Use of pok red marrow oncogenic factor zbtb7a in anti-hepatitis b virus

Abstract

This invention discloses the application of the POK erythroid myeloid oncogenic factor ZBTB7A in the treatment of hepatitis B virus (HBV). Experimental verification demonstrates that overexpression of ZBTB7A significantly reduces the level of secreted HBV-related viral proteins and significantly inhibits HBV transcription and replication, providing a new potential target for the treatment of hepatitis B. This study suggests that ZBTB7A can serve as a novel HBV host restriction factor, laying the foundation for the development of novel antiviral drugs and providing more effective treatment options for clinical practice, demonstrating broad application prospects and market potential.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of POK erythroid myeloid carcinogenic factor ZBTB7A in the treatment of hepatitis B virus. Background Technology

[0002] Hepatitis B virus (HBV) infection is a common chronic viral infection that can progress to severe end-stage liver diseases such as cirrhosis and hepatocellular carcinoma. HBV is a hepatotropic DNA virus. Mature HBV particles consist of a nucleocapsid composed of the hepatitis B core antigen (HBcAg), viral polymerase, and relaxed circular DNA (rcDNA), surrounded by the HBV surface antigen (HBsAg). After HBV invades hepatocytes, rcDNA is repaired into cccDNA, which serves as a template for transcription into four different HBV mRNAs, encoding the HBV core antigen (HBcAg), surface antigen (HBsAg), and e antigen (HBeAg), as well as the polymerase (P) involved in viral replication. HBV then replicates continuously within hepatocytes. Currently, clinical antiviral treatment for HBV mainly relies on nucleotide analogs and pegylated interferon-alpha, but achieving a functional cure is difficult. Therefore, finding new therapeutic targets for HBV infection is of great practical significance.

[0003] ZBTB7A (Zinc finger and BTB domain-containing protein 7A), also known as POK erythroid myelogenic oncogen, is a member of the POK transcriptional repressor family. The protein encoded by ZBTB7A contains an N-terminal BTB / POZ domain and a C-terminal zinc finger domain. The C-terminal zinc finger structure of this protein can specifically recognize and bind to DNA sequences in gene regulatory regions. On the other hand, the N-terminal BTB / POZ domain is a protein-protein interaction functional region, which can recruit various other auxiliary transcriptional repressors to form a transcriptional repression complex, thereby exerting a transcriptional repression effect. Currently, there are few studies on the relationship between ZBTB7A and viral infection. Previous literature reported that ZBTB7A can regulate the transcription of human immunodeficiency virus (HIV). However, there are currently no reports on the relationship between ZBTB7A and HBV infection or replication. Summary of the Invention

[0004] The purpose of this invention is to address the above-mentioned problems by providing an application of POK erythroid myeloid carcinogenic factor ZBTB7A in the treatment of hepatitis B virus.

[0005] To achieve its objective, the present invention employs the following technical solution:

[0006] The first aspect of the present invention provides the application of ZBTB7A in any of the following:

[0007] (1) Application of ZBTB7A as a drug target in screening or preparing drugs against hepatitis B virus;

[0008] (2) Application of ZBTB7A as a drug target in screening or preparing drugs for treating diseases related to hepatitis B virus infection;

[0009] (3) Application of ZBTB7A in the preparation of drugs for treating hepatitis B virus infection or diseases related to hepatitis B virus infection;

[0010] (4) Application of ZBTB7A as a host restriction factor for hepatitis B virus;

[0011] The diseases associated with hepatitis B virus infection include hepatitis B, cirrhosis, and liver cancer.

[0012] In the above-mentioned application technology solutions, the drug is selected from one of the following: a drug that uses ZBTB7A protein, its encoding gene, or biological material containing its encoding gene as an active ingredient; a drug for overexpressing intrahepatic ZBTB7A or increasing the intrahepatic ZBTB7A expression level.

[0013] In the above-mentioned application technology solution, the biological material includes a recombinant vector containing the ZBTB7A gene and a recombinant cell line.

[0014] A second aspect of the invention provides the use of a substance targeting ZBTB7A in the preparation of a medicament for treating hepatitis B virus infection or for treating diseases associated with hepatitis B virus infection.

[0015] In any of the above-mentioned application techniques, the drug reduces the secretion of HBsAg and HBeAg, reduces the levels of HBcAg, HBV total RNA and pgRNA, and inhibits HBV transcription and replication.

[0016] In any of the above-mentioned application techniques, the drug promotes the expression of ZBTB7A.

[0017] A third aspect of the present invention provides a drug inhibitor for hepatitis B virus, wherein the active ingredient of the drug inhibitor comprises ZBTB7A protein, or its encoding gene, or biological material containing its encoding gene.

