene, in order to clarify the biological function of novel-m0298-5p in ovarian granulosa cells and reveal its specific regulatory mechanism to find better ways and methods. Experimental verification shows that novel-m0298-5p can target the WNT5A gene and effectively inhibit the proliferation of ovarian granulosa cells of small-tailed Han sheep, providing a new molecular marker for mastering the proliferation law of ovarian granulosa cells of small-tailed Han sheep.

[0060] The utility of the present invention is not limited to quantifying the gene expression of any specific variant of the marker gene of the present invention. As a non-limiting example, the marker gene may have a nucleotide sequence specified by SEQ ID NO.1. The present invention may utilize any method known in the art to measure gene expression. It should be understood that the means for measuring gene expression is not an important aspect of the present invention. The expression level of the biomarker can be detected at the transcriptional level.

[0061] The sources of the materials involved in the present invention are as follows:

[0062] The accession number of the WNT5A gene sequence: XM_004018630.5. The pmirGLO-WNT5A reporter gene vector sequences in the present invention include the wild type (SEQ ID NO. 10) and the mutant type (SEQ ID NO. 11).

[0063] SEQ ID NO.10

[0064] GCTAGCtaggagctcctcttggaaaacagctcgctacttagggattttattccccctaccacttttatttcgaggaacagcagttttctatgtgttcctgacatcacttggcgaatggacgtcacggaggcgtggccgcatttctcccttctgctcctgtgttcagactccactggcgcttcccgctcctctgcaggt gtcccga gaactgctcccagtggacttgaacacttggttcagtggtacctgatagctcagtctcttgtacataacatatatatatatatatacatatataaatatacatatagttatatcggcgcagccagtgatctgggttccagtttactcgggttatttcttcggcctagagccttgtggtcctccactgcaattcaagtgggattttccccgCTCGAG

[0065] SEQ ID NO.11

[0066] GCTAGCtaggagctcctcttggaaaacagctcgctacttagggattttattccccctaccacttttatttcgaggaacagcagttttctatgtgttcctgacatcacttggcgaatggacgtcacggaggcgtggccgcatttctcccttctgctcctgtgttcagactccactggcgcttcccgctcctctgcaggt cagggctgaactgctcccagtggacttgaacacttggttcagtggtacctgatagctcagtctcttgtacataacatatatatatatatacatatataaatatacatatagt tatatcggcgcagccagtgatctgggttccagtttactcgggttatttcttcggcctagagccttgtggtcctccactgcaattcaagtgggattttccccgCTCGAG

[0067] The nucleotide sequence of novel-m0298-5p sequence is shown in SEQ ID NO.1.

[0068] The utility of the present invention is not limited to quantifying the gene expression of any particular variant of the target gene of the present invention. Two sequences are "substantially homologous" (or substantially similar) if, when a nucleic acid or fragment thereof is optimally aligned with another nucleic acid (or its complementary strand) (with appropriate nucleotide insertions or deletions), there is nucleotide sequence identity in at least about 60% of the nucleotide bases, usually at least about 70%, more usually at least about 80%, preferably at least about 90%, and more preferably at least about 95-98% of the nucleotide bases.

[0069] The present invention can use any method known in the art to measure gene expression. It should be understood that the means of measuring gene expression is not an important aspect of the present invention. The expression level of biomarkers can be detected at the transcriptional level.

[0070] Detection Technology

[0071] The miRNA of the present invention is detected using a variety of nucleic acid technologies known to those of ordinary skill in the art, including but not limited to nucleic acid sequencing and nucleic acid amplification technologies.

[0072] Illustrative non-limiting examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. Because RNA is less stable in cells and more susceptible to nuclease attack in experiments, RNA is usually reverse transcribed into DNA before sequencing.

[0073] The present invention can amplify nucleic acid (eg, ncRNA) before or simultaneously with detection. Illustrative non-limiting examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR).

[0074] The polymerase chain reaction, commonly referred to as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase the number of copies of a target nucleic acid sequence; a transcription-based amplification method, as well as self-sustaining sequence amplification.

[0075] The non-amplified or amplified nucleic acid of the present invention can be detected by any conventional means.

[0076] Kits and upper and lower regulators

[0077] The present invention provides products for detecting novel-m0298-5p gene expression levels, all of which are purchased from Wuhan Saiweier Biotechnology Co., Ltd. As used in the present invention, the novel-m0298-5p up- and down-regulators, i.e., mimics and inhibitors, are all produced by Wuhan Saiweier Biotechnology Co., Ltd.

[0078] The novel-m0298-5p down-regulator refers to any substance that can down-regulate novel-m0298-5p expression; the novel-m0298-5p up-regulator refers to any substance that can up-regulate novel-m0298-5p expression. These substances are useful for inhibiting or overexpressing novel-m0298-5p and can be used to explore the proliferation law of ovarian granulosa cells in small-tailed Han sheep.

[0079] Example 1: Ovarian granulosa cell culture, passage and identification

[0080] 1. Sample collection

[0081] The ovaries of 100 normally growing and developing 2-3 year old Small Tail Han sheep ewes were collected from the slaughterhouse, and the surrounding excess tissues were removed. After being sterilized with 75% alcohol, the ovaries were placed in 37°C preheated physiological saline containing double antibodies (100 IU / mL penicillin and 100 μg / mL streptomycin) and transported back to the cell culture room within 2 hours.

