Molecular marker associated with yield traits of arrow leek pea vs_chr1_250303380 and application thereof
By developing the molecular marker Vs_Chr1_250303380 related to the yield traits of arrow pea, combined with whole genome association analysis and PCR detection, the problems of long breeding cycle and low efficiency in traditional breeding methods were solved, and efficient screening and identification of high-yield arrow pea were achieved to meet the needs of animal husbandry.
Patent Information
- Application Number
- CN202510095656.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-21
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2045-01-21
AI Technical Summary
Traditional breeding methods rely on natural variation and phenotypic observation, resulting in a long breeding cycle and low efficiency for arrow peas. It is difficult to quickly meet the livestock industry's demand for high-quality and high-yield feed, and the existing varieties have low and unstable yields.
The molecular marker Vs_Chr1_250303380 related to the yield trait of pea was developed. Through genome-wide association analysis and third-generation molecular marker technology, PCR was used to detect pea leaf DNA to identify genotypes related to high-yield traits.
It has achieved rapid and accurate screening and identification of high-yield arrow peas, significantly improved breeding efficiency, shortened breeding years, and met the livestock industry's demand for high-quality and high-yield feed.
Smart Images

Figure CN119662893B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to molecular markers related to yield traits of pea cultivar and applications thereof. Background Art
[0002] Currently, crop breeding methods are mainly divided into molecular breeding and traditional breeding. During the breeding process, the selection of target traits depends largely on the genotype and phenotype. Molecular marker-assisted breeding takes advantage of the fact that molecular markers are closely linked to target trait genes. By detecting molecular markers, the presence of target genes can be detected, achieving the purpose of selecting target traits. It has the advantages of being fast, accurate, and not affected by environmental conditions. By using molecular markers to select target trait genotypes, the breeding period is shortened, the breeding process is accelerated, breeding efficiency is improved, and many difficulties in conventional breeding methods are overcome. The research and development and application of molecular marker technology based on genome-wide association studies (GWAS) have become one of the important hot spots and competitive areas in the current breeding field.
[0003] Vicia sativa L. is an important self-pollinating annual forage legume. It is primarily distributed in Turkey, Australia, New Zealand, and various parts of China. Due to its high nutritional value, good palatability, and its ability to prevent the fermentation of ruminant silage, Vicia sativa is an important raw material for feed production. Furthermore, Vicia sativa can be used as a high-quality green manure and a cold-resistant crop, with broad application prospects in environmental protection and ecological restoration. However, traditional breeding methods, which rely on natural variation and phenotypic observation, have long cycles and low efficiency, making it difficult to quickly meet the rapidly growing demand for high-quality, high-yield feed in the livestock industry. In the current context of rapid livestock industry development, the yield of feed crops is particularly prominent. Existing forage crop varieties generally suffer from low and unstable yields, making it difficult to ensure the efficient operation of the feed supply chain. Furthermore, the process of determining high-yield traits typically requires significant time, capital, and manpower, seriously impacting breeding efficiency. Therefore, the development of precise and efficient molecular marker technologies is crucial. Molecular marker-assisted breeding can quickly locate gene loci associated with high-yield traits, significantly improving breeding efficiency. This study combines genome-wide association analysis of pea with third-generation molecular marker technology to develop InDel molecular markers associated with pea yield traits. This provides a scientific basis for breeding peas with high-yield traits, thereby accelerating the selection of high-yield peas. Summary of the Invention
[0004] One of the objects of the present invention is to provide a molecular marker related to the yield traits of pea.
[0005] The second object of the present application is to provide an application of the above-mentioned molecular marker related to yield traits of arrow leek pea.
[0006] To achieve the above-mentioned object, the present application adopts the following technical solutions:
[0007] The present application discloses a pair of molecular markers related to yield traits of arrow leek pea, which are located on chromosome 1 of arrow leek pea, and are named Vs_Chr1_250303380.