[0018] In the aforementioned drug inhibitor, the biological material is a recombinant plasmid expressing ZBTB7A, which is obtained by inserting the gene encoding the ZBTB7A protein into an expression vector.

[0019] The aforementioned drug inhibitor, wherein ZBTB7A is human ZBTB7A, whose coding sequence is shown in SEQ ID NO.1.

[0020] Preferably, the drug inhibitor further includes a pharmaceutically acceptable carrier.

[0021] The beneficial effects of this invention are: This invention experimentally verifies that overexpression of ZBTB7A can significantly reduce the level of secreted HBV-related viral proteins and significantly inhibit HBV transcription and replication, providing a new potential target for the treatment of hepatitis B. ZBTB7A can serve as a new HBV host restriction factor, laying the foundation for the development of novel antiviral drugs and providing more effective treatment options for clinical treatment, with broad application prospects and market potential. Attached Figure Description

[0022] Figure 1 This presents the statistical results of a study on the effect of ZBTB7A overexpression on HBV replication in HBV-transfected Huh7 cells. A: Effect of ZBTB7A overexpression on the level of HBV core antigen (HBcAg) in Huh7 cells; BC: Effect of ZBTB7A overexpression on the secretion of HBsAg and HBeAg by Huh7 cells; D: Effect of ZBTB7A overexpression on the levels of total HBV RNA and pgRNA in Huh7 cells; E: Effect of ZBTB7A overexpression on the level of HBV DNA in Huh7 cells.

[0023] Figure 2 This presents the statistical results of a study on the effect of ZBTB7A overexpression on HBV replication in HBV-infected HepG2-NTCP cells. A: Effect of ZBTB7A overexpression on HBcAg levels in HepG2-NTCP cells; BC: Effect of ZBTB7A overexpression on HBsAg and HBeAg secretion in HepG2-NTCP cells; D: Effect of ZBTB7A overexpression on HBV total RNA and pgRNA levels in HepG2-NTCP cells; E: Effect of ZBTB7A overexpression on HBV DNA levels in HepG2-NTCP cells.

[0024] Figure 3This presents the experimental results on the effect of ZBTB7A overexpression on HBV replication in a chronic HBV replication mouse model. Specifically: A: Male C57BL / 6J mice were transiently injected into the liver via high-pressure tail vein into plasmids pAAV-HBV1.2 and Flag-ZBTB7A or the empty vector pReceiver-M14 to establish a chronic HBV replication mouse model; B: Serum samples were collected from mice at 1, 4, 7, 14, and 21 days after plasmid injection to detect the effect of ZBTB7A overexpression on serum HBsAg and HBeAg levels at different time points; C: Liver tissue was collected on days 7 and 21 after injection for immunohistochemical analysis to count HBcAg-positive hepatocytes; D: Total RNA was isolated and extracted from liver tissue on day 21, and the effect of ZBTB7A overexpression on HBV RNA levels in mouse liver tissue was detected; E: Viral nucleic acid encapsulated in the nucleocapsid was isolated and extracted from liver tissue on day 21, and the effect of ZBTB7A overexpression on HBV DNA levels in mouse liver tissue was detected. Detailed Implementation

[0025] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

[0026] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0027] Example 1

[0028] 1. Experimental Materials and Reagents

[0029] 1.1 Experimental Materials

[0030] Human hepatocellular carcinoma Huh7 cells and HepG2-NTCP cells, pHBV1.3 plasmid (containing 1.3 copies of the HBV genome, Genbank accession NO. AY220698.1) and its empty vector control pUC19, Flag-ZBTB7A plasmid (expressing the human ZBTB7A gene transcript NM_001317990.2) and its empty vector control pReceiver-M14 were purchased from Yijin Biotechnology (China) Co., Ltd.

[0031] 1.2 Experimental Reagents

[0032] 1.2.1 Preparation of main reagents

[0033] (1) 10× electrophoresis solution (1L)

[0034]

[0035] (2) 10× transfer buffer (1L)

[0036]

[0037]

[0038] (3) 5% milk blocking solution (40mL)

[0039]

[0040] (4) 10×TBS(1L)

[0041]

[0042] 1.2.2 Main Reagent Sources

[0043]

[0044]

[0045] 1.2.3 Primer Sequence

[0046]

[0047] The human ZBTB7A gene sequence is shown below (SEQ ID NO.1):