[0082] 2. Culture, passage and identification of ovarian granulosa cells

[0083] The ovarian surface was cleaned with 75% alcohol, rinsed three times with sterile 0.9% NaCl solution, and placed in physiological saline containing 1% double antibody and brought into a sterile laboratory. Follicular fluid from healthy, non-collapsed follicles with a diameter of more than 4 mm was extracted with a 1 mL disposable sterile syringe, filtered through a 400-mesh cell filter, centrifuged at 1000 rpm at room temperature for 5 min, and resuspended and centrifuged in DMEM / F12 medium (Gibco, USA). This step was repeated twice; then the cells were cultured with DMEM / F12 complete medium (including: DMEM / F12 basal medium, 10% fetal bovine serum (Fetal Bovine Serum) (Gibco, USA) and 1% triple antibody (penicillin-streptomycin-amphotericin B) at 37°C and 5% CO2. The medium was changed every 48 h.

[0084] 3. Passaging of ovarian granulosa cells

[0085] When the cells are 80%-90% confluent, they can be passaged. Wash the cells twice with PBS and digest them with 0.25% trypsin (37°C, 3-5 min) (Gibco, USA). When most of the cells fall off the bottom of the bottle, add an equal volume of DMEM / F12 complete medium to terminate the digestion and centrifuge at 1000 rpm for 5 minutes at room temperature. Finally, resuspend them with DMEM / F12 complete medium, inoculate them in cell culture bottles, and culture them in a cell culture incubator.

[0086] 4. Identification of ovarian granulosa cells

[0087] Granulosa cells were identified by immunofluorescence analysis of FSHR, a granulosa cell marker protein. 4 Cells were subcultured and inoculated in 24-well culture plates at a density of 100 cells / well. After the cells were 80%-90% confluent, they were washed twice with PBS. They were treated with 4% paraformaldehyde for 30 minutes and washed three times with PBS. They were treated with 0.2% Triton X-100 for 5 minutes and washed three times with PBS. They were blocked with 1% BSA (Solarbio) for 30 minutes. They were incubated with FSHR primary antibody (22665-1-AP, Proteintech, 1:200) overnight (PBS incubation was negative control) and washed three times with PBS. Fluorescently labeled anti-mouse secondary antibody (abs20004, Absin, 1:100) was incubated in a wet box at room temperature in the dark for 1 hour and washed three times with PBS. DAPI was incubated in a wet box at room temperature in the dark for 5 minutes, washed twice with PBS, and washed twice with sterile water. Finally, microscopic examination and photography were performed.

[0088] 5. Results

[0089] The results show that: Figure 1As shown in the figure, cells were mostly spindle-shaped or polygonal under a fluorescence microscope. The nuclei stained with DAPI were blue and oval. Compared with the cells in the control group, the experimental group with FSHR antibody had obvious green fluorescence, and the positive expression rate was over 95%.

[0090] Example 2: Screening of target genes that can bind to novel-m0298-5p and functional identification of novel-m0298-5p mimics and inhibitors

[0091] 1. Screening of target genes that can bind to novel-m0298-5p

[0092] (1) Bioinformatics prediction

[0093] Based on the previous whole transcriptome sequencing data, novel-m0298-5p (SEQ ID NO. 1) and WNT5A (GenBank accession number: XM_004018630.5) were screened for differential expression, and WNT5A was predicted to be a target gene of novel-m0298-5p through the interaction network.

[0094] 2. Preparation of RNA Samples

[0095] (1) Cell transfection

[0096] The miRNA mimics (mimic, sequence: ACAGGGCUUCCCUGGUGGCUCGGAUCCGAGCCACCAGGGAAGCCCUGU), miRNA mimic negative control (mimic NC, sequence: UCACAACCUCCUAGAAAGAGUAGAUCUACUCUUUCUAGGAGGUUGUGA), miRNA inhibitor (inhibitor, sequence: UCCGAGCCACCAGGGAAGCCCUGU), and miRNA inhibitor negative control (inhibitor NC, sequence: UCUACUCUUUCUAGGAGGUUGUGA) were sent to a gene company for chemical synthesis. Referring to the instructions for use of miRNA products of Wuhan Saiweier Biotechnology Co., Ltd., miRNA mimics and inhibitors were prepared into storage solutions with a concentration of 20 μM, respectively, for transfection experiments.

[0097] When the small-tail Han sheep ovarian granulosa cells prepared in Example 1 grew to the logarithmic phase, the cells were digested with 0.25% trypsin and counted. 5Each well was evenly transferred to a 24-well culture plate, and transfection was performed when the cell confluence reached 60%-80%. Cell transfection was performed according to the instructions of Invigentech INVI DNA RNA from Invigentech, USA. The miRNA mimics, inhibitors and controls were transfected into the ovarian granulosa cells of small-tailed Han sheep respectively.

[0098] Transfection test groups: miRNA mimic group (mimic), miRNA mimic negative control group (mimic NC), miRNA inhibitor group (inhibitor), miRNA inhibitor negative control group (inhibitor NC). Each sample group has 4 parallel test groups (NC represents the negative control group of the corresponding preparation). The transfection concentrations of miRNA mimic, miRNA mimic-NC, miRNAinhibitor, and miRNA inhibitor-NC are all 20μM / L.