[0008] The molecular marker Vs_Chr1_250303380 is an insertion / deletion fragment on chromosome 1 of the arrow leek pea reference genome
[0009] AAATCAAAACCAAATTCAAGAATCTTTCAAAAATTTAGAGACAAATGTTTTTGAATTTC (as shown in SEQ ID NO. 3).
[0010] The primer pair for amplifying the molecular marker related to yield traits of arrow leek pea has the sequence of the primer pair corresponding to the molecular marker Vs_Chr1_250303380 as follows:
[0011] Vs_Chr1_250303380-F: GTGGAGAAAGAAAGAGGTAGA (as shown in SEQ ID NO. 1);
[0012] Vs_Chr1_250303380-R: CATGTTTCTGAAAACCCATT (as shown in SEQ ID NO. 2).
[0013] The present application also discloses an application of the above-mentioned molecular marker primer pair in assisted breeding of yield high / low traits of arrow leek pea. The specific content is that the molecular marker of the present application can be used in future molecular marker assisted breeding, and whether the molecular marker of the present application exists is detected by extracting DNA of leaves in the seedling stage, so as to identify yield traits of arrow leek pea. The detection can be performed by using a PCR detection method, and specifically, the above-mentioned molecular marker primer pair can be used, and the detection can also be performed by using a sequencing method.
[0014] The present application also discloses an application of the above-mentioned molecular marker in identifying yield high / low traits of arrow leek pea, especially in screening and identifying high-yield arrow leek pea, and the application is used for identifying whether arrow leek pea has high-yield traits, and the specific steps are as follows:
[0015] (1) The DNA of the test germplasm is used as a template for PCR amplification, and the primer pair corresponding to the marker Vs_Chr1_250303380 is used as a primer, and the reaction system of PCR amplification is as shown in Table 1:
[0016] Table 1 PCR amplification reaction system
[0017]
[0018]
[0019] PCR amplification program: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 72°C for 5 s, 35 cycles; extension at 72°C for 1 min; storage at 4°C.
[0020] (2) Agarose gel electrophoresis of PCR products was performed to determine the yield of peas.
[0021] If the PCR amplification product is a characteristic band of 160 bp in length as shown in SEQ ID NO.4, the pea is a low-yield type; if the PCR amplification product is a characteristic band of 101 bp in length as shown in SEQ ID NO.5, the pea is a high-yield type.
[0022] In addition, reagents containing the above-mentioned molecular marker primer pairs can be selected to make a kit that can be used to identify the yield traits of pea materials. Furthermore, the kit can be used to identify or assist in identifying the genotype of pea. The specific identification method can be:
[0023] (1) extracting the genomic DNA of the pea to be tested;
[0024] (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product;
[0025] (3) The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product is a characteristic band of 160 bp in length as shown in SEQ ID NO. 4, the pea is a low-yield genotype; if the PCR amplification product is a characteristic band of 101 bp in length as shown in SEQ ID NO. 5, the pea is a high-yield genotype. The present invention has the following advantages:
[0026] (1) The molecular markers in the present invention are closely related to the yield traits of pea, and can be applied to molecular marker-assisted breeding of pea yield traits, to screening of high-yield pea germplasm resources, and to genetic improvement of pea.
[0027] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to the breeding practice of pea in a rapid and high-throughput manner. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 The figure shows the genome-wide association analysis results of the dry weight trait of pea, which is a Manhattan plot obtained based on EMMAX software analysis. The red sites shown are the InDel positions associated with the present invention.
[0029] Figure 2 Boxplot of dry weight (DW) for different genotypes at the Vs_Chr1_250303380 locus in a genome-wide association study. 0 / 0 indicates a low-yield genotype at the Vs_Chr1_250303380 locus, while 1 / 1 indicates a high-yield genotype. Dots represent extreme data points, and the values above indicate the P value for the test of difference.
[0030] Figure 3 The sequence differences between the 0 / 0 genotype and the 1 / 1 genotype within the molecular marker Vs_Chr1_250303380 region.
[0031] Figure 4 This is an electrophoresis diagram of molecular markers amplified from some of the pea germplasm resources. The concentration of the agarose gel is 2%. In the figure, M represents DNA marker. DETAILED DESCRIPTION
[0032] The present invention will be described in detail below through specific embodiments. These embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.