[0048] ATGGCCGGCGGCGTGGACGGCCCCATCGGGATCCCGTTCCCCGACCACAGCAGCGACATCCTGA

[0049] GTGGGCTGAACGAGCAGCGGACGCAGGGCCTGCTGTGCGACGTGGTGATCCTGGTGGAGGGCC

[0050] GCGAGTTCCCCACGCACCGCTCGGTGCTGGCCGCCTGCAGCCAGTACTTCAAGAAGCTGTTCAC

[0051] GTCGGGCGCCGTGGTGGACCAGCAGAACGTGTACGAGATCGACTTCGTCAGCGCCGAGGCGCTC

[0052] ACCGCGCTCATGGACTTCGCCTACACGGGCCACGCTCACCGTCAGCACAGCCAACGTGGGTGACA

[0053] TCCTCAGCGCCGCCCGCCTGCTGGAGATCCCCGCCGTGAGCCACGTGTGCGCCGACCTCCTGGA

[0054] CCGGCAGATCCTGGCGGCCGACGCGGGCGCCGACGCCGGGCAGCTGGACCTTGTAGATCAAATT

[0055] GATCAGCGCAACCTCCTCCGCGCCAAGGAGTACCTCGAGTTCTTCCAGAGCAACCCCATGAACA

[0056] GCCTGCCCCCCGCGGCCGCCGCCGCCGCTGCCAGCTTCCCGTGGTCCGCCTTTGGGGCGTCCGAT

[0057] GATGACCTGGATGCCACCAAGGAGGCCGTGGCCGCCGCTGTGGCCGCCGTGGCCGCGGGCGACT

[0058] GCAACGGCTTAGACTTCTATGGGCCGGGCCCCCCGGCCGAGCGGCCCCCGACGGGGGACGGGG

[0059] ACGAGGGCGACAGCAACCCGGGTCTGTGGCCAGAGCGGGATGAGGACGCCCCCACCGGGGGTC

[0060] TCTTTCCGCCGCCGGTGGCCCCGCCGGCCGCCACGCAGAACGGCCACTACGGCCGCGGCGGAGA

[0061] GGAGGAGGCCGCCTCGCTGTCGGAGGCGGCCCCCGAGCCGGGCGACTCTCCGGGCTTCCTGTCG

[0062] GGAGCGGCCGAGGGCGAGGACGGGGACGGGCCCGACGTGGACGGGCTGGCGGCCAGCACGCT

[0063] GCTGCAGCAGATGATGTCATCGGTGGGCCGGGCGGGGGCCGCGGCGGGGGACAGCGACGAGGA

[0064] GTCGCGGGCCGACGACAAGGGCGTCATGGACTACTACCTGAAGTACTTCAGCGGCGCCCACGAC

[0065] GGCGACGTCTACCCGGCCTGGTCGCAGAAGGTGGAGAAGAAGATCCGAGCCAAGGCCTTCCAG

[0066] AAGTGCCCCATCTGCGAGAAGGTCATCCAGGGCGCCGGCAAGCTGCCGCGACACATCCGCACCC

[0067] ACACGGGCGAGAAGCCCTACGAGTGCAACATCTGCAAGGTCCGCTTCACCAGGCAGGACAAGC

[0068] TGAAGGTGCACATGCGGAAGCACACGGGCGAGAAGCCGTACCTGTGCCAGCAGTGCGGCGCCG

[0069] CCTTTGCCCACAACTACGACCTGAAGAACCACATGCGCGTGCACACGGGCCTGCGCCCCTACCA

[0070] GTGCGACAGCTGCTGCAAGACCTTCGTCCGCTCCGACCACCTGCACAGACACCTCAAGAAAGAC

[0071] GGCTGCAACGGCGTCCCCTCGCGCCGCGGCCGCAAGCCCCGCGTCCGGGGCGGGGCGCCCGAC

[0072] CCCAGCCCGGGGGCCACCGCGACCCCCGGCGCCCCCGCCCAGCCCAGCTCCCCCGACGCCCGGC

[0073] GCAACGGCCAGGAGAAGCACTTTAAGGACGAGGACGAGGACGAGGACGTGGCCAGCCCCGAC

[0074] GGCTTGGGCCGGTTGAATGTAGCGGGCGCCGGTGGAGGAGGTGACAGCGGAGGTGGCCCCGGGGCCGCCACCGACGGTAACTTCACAGCCGGACTCGCCTAA。

[0075] 2 Experimental methods

[0076] 2.1 ELISA for detecting the level of HBV secreted protein in the supernatant

[0077] 2.1.1 ELISA detection of HBsAg levels in supernatant

[0078] (1) Equilibrate the kit to room temperature and prepare the samples to be tested in advance;

[0079] (2) Sample addition: Dilute the cell supernatant according to the cell type, mix well and add 75 μL of sample to each well, and set up negative control, positive control and blank control;

[0080] (3) Incubation: Seal the plate, mix well, and then incubate in a 37℃ constant temperature incubator for 1 hour;

[0081] (4) Enzyme conjugate: Add 50 μL of enzyme conjugate to each well, seal the plate, mix well, and incubate in a 37°C constant temperature incubator for 30 min.