[0099] (2) Cell RNA extraction

[0100] After 48 h of transfection, RNA was extracted from each group of cells. Specifically, the culture medium was aspirated and the cells were washed once with 1× PBS; the PBS washing solution was aspirated and then 1×10 6 - 2×10 7 Add 1 ml of RNAex to the cultured cells, gently shake the culture plate to ensure that the RNAex solution is evenly distributed on the cell surface; use a gun to blow and hit the cells to fully lyse them; use a pipette to repeatedly blow and hit the cells to make them fall off, then transfer the lysate containing the cells to a centrifuge tube, and then use a pipette to blow and hit until there is no obvious precipitation in the lysate. Place the homogenized sample at room temperature for 5 minutes, add 200μL pre-cooled chloroform, mix thoroughly, and stand at room temperature for 5 minutes; centrifuge at 4℃ 12,000g for 15 minutes, separate the samples, and transfer the aqueous phase to a new RNase-free centrifuge tube; add 1 / 2 times the volume of RNAex isopropanol to the supernatant, mix thoroughly, and stand at room temperature for 10 minutes; centrifuge at 4℃ 12,000g for 10 minutes, discard the supernatant after centrifugation, and be careful not to touch the RNA precipitate; add 80% ethanol (pre-cooled at -20℃) equal to the volume of RNAex to the centrifuge tube, wash the RNA precipitate and the wall of the centrifuge tube, centrifuge at 4℃ 7,500g for 5 minutes, carefully discard the supernatant, and do not touch the precipitate; open the centrifuge tube cap and dry the precipitate at room temperature for about 5 minutes; add an appropriate amount of RNase free water to the centrifuge tube to dissolve the RNA. Store the dissolved RNA at -80℃.

[0101] 3. Synthesis of the first strand of miRNA cDNA

[0102] The tailing method was used for reverse transcription of the first strand cDNA of miRNA. The specific operation steps were carried out according to the instructions of the miRNA cDNA first strand synthesis kit of Aikerui Biotechnology Co., Ltd., which are as follows:

[0103] (1) Preparation of reverse transcription system (operate on ice): Total RNA 2 μg, 2×miRNA RT Reaction Solution 5 μL, miRNA RT Enzyme Mix 1.25 μL, and the rest is made up to 10 μL with RNase-Free water (Total RNA is the RNA of each group of cells extracted in the previous step and step 2, and the other reagents are provided by the kit).

[0104] (2) Reverse transcription procedure: 37°C for 60 min, 85°C for 5 min;

[0105] (3) Store the synthesized cDNAs of different groups at -20°C.

[0106] 4. RT-qPCR

[0107] RT-qPCR analysis was performed according to the instructions of SYBR Green Pro Taq HS premixed qPCR kit II (purchased from Hunan Aikerui Biotechnology Co., Ltd.). The upstream primer of novel-m0298-5p was synthesized by Yangling Tianrun Aoke Biotechnology Co., Ltd. The upstream primer was novel-m0298-5p: AATTAACAGGGCTTCCCTGGTGG. The downstream primer was U6 universal primer: TCGCTCCACCAACTAAGAA. The expression of miRNA was detected with sheep U6 gene (as an internal reference, and each sample was biologically repeated 3 times.

[0108] The specific steps are as follows:

[0109] (1) Dilute the cDNA of different groups prepared in step 3 10 times with RNase-Free water for later use;

[0110] (2) Prepare the reaction system on ice (20uL system): 10μL 2×SYBR Green Pro Taq HS Premix II (provided in the kit); 0.8μL upstream and downstream primers of novel-m0298-5p (10 uM); 2μL first-strand cDNA of miRNA treated in step (1); 7.2μL RNase-Free water.

[0111] (3) Reaction conditions: 95°C, 30 s; 40 cycles (95°C, 5 s; 60°C, 20 s).

[0112] 5. Data Analysis

[0113] SPSS 20.0 software and Excel were used to analyze the data and perform independent sample t-tests. The data are presented as "mean ± standard deviation". * indicates P < 0.05, with significant difference; ** indicates P < 0.01, with extremely significant difference. GraphPadPrism 8 software was used to draw the graph (see Figure 2 ).

[0114] 6. Results

[0115] The results showed that the relative expression levels of novel-m0298-5p mRNA in the transfected cells of each group were as follows:

[0116] Taking novel-m0298-5p mimic NC transfected in ovarian granulosa cells of small-tail Han sheep as control, the relative expression level of novel-m0298-5p mRNA in cells was 23.26 after transfection of novel-m0298-5p mimic in ovarian granulosa cells of small-tail Han sheep, which increased by 22.94 times;

[0117] Taking the novel-m0298-5p inhibitor NC transfected in the ovarian granulosa cells of the Small-Tail Han sheep as the control, after the novel-m0298-5p inhibitor was transfected in the ovarian granulosa cells of the Small-Tail Han sheep, the relative expression level of novel-m0298-5p mRNA in the cells was 0.17, which was reduced by 5.8 times;

[0118] After transfection of novel-m0298-5p mimic and inhibitor into ovarian granulosa cells of small-tail Han sheep, the expression level of endogenous novel-m0298-5p was increased or inhibited. The novel-m0298-5p mimic and inhibitor can be used for subsequent experiments.

