A KASP molecular marker tightly linked to larch growth and its application

Abstract

A KASP molecular marker closely linked to larch growth and its application are designed based on a single nucleotide polymorphism (SNP) site in the larch genome. This SNP site contains an A / C base mutation, wherein the A:C and C:C genotypes exhibit fast-growing genotypes, and the A:A genotype exhibits a non-fast-growing genotype. Also disclosed are primers for detecting the KASP molecular marker and a method for identifying whether a larch is fast-growing using the primer. Also disclosed are reagents, primers, or methods for detecting the molecular marker for identifying whether a larch is fast-growing at the seedling stage and the application of molecular marker-assisted breeding for larch. The primers of the present invention can quickly identify whether a larch is fast-growing, and have the advantages of accuracy, rapidity, low cost, short identification cycle, and ease of operation. They can assist in the selection and breeding of superior larch strains and have broad application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of forest tree molecular marker assisted breeding, and particularly relates to a KASP molecular marker closely linked to larch growth (diameter at breast height) and application thereof. Background Art

[0002] Larix, a genus of the Pinaceae family (Larix spp.), is an important economic tree species valued for its rapid growth, high-quality wood, and wide adaptability. However, traditional breeding methods have problems such as low efficiency and long cycles in improving the growth rate and excellent traits of larch. Therefore, developing molecular markers that are tightly linked to low growth and using molecular markers to assist in the selection of larch fiber growth will effectively save breeding time and land, accelerate the breeding process, and have important practical significance for the selection and promotion of larch varieties. KASP (Kompetitive Allele-Specific PCR), that is, competitive allele-specific PCR, has the advantages of high throughput, low cost, high efficiency, and no need for electrophoresis detection compared to traditional PCR methods. Summary of the Invention

[0003] The first object of the present invention is to provide a KASP molecular marker that is closely linked to larch growth (diameter at breast height) and a primer for detecting the KASP molecular marker.

[0004] The present invention also aims to provide a method for identifying the fast-growing property of larch.

[0005] The final object of the present invention is to provide a reagent, primer or method for detecting the KASP molecular marker and its application in identifying larch growth phenotypes and in larch molecular marker-assisted breeding.

[0006] The first object of the present invention can be achieved by the following technical solution: a KASP molecular marker (nucleotide sequence shown in SEQ ID NO.4) that is closely linked to the growth of larch. The KASP molecular marker is designed based on a SNP site on the larch genome. The SNP site has an A / C base mutation, and the corresponding genotypes include A:A, A:C, and C:C, among which the C:C and A:C genotypes exhibit fast-growing genotypes, and the A:A genotype exhibits a slow-growing genotype. The KASP molecular marker can be obtained by amplification using primers shown in SEQ ID NO.1 to SEQ ID NO.3, respectively.

[0007] The nucleotide sequence of the KASP molecular marker is as follows:

[0008] AAGACTTGGAACACATAATACATCTTTGAAATTACCATCATCTAGTTGAATTGTT CCATATCCTACAACATTCAGATATCTATCATCACCAACAAATATTTGTTGGGTGTTACA TTCATTTAGAGTAGAAAAGTGGCTTTATCCTTATCC(A / C)AATGATAATATTCTCCAAC ATCAATGAGTCACTCATTAGAAGAAGAAGAAGATGCATTAAAGGAAAAACTAGAAGCGGAAAATGTATGTCCATGACATGTAGAGTTAGAAGAAAAATCAAGTTTGATGGTTTGCTTCTTTATTCATGATT

[0009] One SNP site of the present invention is mutated in the case of a fast-growing trait, and is not mutated in the case of a non-fast-growing trait.

[0010] The present invention also provides a set of primers for detecting KASP molecular markers closely linked to larch growth. The set of primers includes two specific upstream primers sca235:1015388-F3 and sca235:1015388-F4 and a universal downstream primer sca235:1015388-R2, wherein the nucleotide sequence of the upstream primer sca235:1015388-F3 is shown as SEQ ID NO.1, the nucleotide sequence of the upstream primer sca235:1015388-F4 is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer sca235:1015388-R2 is shown as SEQ ID NO.3. A FAM fluorescent label sequence is added to the 5' end of the upstream primer sca235:1015388-F3, and a VIC fluorescent label sequence is added to the 5' end of the upstream primer sca235:1015388-F4.