[0082] (5) Washing the plate: Prepare the washing solution (the concentrated washing solution is diluted with ddH2O), remove the sealing film, discard the liquid, pat dry, add the washing solution, let stand for 30 seconds and then discard, repeat this washing process 5 times and then pat dry.

[0083] (6) Color development: Add 50 μL of color developer A and color developer B to each well and incubate at 37°C;

[0084] (7) Termination: Add 50 μL of stop solution to each well, mix well, and measure the absorbance using an ELISA reader (wavelength 450 nm). Record the detection data.

[0085] 2.1.2 ELISA detection of HBeAg levels in supernatant

[0086] (1) Equilibrate the kit to room temperature and prepare the samples to be tested in advance;

[0087] (2) Sample addition: Dilute the cell supernatant according to the cell type, mix well and add 50 μL of sample to each well, and set up negative control, positive control and blank control;

[0088] (3) Enzyme conjugate: Add 50 μL of enzyme conjugate to each well, seal the plate, mix well, and incubate in a 37°C constant temperature incubator for 30 min.

[0089] (4) Washing the plate: Prepare the washing solution (the concentrated washing solution is diluted with ddH2O), remove the sealing film, discard the liquid, pat dry, add the washing solution, let stand for 30 seconds and then discard, repeat this washing process 5 times and then pat dry.

[0090] (5) Color development: Add 50 μL of color developer A and color developer B to each well and incubate at 37°C;

[0091] (6) Termination: Add 50 μL of stop solution to each well, mix well, and measure the absorbance using an ELISA reader (wavelength 450 nm). Record the detection data.

[0092] 2.2 Western blot assay to detect intracellular HBV protein levels

[0093] 2.2.1 Cell lysis

[0094] (1) Collect the cell supernatant and wash once with PBS;

[0095] (2) Add RIPA protein lysis buffer to each well of a 12-well plate, 120 μL, and place on ice and shake to lyse for 30 min.

[0096] (3) Transfer the lysis buffer to a 1.5 mL EP tube and centrifuge at 4 °C, 12000 rpm, for 2 min;

[0097] 2.2.2 BCA method for detecting protein concentration

[0098] (1) Prepare protein standards: Prepare standards according to the instructions, mix well and centrifuge briefly to a final concentration of 0.5 μg / μL; (2) Prepare BCA working solution: A volume: B volume = 50:1, prepare 200 μL per blank;

[0099] (3) In a 96-well plate, add 1 μL, 2 μL, 4 μL, 8 μL and 16 μL of protein standard to the blank wells in sequence, and make up to 20 μL with PBS. In addition, each sample is diluted 5 times with PBS, that is, 5 μL of the sample to be tested plus 20 μL of PBS, and mix thoroughly.

[0100] (4) Color development: After adding the standard and the sample to be tested, add 200 μL BCA working solution to each well and incubate in a 37℃ constant temperature incubator for 30 min;

[0101] (5) Detection: The absorbance was measured using an ELISA reader (wavelength 562nm), and the detection data was recorded;

[0102] (6) Plotting the standard curve: Plot the standard curve using the absorbance and concentration of the standard, calculate the concentration of the sample based on the standard curve, and adjust the concentration accordingly.

[0103] 2.2.3 Western blot assay to detect the expression level of the target protein

[0104] (1) Protein denaturation: Add 5×SDS-PAGE protein loading buffer to the protein sample with the adjusted concentration by volume, place it in a 95℃ metal bath for 10 minutes, and then place it on ice for 10 minutes;

[0105] (2) Gel preparation: Clean the gel preparation glass plate, align the glass plates and clamp them together. Select 10%, 12% or 15% separating gel and 5% stacking gel according to the size of the target protein molecules. Use it after it has completely solidified.

[0106] (3) Sample loading: Place the gel into the electrophoresis tank, add 1× electrophoresis solution to the appropriate position, pull out the comb vertically, and add the corresponding protein sample;

[0107] (4) Electrophoresis: 80V electrophoresis for 30 minutes, followed by 120V electrophoresis for 1-1.5 hours;

[0108] (5) Transfer: After electrophoresis, cut the gel according to the molecular weight of the target protein. Then place the transfer clamp with the black side down, and place the sponge pad, thick filter paper, gel block, PVDF membrane, thick filter paper, and sponge pad in sequence. After closing the transfer clamp, place it in the transfer instrument and maintain a constant current of 250mA for 90min.