[0119] Example 3: Dual luciferase reporter gene assay

[0120] 1. Luciferase reporter plasmid construction and plasmid extraction

[0121] RNAhybrid (https: / / bibiserv.cebitec.uni-bielefeld.de) and miRanda (http: / / www.bioinformatics.com.cn) software were used to predict the binding sites of 3'UTR of WNT5A mRNA and novel-m0298-5p.

[0122] According to the binding site predicted by the software, primers were designed for the fragments about 200 bp upstream and downstream of the predicted binding site using an online primer design tool, and a high-fidelity enzyme was used to amplify the fragments about 200 bp upstream and downstream of the predicted binding site of the target gene using small-tailed Han sheep DNA as a template. After the amplified product was purified, it was connected to the pmiRGLO vector using seamless cloning technology, and after transformation, screening and sequencing identification, the plasmid was extracted using an endotoxin-free plasmid mini-extraction kit;

[0123] The extracted plasmid was named pmiRGLO-WNT5A-WT (shown in SEQ ID NO.10). The WNT5A-MUT with a mutated binding site was synthesized by a total gene synthesis method, and the mutant vector was constructed and extracted according to the above method. The extracted plasmid was named pmiRGLO-WNT5A-MUT (SEQ ID NO.11).

[0124] pmiRGLO-WNT5A-WT and pmiRGLO-WNT5A-MUT were synthesized by Suzhou GeneWeiZhi Biotechnology Co., Ltd., and the sequences are shown in SEQ ID No. 10 and SEQ ID No. 11. Plasmids were extracted with reference to the EasyPure® Plasmid MiniPrep Kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd.).

[0125] The primer sequences are: upstream primer 5′AGGGCAATGTCTTCCAAGTTCTTC-3′ (SEQ ID NO. 8); downstream primer 5′-GTTATTCATACCTAGCGACCACCAAG -3′ (SEQ ID NO. 9).

[0126] 2. Cell culture and transfection

[0127] After taking out the HEK293T cells from liquid nitrogen, they were quickly placed in a 37°C water bath to dissolve for 2 minutes, centrifuged at 1000rpm for 5 minutes at room temperature, and the supernatant was discarded. DMEM / F12 complete medium (including: DMEM / F12 basal medium (Gibco, USA), 10% fetal bovine serum (Fetal Bovine Serum) (Gibco, USA) and 1% triple antibody (penicillin-streptomycin-amphotericin B) were added to culture the cells at 37°C and 5% CO2. The medium was changed every 48 hours. When the cell density reached about 70%~80%, the cells were transfected according to the INVI DNA&RNA Transfection Reagent™ steps. That is, the wild-type (WT) and mutant (MUT) dual luciferase reporter vectors were co-transfected with novel-m0298-5p mimic and mimics NC into HEK293T cells respectively; the experimental groups were:

[0128] WNT5A-WT+novel-m0298-5p mimic NC, WNT5A-WT+novel-m0298-5p mimic, WNT5A-MUT+novel-m0298-5p mimic NC, WNT5A-MUT+novel-m0298-5p mimic.

[0129] Set up 4 replicates for each group. After mixing, place in a 37°C, 5% CO2 incubator for 24 hours.

[0130] 3. Dual luciferase assay

[0131] 24 hours after cell transfection, dual-luciferase activity was detected using the Dual-Luciferase® Reporter Assay System kit (purchased from Promega, USA). The specific operation is as follows:

[0132] (1) Prepare passive lysis buffer 1×PLB: Add 1 volume of 5× Passive Lysis Buffer (PLB) to 4 volumes of distilled water, mix well and store in a refrigerator at 4°C until use.

[0133] (2) Preparation of LAR II: Dissolve the freeze-dried Luciferase Assay Substrate in the kit in Luciferase Assay Buffer II, mix well, and store in a -80℃ refrigerator for later use.

[0134] (3) Preparation of Stop & Glo® Reagent: Add 10 μL of 50× Stop & Glo® Substrate to 500 μL of Stop & Glo® Buffer and mix well. Shake the mixture in the Stop & Glo® Reagent bottle for 10 seconds.

[0135] (4) 24 hours after transfection, aspirate the culture medium in the 24-well plate, rinse with PBS 2 to 3 times, add 100 μl of Passive Lysis Buffer (PLB) to each well, and gently shake the culture plate at room temperature for 15 minutes to fully lyse the cells.

[0136] (5) The lysed and mixed cells were pipetted into a 96-well dual-luciferase brown ELISA plate, with 6 replicates per group.

[0137] (6) Add 20 μL of PLB cell lysate to the sample well, and then add 100 μL of LAR Ⅱ to detect the firefly luciferase activity using VarioskanLUX multi-function microplate reader.

[0138] (7) Add 100 μL Stop & Glo reagent to the sample well and detect Renilla luciferase activity using a Varioskan LUX multi-function microplate reader.

[0139] 4. Data Analysis

[0140] SPSS 20.0 software was used to perform independent sample t-tests, and the data were expressed as "mean ± standard deviation". * indicates P < 0.05, with significant difference; ** indicates P < 0.01, with extremely significant difference. GraphPad Prism 8 software was used to draw the graph (see Figure 3 ).