[0033] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0035] Example 1 Development of molecular markers related to pea yield
[0036] The present invention uses DW (dry weight, unit g) as an indicator to evaluate the yield traits of pea. The higher the value, the higher the yield of pea. The lower the value, the lower the yield of pea. After measuring DW of pea population, through GWAS analysis, an InDel site was located in pea ( Figure 1The red locus is named Vs_Chr1_250303380. This locus is located at position 250303380 on chromosome 1 of the reference genome of the pea (download link: http: / / dx.doi.org / 10.5524 / 100954). The first insertion InDel allele is 0 / 0, and the second deletion InDel allele is 1 / 1. DW distribution box plot of different genotypes at the Vs_Chr1_250303380 locus in the pea population ( Figure 2 ), indicating that the dry weight of the 1 / 1 genotype of the pea is significantly higher than that of the 0 / 0 genotype. At the 250303380th site on chromosome 1 of the pea, the insertion / deletion fragment is AAATCAAAACCAAATTCAAGAATCTTTCAAAAATTTAGAGACAAATGTTTTTGAATTTC (shown in SEQ ID NO. 3) ( Figure 3 ), the 0 / 0 type has the inserted fragment of SEQ ID NO.3, while the 1 / 1 type lacks the inserted fragment of SEQ ID NO.3.
[0037] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Primer 5.0 software:
[0038] Vs_Chr1_250303380-F: GTGGAGAAAGAAAGAGGTAGA (shown in SEQ ID NO.1);
[0039] Vs_Chr1_250303380-R: CATGTTTCTGAAAACCCATT (shown in SEQ ID NO. 2).
[0040] Then, the primers were used to perform PCR amplification on the samples to be tested. The results showed that the PCR product of the low-yield sagittia pea sample had a characteristic band of 160 bp, and the PCR product of the high-yield sagittia pea sample had a characteristic band of 101 bp.
[0041] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention
[0042] 222 germplasms were identified, and the specific germplasm materials used are shown in Table 2:
[0043] Table 2 Dry weight index of 222 pea germplasm materials and genotype corresponding to Vs_Chr1_250303380 locus
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050] Note: In the table, genotype . / . represents missing genotype.
[0051] 1) using the genomic DNA of the pea to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;
[0052] The PCR amplification reaction system is as follows: 10-100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 5 μL of 2× TaqPCR Master Mix, and deionized water to 10 μL. The PCR amplification reaction procedure is preferably as follows: pre-denaturation at 98°C for 30 s, followed by 35 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 5 s, followed by extension at 72°C for 5 min, and storage at 4°C. Separation is performed by electrophoresis on a 2% agarose gel. After spotting, electrophoresis is performed at 140 V DC for 1 h, and the PCR banding pattern of each sample is read.
[0053] 2) Determining the genotype of the pea genotype based on the size of the PCR product: when the PCR product of the pea genotype to be identified contains the fragment shown in SEQ ID NO. 3, the pea genotype to be identified is 0 / 0; when the PCR product of the pea genotype to be identified lacks the fragment shown in SEQ ID NO. 3, the pea genotype to be identified is 1 / 1;
[0054] Specifically, when the PCR product of the to-be-identified pea contains the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 160 bp (SEQ ID NO.4), the to-be-identified pea is of the 0 / 0 type.
[0055] The sequence of SEQ ID NO.4 is as follows:
[0056]
[0057] When the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the to-be-identified pea, the length of the PCR product band is 101 bp (SEQ ID NO. 5), and the to-be-identified pea is of type 1 / 1.
[0058] The sequence of SEQ ID NO.5 is as follows:
[0059]
[0060] Analysis of the 222 accessions of pea (Table 2) revealed that, excluding six accessions with genotype deletions, 63 accessions had a 0 / 0 genotype at the Vs_Chr1_250303380 locus, with an average DW of 16.93946154 g, indicating low-yielding pea varieties. Meanwhile, 153 accessions had a 1 / 1 genotype at the Vs_Chr1_250303380 locus, with an average DW of 21.05821429 g, indicating high-yielding pea varieties. Analysis of variance revealed significant differences in DW between high-yielding and low-yielding pea varieties (P < 0.01).