[0109] (6) Blocking: After the transfer is completed, wash the membrane with 1×TBST for 5 minutes, add 5% milk blocking solution, and block at room temperature for one hour;

[0110] (7) Primary antibody incubation: After blocking, wash the membrane 3 times with 1×TBST for 5 minutes each time, cut the bands according to the target protein and add the primary antibody for incubation, and incubate overnight at 4°C;

[0111] (8) Washing the membrane: Wash the membrane 3 times with 1×TBST, 5 minutes each time;

[0112] (9) Secondary antibody incubation: Add the corresponding secondary antibody according to the properties of the primary antibody and incubate at room temperature for 1 hour;

[0113] (10) Washing the membrane: Wash the membrane 3 times with 1×TBST, 5 minutes each time;

[0114] (11) Development: Add an appropriate amount of ECL developer drop onto the membrane, expose it using the Bio-Rad gel imaging system and save the data.

[0115] 2.3 Intracellular HBV RNA Detection

[0116] 2.3.1 Cell RNA Extraction

[0117] (1) Collect cell supernatant and wash cells with PBS.

[0118] (2) Add 1 mL of Trizol reagent to each well of a 6-well plate, lyse on ice for 5 min, and collect the cell lysate into a 1.5 mL EP tube.

[0119] (3) Add 100 μL of chloroform and shake vigorously for 15 seconds.

[0120] (4) Incubate at room temperature for 2-3 minutes, then centrifuge at 12000g for 15 minutes at 4℃.

[0121] (5) Transfer the aqueous phase (upper layer, about 50% of the total volume) to a new 1.5 mL EP tube, add 250 μL of isopropanol, mix well, incubate at room temperature for 10 min, and centrifuge at 12000 g for 10 min at 4 °C.

[0122] (6) Discard the supernatant and add 100 μL of 75% ethanol to wash the RNA precipitate twice.

[0123] (7) Centrifuge at 7500g for 5 minutes at 4℃, remove the supernatant, and let the precipitate air dry.

[0124] (8) Add 15 μL DEPC water to dissolve the precipitate and mix the sample.

[0125] 2.3.2 Real-time quantitative reverse transcription PCR (Realtime RT-qPCR) detection of HBV RNA levels

[0126] (1) Sample dilution: Dilute the extracted RNA template to 100 ng / μL.

[0127] (2) Preparation of RT-PCR reaction system:

[0128]

[0129] (3) PCR reaction conditions

[0130]

[0131] (4) Results calculation and analysis: Statistical analysis and calculation were performed based on the results of Realtime RT-qPCR.

[0132] 2.4 Intracellular HBV DNA Detection

[0133] 2.4.1 Extraction of intracellular HBV EcDNA (encapsidated DNA)

[0134] (1) Collect the cell supernatant and wash it once with PBS.

[0135] (2) Add 800 μL of lysis buffer to each well of a 6-well plate and place it on ice for 10 min to lyse.

[0136] (3) Collect the cell lysate into a 2 mL EP tube (spread it with a pipette tip), place it on a vortex mixer and vortex for 15 s, then incubate on ice for 10 min.

[0137] (4) Centrifuge at 13200 rpm for 2 min in a 4℃ centrifuge.

[0138] (5) Transfer the supernatant to a new 2mL EP tube, add 8μL MgCl2 (1M) and 8μL LDNase I (10mg / mL), invert and mix 3-4 times, then centrifuge and incubate in a 37℃ water bath for 30min.

[0139] (6) After incubation, add 40 μL of 0.5 M EDTA (pH 8.0) and mix by inverting.

[0140] (7) Centrifuge the sample quickly, add 80 μL of 10% SDS, and vortex to mix.

[0141] (8) Centrifuge the sample quickly and add 20 μL of proteinase K (20 mg / mL).

[0142] (9) Incubate in a water bath at 55°C for 2 hours, mixing the sample thoroughly during incubation.

[0143] (10) Add 900 μL of DNA extraction reagent at a ratio of 1:1 between the supernatant and the DNA extraction liquid, vortex and let stand for 2 min, then centrifuge at 13000 rpm for 10 min at room temperature.

[0144] (11) Pipette the supernatant into a new 2mL EP tube, add 0.7 times the volume of isopropanol, 100μL of 3M sodium acetate (pH5.2), and 2μL of yeast RNA, and place in a -20℃ refrigerator to precipitate overnight.

[0145] (12) After centrifuging at 13200 rpm for 15 min at 4℃, discard the supernatant, add 1 mL of 75% ethanol to gently wash the precipitate twice, and then centrifuge at 8000 rpm for 5 min at room temperature.

[0146] (13) Discard the supernatant and let the DNA precipitate air dry for 5 minutes.

[0147] (14) Add 15 μL of 1×TE buffer to dissolve the extracted DNA precipitate and mix the sample.