[0141] 5. Results

[0142] The results show that ( Figure 3 ), novel-m0298-5p mimics can bind to the 3'UTR region of WNT5A to inhibit the activity of the firefly luciferase gene; the seed sequence of novel-m0298-5p can bind to the target specific site of the WNT5A gene.

[0143] Example 4: RT-qPCR and Western blot detection of the expression level of the target gene WNT5A

[0144] 1. RNA extraction and detection

[0145] 1. Preparation of RNA samples

[0146] Specific implementation method The same as step 2 of Example 2, extracting RNA of different groups. Transfection test groups: miRNA mimic group (mimic), miRNA mimic negative control group (mimic NC), miRNA inhibitor group (inhibitor), miRNA inhibitor negative control group (inhibitor NC).

[0147] 2. Synthesis of miRNA cDNA first strand

[0148] The first-strand cDNA of mRNA was reverse transcribed (on ice) according to the HiScript®ⅡQ RT SuperMix for qPCR (+gDNAwiper) kit of Novozyme Biotechnology Co., Ltd. The specific operation is shown in the following table. The reverse transcription product was diluted 5 times and stored at 4°C for subsequent experiments.

[0149] Table 1 cDNA first-strand synthesis operation flow

[0150] 3. RT-qPCR

[0151] According to the WNT5A gene sequence published on the NCBI website (accession number XM_004018630.5), primers were designed using PrimerPremier 5.0 software, and specificity analysis was performed using BLAST. The primers were sent to Yangling Tianrun Aoke Biotechnology Co., Ltd. for primer synthesis. The primer sequences were: WNT5A upstream primer 5′AGGGCAATGTCTTCCAAGTTCTTC-3′ (SEQ ID NO. 8); WNT5A downstream primer 5′-GTTATTCATACCTAGCGACCACCAAG -3′ (SEQ ID NO. 9).

[0152] RT-qPCR test was performed according to the instructions of SYBR Green Pro Taq HS premixed qPCR kit of Acori Biotechnology Co., Ltd. Sheep GAPDH gene (GenBank accession number: NM_001190390.1) was used as an internal reference. Three biological replicates were performed for each sample. The specific operations are shown in the following table.

[0153] Table 2 RT-qPCR reaction system and procedure

[0154] 2. Protein extraction and testing

[0155] Specific implementation method The same as step 2 of Example 2, extracting total proteins of different groups. Transfection test groups: miRNA mimic group (mimic), miRNA mimic negative control group (mimic NC), miRNA inhibitor group (inhibitor), miRNA inhibitor negative control group (inhibitor NC).

[0156] 1. Protein extraction

[0157] After 48 hours of transfection, the cells were washed with PBS and RIPA lysis buffer (including PMSF) (purchased from Wuhan Sevier Biotechnology Co., Ltd.) was added to extract total protein. The total protein concentration was detected by BCA kit (purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd.). 5*protein loading buffer (purchased from Wuhan Sevier Biotechnology Co., Ltd.) was added at a ratio of 4:1, boiled at 98℃ for 5min, ice bathed for 5min, repeated 3 times and stored in a -80℃ refrigerator.

[0158] 2. Western blot test

[0159] 30 μg of denatured protein was loaded into each well, and GAPDH was used as an internal reference. Electrophoresis was performed on 12% SDS-PAGE gel (Sodium dodecylsulfate polyacrylamide gel electrophoresis), and then transferred to a PVDF membrane. The membrane was then blocked with 5% skim milk powder at room temperature for 1.5 h, and then incubated with rabbit primary antibodies WNT5A (purchased from Affinity, 1:1000) and GAPDH (purchased from Affinity, 1:5000) at 4°C overnight. After washing the membrane with TBST (Tris-Buffered Saline with Tween 20), goat anti-rabbit secondary antibody (purchased from Affinity, 1:6000) was used for incubation at room temperature for 1 h. After washing the membrane, the substrate chemiluminescence solution (Electrochemi-luminescence, ECL) was added for reaction for 5 min, and the chemiluminescence instrument was exposed and imaged.

[0160] 3. Data Analysis

[0161] According to the CT value measured by RT-qPCR, the relative quantitative analysis of WNT5A gene mRNA was performed by the 2-ΔΔCt method, and the Western blot results were quantitatively analyzed using Image J software. SPSS 20.0 software was used for independent sample t test, and GraphPad Prism 8 software was used for drawing (see Figure 4 ).

[0162] IV. Results

[0163] like Figure 4 As shown, compared with the control group, the relative expression levels of WNT5A gene mRNA and its encoding protein decreased after novel-m0298-5p overexpression, and increased after novel-m0298-5p inhibition.

[0164] The results showed that novel-m0298-5p could target the 3′UTR region of WNT5A and inhibit the expression of WNT5A.

[0165] Example 5: CCK-8 method to detect the effect of novel-m0298-5p on granulosa cell viability

[0166] 1. Cell culture

[0167] The ovarian granulosa cells were cultured and transfected according to the method of Example 2; the experiment set up a blank group (no cells), a drug-added group (novel-m0298-5p mimic-NC, novel-m0298-5p inhibitor-NC, novel-m0298-5pmimic, novel-m0298-5p inhibitor), and a drug-added group (untreated cells), and each group had 5 parallel wells.