[0011] After the PCR products of the present invention are subjected to fluorescence detection, typing detection is performed on the PCR amplification products and the results are presented in the form of a graph; the graph is divided into X and Y axes, each data point represents an independent DNA sample, and samples of the same genotype are clustered together. Among them, if the genotype is T:T type, the fluorescent signal is blue and clustered near the Y axis, which is determined to be a homozygous material without fast growth; if the genotype is G:T type, the fluorescent signal is green and clustered near the middle position, which is determined to be a heterozygous material with fast growth; if the genotype is G:G type, the fluorescent signal is red and clustered near the X axis, which is determined to be a homozygous material with fast growth.

[0012] The last object of the present invention can be achieved by the following technical solution: use of a reagent for detecting the KASP molecular marker in identifying larch growth phenotypes.

[0013] The present invention has the following advantages:

[0014] The KASP molecular marker primers in the present invention can quickly identify the growth phenotype of larch, and have the advantages of accuracy, rapidity, low cost, short identification cycle, and simple operation. They can assist in the breeding of new larch varieties and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the genotyping diagram of the larch population using the KASP molecular marker primer sca235:1015388 in Example 2. The genotype is T:T type, the fluorescent signal is blue, and the material is concentrated near the Y axis, which is determined to be a homozygous material without fast growth; the genotype is G:T type, the fluorescent signal is green, and the material is concentrated near the middle position, which is determined to be a heterozygous material with fast growth; the genotype is G:G type, the fluorescent signal is red, and the material is concentrated near the X axis, which is determined to be a homozygous material with fast growth. DETAILED DESCRIPTION

[0016] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed in the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify the contents of the present invention based on the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0017] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention but are not intended to limit the present invention.

[0018] Example 1

[0019] In this example, a gene pool was constructed using 310 hybrid larch plants from 39 populations. RAD-seq was performed to obtain SNP sites and perform genome-wide association analysis on growth (DBH) traits. The SNP site sca235:1015388, which is closely linked to the growth traits of larch, was identified (as shown in Table 1).

[0020] Based on the SNP locus information, KASP markers were developed using PrimerPicker Lite for KASPar Version 0.26 (https: / / www.biosearchtech.com / ). Each marker consists of three primers. The two upstream primers, sca235:1015388-F3 and sca235:1015388-F4, are specific primers designed based on the SNP locus sca235:1015388, and the downstream primer sca235:1015388-R2 is a universal primer. The 3' end of the upstream primer contains a variant base, and the 5' end is connected to the fluorescent signal tag sequence of carboxyfluorescein FAM (GAAGGTGACCAAGTTCATGCT) and phosphoramidite fluorescein VIC (GAAGGTCGGAGTCAACGGATT), respectively. The three primer sequences are shown below:

[0021] 1)sca235:1015388-F3:

[0022] 5'- GAAGGTGACCAAGTT CATGCTTTGATGTTGGAGAATATTATCATTG-3' (SEQ ID NO. 1), the underlined portion is the sequence of fluorescein FAM.

[0023] 2)sca235:1015388-F4:

[0024] 5'- GAAGGTCGGAGTCAACGGATT ATTGATGTTGGAGAATATTATCATTT-3' (SEQ ID NO. 2), the underlined portion is the sequence of fluorescein VIC.

[0025] 3)sca235:1015388-R2:

[0026] 5'-TTGTTGGGGTTACATTCATTTAGA-3' (SEQ ID NO. 3).

[0027] The primers can also be developed into a kit for use.

[0028] Example 2

[0029] PCR amplification of a single larch plant using the labeled primers and detection of the PCR product include the following steps:

[0030] (1) Larch DNA extraction

[0031] The experimental material is fresh leaves from a single larch plant. The steps for extracting genomic DNA are as follows:

[0032] ① Take a small amount of fresh leaves and place them in a 2 mL centrifuge tube. Add steel balls and grind them in a grinder at 30 times per second for 2 minutes. Add 800 μL of 2% CTAB extract, mix well, and place in a 65°C water bath for 1 hour (shake well every 10 minutes).