[0148] 2.4.2 Quantitative PCR (qPCR) detection of HBV DNA levels

[0149] (1) Sample dilution: Prepare 200 μL EP tubes, then add 8 μL 1×TE buffer and 2 μL HBV DNA sample; (2) Preparation of standards: Prepare new 1.5 mL EP tubes, add 45 μL sterile ddH2O to each tube, and aspirate 5 μL of standard (10 9 Add copies / μL) to the first EP tube, vortex to mix, and repeat the operation, serially diluting to 10^10. 3-10 8 Copies / μL concentration gradient;

[0150] (3) Preparation of PCR reaction system

[0151]

[0152] (4) PCR reaction conditions

[0153]

[0154] (5) PCR result calculation: Calculate the sample copy number according to the standard curve and the corresponding dilution factor.

[0155] 2.5 Chronic HBV Replication Mouse Model

[0156] 2.5.1 Construction of a chronic HBV replication mouse model

[0157] (1) Preparation of laboratory animals: All animal experiments were approved by the Ethics Committee of Chongqing Medical University (Ethics No. 2022081). This study was conducted strictly in accordance with the recommendations in the "Guidelines for the Care and Use of Laboratory Animals" and the regulations of the People's Republic of China.

[0158] (2) Grouping: The purchased C57BL / 6J male mice were weighed, and mice weighing approximately 20g were selected for the experiment. The mice were first randomly divided into two groups: the ZBTB7A overexpression experimental group and the pReceiver-M14 control group;

[0159] (3) High-pressure tail vein injection: The constructed pAAV-HBV1.2 plasmid and Flag-ZBTB7A overexpression plasmid or pReceiver-M14 empty vector plasmid were diluted with physiological saline and injected into each mouse with 2 ml of plasmid dilution solution (containing 10 μg pAAV-HBV1.2 plasmid and 10 μg Flag-ZBTB7A plasmid or pReceiver-M14 empty vector control) via high-pressure tail vein injection to establish a chronic HBV replication mouse model overexpressing the ZBTB7A gene;

[0160] (4) Orbital blood collection: Mouse serum was collected on days 1, 4, 7, 14 and 21 after injection. Liver samples were collected from mice at the specified time points;

[0161] (5) Sample preservation: Mouse serum was centrifuged at 8000 rpm for 10 min at room temperature, the supernatant was collected and stored in a -20℃ freezer; in addition, liver tissue samples were preserved with 4% tissue cell fixative (immunohistochemical detection of HBcAg expression in the liver), and the remaining mouse liver tissue was stored in a -80℃ freezer for later use.

[0162] 2.5.2 Extraction of HBV RNA from Hepatocytes

[0163] Total RNA was extracted from mouse liver tissue using the RNAprep Pure Animal Tissue Total RNA Extraction Kit (centrifuge column type) (Tiangen Biotech, DP431).

[0164] 2.5.3 Extraction of HBV DNA from Hepatocytes

[0165] (1) Accurately weigh 60mg of liver tissue, add 600μL of pre-cooled 1×TE buffer (pH8.0) and grind thoroughly;

[0166] (2) Add 5 μL of NP-40 (final concentration 0.5%) and incubate on ice for 30 min;

[0167] (3) Centrifuge at 14000 rpm for 1 min at 4℃, transfer the supernatant to a new 2 mL EP tube, add 5 μL of 1 M MgCl2 (final concentration 5 mM) and 8 μL of 10 mg / mL DNase I, and incubate at 37℃ for 30 min.

[0168] (4) Add 20 μL of 0.5 M EDTA (final concentration 10 mM);

[0169] (5) Add 100 μL of 10% SDS (final concentration 1%) and 30 μL of 20 mg / mL Proteinase K (final concentration 0.5 mg / mL), and incubate at 55 °C for 2 h;

[0170] (6) Add an equal volume of phenol / chloroform (500 μL: 500 μL, 1:1) and vortex to mix. Centrifuge at 14,000 rpm for 8 min at room temperature;

[0171] (7) Transfer the supernatant to a new 2 mL EP tube, then add 700 μL isopropanol, 100 μL 3M NaAc (pH 5.2) and 2 μL tRNA (10 mg / mL), and place in a -20°C freezer to precipitate overnight;

[0172] (8) After the sample is taken out of the refrigerator, it is centrifuged at 14,000 rpm for 15 min at 4℃ and the supernatant is discarded.

[0173] (9) Add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 14000 rpm at 4℃ for 5 min, and wash twice;

[0174] (10) Discard the supernatant, then let it air dry for 5 minutes, and finally dissolve the precipitate with 15 μL 1×TE buffer.

[0175] 2.5.4 Immunohistochemical staining (Wuhan Sewell Biotechnology)

[0176] (1) Dewaxing paraffin sections to water: Place the sections in dewaxing solution I, dewaxing solution II and dewaxing solution III in sequence for 10 min, then place them in anhydrous ethanol I (5 min), anhydrous ethanol II (5 min) and anhydrous ethanol III (5 min) in sequence, and wash with distilled water.