[0168] The specific steps are as follows:

[0169] (1) Cell culture

[0170] Cell culture was performed according to the method of Example 2.

[0171] (2) Cell transfection

[0172] The miRNA mimics (mimic, sequence: ACAGGGCUUCCCUGGUGGCUCGGAUCCGAGCCACCAGGGAAGCCCUGU), miRNA mimic negative control (mimic NC, sequence: UCACAACCUCCUAGAAAGAGUAGAUCUACUCUUUCUAGGAGGUUGUGA), miRNA inhibitor (inhibitor, sequence: UCCGAGCCACCAGGGAAGCCCUGU), and miRNA inhibitor negative control (inhibitor NC, sequence: UCUACUCUUUCUAGGAGGUUGUGA) were sent to a gene company for chemical synthesis. Referring to the instructions for use of miRNA products of Wuhan Saiweier Biotechnology Co., Ltd., miRNA mimics and inhibitors were prepared into storage solutions with a concentration of 20 μM, respectively, for transfection experiments.

[0173] When the ovarian granulosa cells grew to the logarithmic phase, the cells were digested with 0.25% trypsin and counted. 5 Each well was evenly transferred to a 24-well culture plate, and transfection was performed when the cell confluence reached 60%-80%. Cell transfection was performed according to the instructions of Invigentech INVI DNA RNA from Invigentech, USA. The miRNA mimics, inhibitors and controls were transfected into the ovarian granulosa cells of small-tailed Han sheep respectively.

[0174] Transfection test groups: miRNA mimic group (mimic), miRNA mimic negative control group (mimic NC), miRNA inhibitor group (inhibitor), miRNA inhibitor negative control group (inhibitor NC). Each sample group has 4 parallel test groups (NC represents the negative control group of the corresponding preparation). The transfection concentrations of miRNA mimic, miRNA mimic-NC, miRNAinhibitor, and miRNA inhibitor-NC are all 20μM.

[0175] At the same time, a blank group (no cells) was set up: this group had no cells but only DMEM / F12 complete culture medium.

[0176] 0 drug addition group (cells without treatment): DMEM / F12 complete medium was added to the cultured cells without any transfection treatment.

[0177] 2. CCK-8 detection

[0178] After 24 hours of transfection in each group, the cell viability was detected using the Cell Counting Kit-8 (CCK-8) kit of Beijing Lanjieke Technology Co., Ltd. The specific operation was as follows: 10 μL of CCK8 reaction solution was added to the 96-well plate along the cell plate wall, and the plate was placed in the incubator for further incubation for 4 hours. The OD value of each group was measured at 450 nm using a Varioskan LUX multifunctional microplate reader.

[0179] 3. Data processing

[0180] The cell viability was calculated using the formula: cell viability = (absorbance value of the drug-added group - absorbance value of the blank group) / (absorbance value of the 0 drug-added group - absorbance value of the blank group). SPSS 20.0 software was used for independent sample t-test, and GraphPad Prism 8 software was used for graphing (see Figure 2 ).

[0181] 4. Results

[0182] like Figure 2As shown in B, the cell viability after novel-m0298-5p overexpression was lower than that of the control group (decreased by 1.18), and the cell viability increased after novel-m0298-5p inhibition (increased by 1.16). Therefore, it can be seen that novel-m0298-5p has an inhibitory effect on the viability of ovarian granulosa cells of small-tail Han sheep.

[0183] Example 6: EdU detection of the effect of novel-m0298-5p on granulosa cell viability

[0184] 1. Cell culture

[0185] (1) Cell culture

[0186] The ovarian granulosa cells were cultured according to the method of Example 2.

[0187] (2) Cell transfection

[0188] The miRNA mimics (mimic, sequence: ACAGGGCUUCCCUGGUGGCUCGGAUCCGAGCCACCAGGGAAGCCCUGU), miRNA mimic negative control (mimic NC, sequence: UCACAACCUCCUAGAAAGAGUAGAUCUACUCUUUCUAGGAGGUUGUGA), miRNA inhibitor (inhibitor, sequence: UCCGAGCCACCAGGGAAGCCCUGU), and miRNA inhibitor negative control (inhibitor NC, sequence: UCUACUCUUUCUAGGAGGUUGUGA) were sent to a gene company for chemical synthesis. Referring to the instructions for use of miRNA products of Wuhan Saiweier Biotechnology Co., Ltd., miRNA mimics and inhibitors were prepared into storage solutions with a concentration of 20 μM, respectively, for transfection experiments.

[0189] When the ovarian granulosa cells grew to the logarithmic phase, the cells were digested with 0.25% trypsin and counted. 5 Each well was evenly transferred to a 24-well culture plate, and transfection was performed when the cell confluence reached 60%-80%. Cell transfection was performed according to the instructions of Invigentech INVI DNA RNA from Invigentech, USA. The miRNA mimics, inhibitors and controls were transfected into the ovarian granulosa cells of small-tailed Han sheep respectively.