[0033] ② After allowing to cool to room temperature, add 800 μL of chloroform:isoamyl alcohol (volume ratio 24:1), mix gently for 10 minutes, and then centrifuge at 12000 rpm for 15 minutes. Transfer the supernatant (about 600 μL) to a new 1.5 mL centrifuge tube;

[0034] ③ Add 2 / 3 volume of isopropanol to the supernatant, mix gently, and place at -20℃ for 30 minutes to 1 hour;

[0035] ④ Centrifuge at 12000 rpm for 10 min and discard the supernatant;

[0036] ⑤ Wash the DNA pellet once with anhydrous ethanol, then wash it once with 75% (volume percentage) ethanol, and blow dry it on a clean bench;

[0037] ⑥ Add 50 μL TE (or ddH2O) to dissolve and use as larch genomic DNA.

[0038] (2) Using larch genomic DNA as a template, PCR amplification was performed using the KASP molecular marker primers in Example 1.

[0039] PCR amplification was performed in a CFX fluorescence quantitative instrument from BIO-RAD. The 5 μL reaction system included: 1.25 μL of genomic DNA at a concentration of 100 ng / μL, 2.5 μL of HiGeno2×ProbeMixA, 0.25 μL of each upstream primer at a concentration of 10 mM, and 0.75 μL of a downstream primer at a concentration of 10 mM.

[0040] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 20 s, annealing at 61-55°C for 1 min, with the annealing temperature decreasing by 0.6°C per cycle for a total of 10 cycles, followed by denaturation at 95°C for 20 s and extension at 55°C for 1 min. After 27 cycles, the fluorescence signal was read at 25°C for 1 min.

[0041] (3) Amplification results:

[0042] PCR amplification was performed using the primers of Example 1, and fluorescence detection was performed on the amplified product. The fluorescence signal was combined with the marker information to complete the genotyping and present it in the form of a chart; Figure 1 As shown, the figure is divided into X and Y axes, each data point represents an independent DNA sample, and samples with the same genotype are clustered together.

[0043] like Figure 1 After the PCR products were read by fluorescence, there was one genotype that did not grow rapidly, and the fluorescent signal of the genotype "T:T" was blue and concentrated near the Y-axis. There were two genotypes that grew rapidly, of which the fluorescent signal of the genotype "G:G" was red and concentrated near the X-axis, and the fluorescent signal of the genotype "G:T" was green and concentrated near the middle.

[0044] The results showed that the fast-growing phenotype of individual plants in the population during assisted selection for larch growth was consistent with the band pattern amplified by the primers for the molecular markers. This example uses KASP molecular markers to screen for fast-growing larch, achieving assisted breeding for larch.

[0045] Table 1 Gene mapping results of SNP site sca3332:283854

[0046] CHROM POS REF ALT sca235 1015388 A C

Claims

1. An application of a KASP molecular marker closely linked to larch growth, characterized in that The molecular marker is used to assist in fast-growing larch breeding; the KASP molecular marker has a base mutation of A / C at position 151 of sequence SEQ ID NO.4; the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.4, and the assisted fast-growing larch breeding is achieved by screening larch based on its diameter at breast height. The nucleotide sequence of SEQ ID NO.4 is AAGACTTGGAACACATAATACATCTTTGAAATTACCATCATCTAGTTGAATTGTTCCATATCCTACAACATTCAGATATCTATCATCACCAACAAATATTTGTTGGGTGTTACATTCATTTAGAGTAGAAAAGTGGCTTTATCCTTATCC(A / C)AATGATAATATTCTCCAACATCAATGAGTCACTCATTAGAAGAAGAAGAAGATGCATTAAAGGAAAAACTAGAAGCGGAAAATGTATGTCCATGACATGTAGAGTTAGAAGAAAAATCAAGTTTGATGGTTTGCTTCTTTATTCATGATT.

2. The use according to claim 1, characterized in that The A / C base mutation corresponds to genotypes including A:A, A:C and C:C, wherein the A:A genotype is a genotype that does not have fast growth, and the A:C and C:C genotypes are genotypes that have fast growth.

3. A primer for detecting KASP molecular markers related to larch growth, characterized in that The primer sequences are F3, F4 and R2; the nucleotide sequence of F3 is shown in SEQ ID NO.1, the nucleotide sequence of F4 is shown in SEQ ID NO.2, and the nucleotide sequence of R2 is shown in SEQ ID NO.

3.

4. A kit comprising the primers according to claim 3.

Images