[0177] (2) Antigen retrieval: After natural cooling, place the slide in PBS and wash it three times on a decolorizing shaker for 5 minutes each time;

[0178] (3) Blocking endogenous peroxidase: Incubate the slide in 3% hydrogen peroxide solution in the dark for 25 min, then decolorize it in PBS, and wash it 3 times on a shaker for 5 min each time;

[0179] (4) Covering: Cover the tissue slide with 3% BSA and seal at room temperature for 30 min;

[0180] (5) Primary antibody incubation: Drain the blocking solution, add the prepared primary antibody to the slide, and incubate the slide in a humidified chamber at 4°C overnight;

[0181] (6) Secondary antibody incubation: Wash the slide in PBS, wash it 3 times on a shaker for 5 min each time, then add the secondary antibody (HRP-labeled) of the same species as the primary antibody and incubate at room temperature for 50 min;

[0182] (7) DAB staining: Wash the slides three times in PBS for 5 minutes each time. Add freshly prepared DAB staining solution and control the staining time under a microscope. The positive result is brownish-yellow. Rinse the slides with tap water to stop the staining process.

[0183] (8) Counterstaining cell nuclei: Counterstain with hematoxylin for about 3 minutes, rinse with tap water, differentiate with hematoxylin differentiation solution for a few seconds, rinse with tap water, re-blue with hematoxylin blue solution, and rinse with running water.

[0184] (9) Dehydration and mounting: Place the slides in 75% alcohol for 5 min, 85% alcohol for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, n-butanol for 5 min, and xylene I for 5 min to dehydrate and become transparent. Remove the slides from the xylene and let them dry slightly. Then mount them with mounting glue.

[0185] 3 Experimental Results

[0186] 3.1 Study on the effect of ZBTB7A overexpression on HBV replication in HBV-transfected Huh7 cells.

[0187] Huh7 cells were co-transfected with 1 μg of HBV expression plasmid pHBV1.3 and 1 μg of Flag-ZBTB7A plasmid or its empty vector control pReceiver-M14.

[0188] 72 hours after transfection, the expression level of total HBcAg in cell lysates was detected by Western blot using anti-HBc (a gift from Professor Cai Xuefei of Chongqing Medical University); the experimental results are as follows. Figure 1 As shown in Figure A, overexpression of ZBTB7A significantly reduced intracellular HBcAg levels. Cell supernatants were collected and the levels of secreted HBsAg and HBeAg in the cell supernatants were detected using a hepatitis B surface antigen (HBsAg) diagnostic kit (ELISA; Shanghai Kehua, SI0910113) and a hepatitis B e antigen (HBeAg) diagnostic kit. The experimental results are as follows: Figure 1 B and Figure 1 As shown in Figure C, overexpression of ZBTB7A significantly inhibited the secretion of HBsAg and HBeAg. The effect of ZBTB7A overexpression on the levels of total HBV RNA and pgRNA in cells was detected by Real-time RT-qPCR (TaKaRa, RR086A). The experimental results are shown below. Figure 1 As shown in Figure D, overexpression of ZBTB7A significantly reduced the levels of total HBV RNA and pgRNA in cells. The effect of ZBTB7A overexpression on intracellular HBV DNA levels was detected using Real-time qPCR (TaKaRa, RR820A). The experimental results are shown below. Figure 1 As shown in Figure E, overexpression of ZBTB7A significantly reduced intracellular HBV DNA levels. These experimental results indicate that ZBTB7A can significantly inhibit HBV transcription and replication in HBV-transfected cell systems. 3.2 Study on the effect of ZBTB7A overexpression on HBV replication levels in HBV-infected HepG2-NTCP cells.

[0189] Two days prior to HBV infection, doxycycline-pretreated HepG2-Tet On-NTCP cells were seeded in type I collagen-treated 12-well cell culture plates. One day prior to HBV infection, cells were incubated for 24 hours with 700 μL of William's E complete medium (Procell, PM151221) + 4% PEG8000 + HBV virus suspension (MOI: 1000). Twenty-four hours after HBV infection, cells were transfected with Flag-ZBTB7A plasmid or its empty vector control pReceiver-M14. Four to six hours after transfection, the old medium was replaced with 1 ml of fresh William's E complete medium. Seventy-two hours after HBV infection, cells were washed three times with PBS, and then the old medium was replaced with 1 ml of fresh William's E complete medium.