[0190] Transfection test groups: miRNA mimic group (mimic), miRNA mimic negative control group (mimic NC), miRNA inhibitor group (inhibitor), miRNA inhibitor negative control group (inhibitor NC). Each sample group has 4 parallel test groups (NC represents the negative control group of the corresponding preparation). The transfection concentrations of miRNA mimic, miRNA mimic-NC, miRNAinhibitor, and miRNA inhibitor-NC are all 20μM.

[0191] 2. EdU detection

[0192] After 24 hours of transfection, the proliferation rate of small-tail Han sheep granulosa cells was analyzed using the EdU-555 cell proliferation detection kit (purchased from Shanghai Bio-Tech Biotechnology Co., Ltd.).

[0193] The specific operations are as follows:

[0194] After 24 hours of transfection, cells in each group were inoculated into 24-well plates for different transfection treatments. 2×EdU working solution (20μM) was preheated at 37℃ and added to the 24-well plates in equal volume. Incubate for 2h. Abandon the culture medium and add 1mL of fixative solution (4% paraformaldehyde) for 15 min. Remove the fixative solution and add 1mL of washing solution (PBS containing 3% BSA) for 5min / time for 3 times. Remove the washing solution and add 1mL of permeabilization solution (PBS containing 0.3% Triton X-100) for 15min. Remove the permeabilization solution and add 1mL of washing solution for 5min / time for 2 times. Click reaction solution: 430μl Click Reaction Buffer, 20μl CuSO4, 1μl Azide555, 50μl ClickAdditive Solution, total volume 500μl. Prepare the reaction solution in multiples according to this system. Add 100μl Click reaction solution and incubate for 30min in the dark. Remove the Click reaction solution, add 1 mL of washing solution, 5 min / time, 3 times. Add 100 μl of Hoechst 33342 (v / v, 1:1000) diluted in PBS, incubate for 10 min in the dark. Add 1 mL of washing solution, 5 min / time, 3 times. Detect fluorescence under a microscope. Each group of experiments has 3 replicates.

[0195] 3. Data processing

[0196] Image J software was used to count cells, and cell proliferation rate (%) = number of proliferating cells / total number of cells × 100. SPSS 20.0 software was used for independent sample t test, and GraphPad Prism 8 software was used for drawing (see Figure 2 C and Figure 2 D).

[0197] 4. Results

[0198] like Figure 2 C and Figure 2 As shown in D, the cell viability was lower after novel-m0298-5p overexpression than that of the control group (reduced by 1.17 times), and the cell viability was higher after novel-m0298-5p inhibition (increased by 1.37 times).

[0199] It can be seen that novel-m0298-5p can inhibit the viability of ovarian granulosa cells in Small Tail Han sheep.

[0200] The sequences involved in the present invention are as follows:

[0201] SEQ ID No.1

[0202] novel-m0298-5p sequence

[0203] ACAGGGCTTCCCTGGTGGCTCGGA

[0204] SEQ ID No.2

[0205] Primer pair for amplifying novel-m0298-5p sequence, upstream primer

[0206] AATTAACAGGGCTTCCCTGGTGG

[0207] SEQ ID No.3

[0208] Primer pair for amplifying novel-m0298-5p sequence, downstream primer

[0209] TCGCTCCACCAACTAAGAA

[0210] SEQ ID No.4

[0211] The mimic sequence of novel-m0298-5p is ACAGGGCUUCCCUGGUGGCUCGGAUCCGAGCCACCAGGGAAGCCCUGU

[0212] SEQ ID No.5

[0213] novel-m0298-5p mimic control sequence, mimic NC sequence

[0214] UCACAACCUCCUAGAAAGAGUAGAUCUACUCUUUCUAGGAGGUUGUGA

[0215] SEQ ID No.6

[0216] novel-m0298-5p inhibitor, inhibitor sequence

[0217] UCCGAGCCACCAGGGAAGCCCUGU

[0218] SEQ ID No.7

[0219] novel-m0298-5p inhibitor control sequence, inhibitor NC sequence

[0220] UCUACUCUUUCUAGGAGGUUGUGA

[0221] SEQ ID No.8

[0222] Upstream primer sequence of target gene WNT5A

[0223] AGGGCAATGTCTTCCAAGTTCTTC

[0224] SEQ ID No.9

[0225] Downstream primer sequences of target gene WNT5A

[0226] GTTATTCATACCTAGCGACCACCAAG

[0227] SEQ ID No.10

[0228] pmiRGLO-WNT5A-WT:GCTAGCtaggagctcctcttggaaaacagctcgctacttagggattttatcccccctaccacttttatttcgaggaacagcagttttcta tgtgttcctgacatcacttggcgaatggacgtcacggaggcgtggccgcatttctcccttctgctcctgtgttcagactccactggcgcttcccgctcctctgcaggt gtccc gagaactgctcccagtggacttgaacacttggttcagtggtacctgatagctcagtctcttgtacataacatatatatatatatacatatataaatatacatatagt tatatcggcgcagccagtgatctgggttccagtttactcgggttatttcttcggcctagagccttgtggtcctccactgcaattcaagtgggattttccccgCTCGAG

[0229] SEQ ID No.11

[0230] pmiRGLO-WNT5A-MUT:

[0231] GCTAGCtaggagctcctcttggaaaacagctcgctacttagggatttttcccccctaccacttttatttcgaggaacagcagttttctatgtgttcct gacatcacttggcgaatggacgtcacggaggcgtggccgcatttctcccttctgctcctgtgttcagactccactggcgcttcccgctcctctgcaggt cagggct gaactgctcccagtggacttgaacacttggttcagtggtacctgatagctcagtctcttgtacataacatatatatatatatacatatataaatatacatatagt tatatcggcgcagccagtgatctgggttccagtttactcgggttatttcttcggcctagagccttgtggtcctccactgcaattcaagtgggattttccccgCTCGAG

[0232] The above is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Although the present invention is described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention. Therefore, the protection scope of the present invention shall be based on the protection scope of the claims.