[0061] 24 accessions (accessions numbers 64, 65, 470, 17, 270, 67, 79, 200, 303, 302, 467, 62, 109, 164, 172, 202, 208, 235, 33, 409, 429, 447, 461, 527) from the 222 accessions of Vitis vinifera listed in Table 3 were selected for verification. Figure 4 As can be seen, 12 samples of pea cultivars amplified a 101bp characteristic band, indicating the 1 / 1 type. Statistical analysis showed that the average DW of these 12 samples was 21.36583333 g. Another 12 samples of pea cultivars amplified a 160bp characteristic band, indicating the 0 / 0 type. Statistical analysis showed that the average DW of these 12 0 / 0 cultivars was 8.255 g, lower than the average DW of the 12 1 / 1 cultivars. Analysis of variance showed that the DW of the 0 / 0 and 1 / 1 types differed significantly (P < 0.01). The 1 / 1 cultivars cultivars genotyped by PCR detection results were expected to be high-yield materials, and the actual results were essentially consistent with expectations. Therefore, the InDel molecular markers of the present invention can effectively identify the yield traits of pea cultivars and can be used to predict and screen high-yield cultivars.
[0062] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.
Claims
1. The InDel molecular marker Vs_Chr1_250303380 related to the yield trait of pea, characterized in that: The nucleotide sequence of the InDel molecular marker Vs_Chr1_250303380 is shown in SEQ ID NO.4 or SEQ ID NO.5, and the nucleotide sequence of the insertion / deletion fragment thereof is shown in SEQ ID NO.
3.
2. Use of the primer pair for amplifying the InDel molecular marker according to claim 1 in assisted breeding of pea, characterized in that: The invention is used for identifying or assisting in identifying the yield trait of pea stalks, specifically: using primers Vs_Chr1_250303380-F and Vs_Chr1_250303380-R to perform PCR amplification on the pea stalk genomic DNA to be tested; if the PCR amplification product is a characteristic band with a length of 160 bp as shown in SEQ ID NO.4, the pea stalks are of low-yield type; if the PCR amplification product is a characteristic band with a length of 101 bp as shown in SEQ ID NO.5, the pea stalks are of high-yield type; the primer pair sequence is: Vs_Chr1_250303380-F:GTGGAGAAAGAAAGAGGTAGA; Vs_Chr1_250303380-R:CATGTTTCTGAAAACCCATT.
3. A method for identifying the yield characteristics of pea, characterized in that: The method comprises the following steps: (1) Extracting the genomic DNA of the pea to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair described in claim 2, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determine based on the electrophoresis bands and / or sequencing results of step (2). The specific criteria are: The genomic DNA of the tested pea was PCR amplified using primers Vs_Chr1_250303380-F and Vs_Chr1_250303380-R. If the PCR amplification product was a characteristic band of 160 bp in length as shown in SEQ ID NO.4, the pea was a low-yield type; if the PCR amplification product was a characteristic band of 101 bp in length as shown in SEQ ID NO.5, the pea was a high-yield type.
4. Use of a kit comprising the primer pair described in claim 2 in identifying yield genotypes of pea.
5. The use according to claim 4, characterized in that The method for identifying the yield genotype of pea using the kit is as follows: (1) Extracting the genomic DNA of the pea to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair described in claim 2, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product is a characteristic band of 160 bp in length as shown in SEQ ID NO.4, the pea is a low-yield genotype; if the PCR amplification product is a characteristic band of 101 bp in length as shown in SEQ ID NO.5, the pea is a high-yield genotype.
Citation Information
Patent Citations
Molecular marker VsChr2184572096 closely linked with drought resistance of vicia sativa and application of molecular marker VsChr2184572096
CN118186133A
Molecular marker located in chromosome 1 and related to crack resistance character of vicia sativa and application of molecular marker
CN118308525A