[0190] On day 5 post-HBV infection, the expression level of total HBcAg in cell lysates was detected by Western blot. The results are as follows: Figure 2 As shown in Figure A, overexpression of ZBTB7A significantly reduced intracellular HBcAg levels. Cell supernatants were collected, and the levels of secreted HBsAg and HBeAg in the cell supernatants were detected using HBsAg and HBeAg diagnostic kits. The experimental results are shown below. Figure 2 B and Figure 2 As shown in Figure C, overexpression of ZBTB7A significantly reduced the levels of secreted HBsAg and HBeAg. The effect of ZBTB7A overexpression on intracellular total HBV RNA and pgRNA levels was detected using Real-time RT-qPCR. The experimental results are shown below. Figure 2 As shown in Figure D, overexpression of ZBTB7A significantly reduced intracellular HBV total RNA and HBV pgRNA levels. The effect of ZBTB7A overexpression on intracellular HBV DNA levels was detected using Real-time qPCR. The experimental results are as follows: Figure 2 As shown in Figure E, overexpression of ZBTB7A significantly reduced intracellular HBV DNA levels. These experimental results indicate that ZBTB7A can significantly inhibit HBV transcription and replication in HBV-infected cell systems.

[0191] 3.3 Study on the effect of ZBTB7A overexpression on HBV replication level in a mouse model of chronic HBV infection.

[0192] Plasmids pAAV-HBV1.2 and Flag-ZBTB7A (n=10 in the experimental group) or empty vector control pReceiver-M14 (n=10 in the control group) were rapidly introduced into 8-week-old male C57BL / 6J mice via high-pressure tail vein injection. Serum samples were collected from mice on days 1, 4, 7, 14 and 21 after plasmid injection, and liver tissue samples were collected from mice on days 7 and 21 after injection.

[0193] like Figure 3 As shown in Figure A, serum samples from mice were collected at 1, 4, 7, 14, and 21 days after plasmid injection, and serum HBsAg and HBeAg levels were detected at each time point using ELISA. The experimental results are as follows: Figure 3 As shown in Figure B, overexpression of ZBTB7A significantly reduced the levels of secreted HBsAg and HBeAg in mouse serum. On days 7 and 21 after plasmid injection, mouse liver tissue was collected for immunohistochemical detection: mouse liver tissue sections were incubated with rabbit anti-HBc antibody and goat anti-rabbit IgG secondary antibody, and HBcAg-positive hepatocytes were counted (magnification 200). The experimental results are as follows... Figure 3As shown in Figure C, overexpression of ZBTB7A significantly reduced HBcAg levels and the number of HBcAg-positive hepatocytes in mouse liver tissue. The effects of ZBTB7A overexpression on total HBV RNA and pgRNA levels in mouse liver tissue were detected using Real-time RT-qPCR. The experimental results are shown below. Figure 3 As shown in Figure D, overexpression of ZBTB7A significantly reduced the levels of total HBV RNA and pgRNA in mouse liver tissue. The effect of ZBTB7A overexpression on HBV DNA levels in mouse liver tissue was detected using Real-time qPCR. The experimental results are as follows: Figure 3 As shown in E, overexpression of ZBTB7A significantly reduced the level of HBV DNA in mouse liver tissue.

[0194] The above experimental results indicate that ZBTB7A can significantly inhibit HBV transcription and replication in a chronic HBV replication mouse model.

[0195] In summary, this invention has validated in HBV transfection and infection systems and chronic HBV replication mouse models that overexpression of ZBTB7A significantly reduces secreted HBsAg and HBeAg levels, decreases intracellular HBcAg levels, and significantly inhibits HBV transcription and replication. This invention provides a novel potential target for the treatment of hepatitis B, offering more effective treatment options for clinical practice, and has broad application prospects and market potential.

Claims

1. Applications of ZBTB7A in any of the following: (1) Application of ZBTB7A as a drug target in screening or preparing drugs against hepatitis B virus; (2) Application of ZBTB7A as a drug target in screening or preparing drugs for treating diseases related to hepatitis B virus infection; (3) Application of ZBTB7A in the preparation of drugs for treating hepatitis B virus infection or diseases related to hepatitis B virus infection; The diseases associated with hepatitis B virus infection include hepatitis B, cirrhosis, and liver cancer.

2. The application according to claim 1, characterized in that, The drug is selected from one of the following: a drug that uses ZBTB7A protein, its encoding gene, or biological material containing its encoding gene as an active ingredient; a drug for overexpressing intrahepatic ZBTB7A or increasing the intrahepatic ZBTB7A expression level.

3. The application according to claim 2, characterized in that, The biological materials include recombinant vectors or recombinant cell lines containing the ZBTB7A gene.

4. Application of substances targeting ZBTB7A in the preparation of drugs for treating hepatitis B virus infection or diseases related to hepatitis B virus infection.

5. The application according to any one of claims 1 to 4, characterized in that, The drug reduces HBsAg and HBeAg secretion, decreases HBcAg, HBV total RNA and pgRNA levels, and inhibits HBV transcription and replication.

6. The application according to any one of claims 1 to 4, characterized in that, The drug promotes the expression of ZBTB7A.

Images