Claims

1. A miRNA marker associated with proliferation of ovarian granulosa cells of small-tailed Han sheep, characterized in that: The miRNA marker is novel-m0298-5p, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. Use of the miRNA marker novel-m0298-5p according to claim 1 as a target in any of the following items; a) Use in the preparation of drugs for promoting proliferation and / or inhibiting apoptosis of ovarian granulosa cells of Small Tail Han sheep; b) Application in identifying the proliferation patterns of ovarian granulosa cells in Small Tail Han sheep.

3. The use according to claim 2, characterized in that: The target gene of the miRNA marker novel-m0298-5p is WNT5A; Preferably, the effect of promoting the proliferation of ovarian granulosa cells of Small Tail Han sheep or inhibiting the apoptosis of ovarian granulosa cells of Small Tail Han sheep is achieved by inhibiting the expression of miRNA marker novel-m0298-5p.

4. A method for studying the function of genes related to the proliferation of ovarian granulosa cells of small-tailed Han sheep and / or identifying the proliferation process of ovarian granulosa cells of small-tailed Han sheep and / or screening drugs for promoting the proliferation of ovarian granulosa cells of small-tailed Han sheep and / or inhibiting the apoptosis of ovarian granulosa cells of small-tailed Han sheep, characterized in that: The method comprises knocking out the miRNA marker novel-m0298-5p gene or reducing the expression of the miRNA marker novel-m0298-5p gene; the nucleotide sequence of the miRNA marker novel-m0298-5p gene is shown in SEQ ID NO.1; Preferably, the method of reducing the expression of the miRNA marker novel-m0298-5p gene includes using a miRNA marker novel-m0298-5p inhibitor; the nucleotide sequence of the miRNA marker novel-m0298-5p inhibitor is shown in SEQ ID NO.

6.

5. A method for identifying the proliferation efficiency of ovarian granulosa cells of small-tailed Han sheep, characterized in that: The method comprises: treating a system expressing or containing a miRNA marker novel-m0298-5p gene with a candidate substance; and detecting the expression of the miRNA marker novel-m0298-5p gene in the system; if the expression or activity of the miRNA marker novel-m0298-5p gene is the lowest, it indicates that the proliferation efficiency of the ovarian granulosa cells of the small-tail Han sheep is the highest; the nucleotide sequence of the miRNA marker novel-m0298-5p is shown in SEQ ID NO.

1.

6. Use of the miRNA marker novel-m0298-5p inhibitor in the preparation of a drug for promoting proliferation and / or inhibiting apoptosis of ovarian granulosa cells of small-tail Han sheep, characterized in that: The nucleotide sequence of the miRNA marker novel-m0298-5p inhibitor is shown in SEQ ID NO.

6.

7. A drug for promoting proliferation of ovarian granulosa cells of small-tail Han sheep and / or inhibiting apoptosis of ovarian granulosa cells of small-tail Han sheep, characterized in that: The drug can inhibit the expression of the miRNA marker novel-m0298-5p gene, and the nucleotide sequence of the miRNA marker novel-m0298-5p is shown in SEQ ID NO.

1.

8. The drug according to claim 6 or 7, characterized in that The dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pills or solutions; Preferably, the drug further contains pharmaceutically acceptable excipients; the pharmaceutical excipients refer to conventional drug carriers in the pharmaceutical field; Preferably, the auxiliary materials include one or more of the following: adhesives such as cellulose derivatives, alginate, gelatin and polyvinyl pyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol; fillers such as starch, sucrose; wetting agents such as glycerol; disintegrants such as sodium carboxymethyl starch, cross-linked polyvinyl pyrrolidone and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbate, sorbitan fatty acid and glycerol fatty acid esters; colorants such as titanium dioxide, sunset yellow, methylene blue, medicinal iron oxide red; lubricants such as hydrogenated vegetable oil, talc and polyethylene glycol; coating materials such as acrylic resin, hydroxypropyl methylcellulose, povidone, cellulose acetate; in addition, other auxiliary agents such as flavoring agents and sweeteners can be added to the composition.

9. Use of the miRNA marker novel-m0298-5p according to claim 1 in preparing a pharmaceutical composition for influencing the proliferation of ovarian granulosa cells of small-tail Han sheep.

10. The use according to claim 9, characterized in that: The pharmaceutical composition comprises an up-regulator and a down-regulator of novel-m0298-5p, wherein the up-regulator is a mimetic of novel-m0298-5p, and the down-regulator is an inhibitor of novel-m0298-5p; Preferably, the nucleotide sequence of the novel-m0298-5p mimetic is shown as SEQ ID NO.4, and the nucleotide sequence of the novel-m0298-5p inhibitor is shown as SEQ ID NO.6.

Images