Application of combination of GK921 and sorafenib in preparation of medicine for preventing and / or treating liver cancer
By combining GK921 and sorafenib, the proliferation of liver cancer cells was jointly inhibited, and the problem of low efficiency of existing liver cancer treatment methods was solved, achieving more efficient liver cancer treatment effects.
Patent Information
- Application Number
- CN202510037461.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-09
- Publication Date
- 2025-03-25
AI Technical Summary
Existing treatments for liver cancer are inefficient, especially for patients with advanced HCC. The total effective and median survival of existing drugs such as sorafenib, levatinib, or altezolizumab plus bevacizumab are insufficient to meet clinical needs.
By combining the pharmaceutical composition, including GK921 and sorafenib, the prevention and/or treatment of liver cancer is synergistically prevented and/or treated. As a transglutaminase 2 (TGase 2) inhibitor, GK921 can inhibit the proliferation of liver cancer cells alone and produce a synergistic inhibitory effect when used in combination with sorafenib.
The combination of GK921 and sorafenib significantly improves the inhibitory effect on liver cancer cells, which is stronger than the inhibitory effect during single drug use, and provides a potentially efficient method for treating liver cancer.
Smart Images
Figure BDA0005235935200000021 
Figure BDA0005235935200000022 
Figure BDA0005235935200000041
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular to the use of a combined pharmaceutical composition in the preparation of a drug for preventing and / or treating liver cancer. Background Art
[0002] Primary liver cancer (PLC) is one of the most commonly diagnosed cancers worldwide and the third leading cause of cancer-related death. Hepatocellular carcinoma (HCC) accounts for approximately 75-85% of all PLC cases. Its pathogenesis is extremely complex and can have multiple causes, including chronic hepatitis B virus or hepatitis C virus infection, exposure to aflatoxin B1, alcoholic and non-alcoholic fatty diseases, etc. Although recent studies have discovered many genes and pathways that affect the development of HCC, treatment and patient prognosis remain unsatisfactory.
[0003] Although many trials have been conducted to treat patients with advanced HCC, systemic therapy, including sorafenib, lenvatinib, or atezolizumab plus bevacizumab, is the main treatment option. The overall response rate of sorafenib is only 2%, and the overall median survival of the sorafenib group is only 10.7 months. The efficacy of lenvatinib and atezolizumab combined with bevacizumab is still far from satisfactory, although it is slightly better than sorafenib. This situation highlights the need for more therapeutic approaches to improve the clinical benefit of HCC treatment.
[0004] Therefore, it is necessary to develop a new drug for preventing and / or treating liver cancer. Summary of the invention
[0005] The purpose of the present invention is to overcome the defects of the prior art and provide the use of a combination pharmaceutical composition in the preparation of a drug for preventing and / or treating liver cancer. The present application found that the combination of GK921 and sorafenib can achieve a synergistic effect in preventing and / or treating liver cancer.
[0006] The present invention is achieved in that:
[0007] In a first aspect of the present invention, a combination pharmaceutical composition is provided for use in the preparation of a medicament for preventing and / or treating liver cancer, wherein the combination pharmaceutical composition contains GK921 and sorafenib, and the structural formula of GK921 is:
[0008]
[0009] Furthermore, the drug for preventing and / or treating liver cancer inhibits the proliferation of liver cancer cells.
[0010] Further, the mass ratio of GK921 to sorafenib is 1:1-100. Preferably, the mass ratio of GK921 to sorafenib is 1:10.
[0011] As a specific embodiment, the dosage of sorafenib is 1-50 mg / kg, preferably 30 mg / kg. The dosage of GK921 is 1-5 mg / kg, preferably 3 mg / kg.
[0012] In a second aspect of the present invention, a drug for preventing and / or treating liver cancer is provided, wherein the drug for preventing and / or treating liver cancer contains sorafenib and GK921, and the structural formula of GK921 is:
[0013]
[0014] Furthermore, the drug for preventing and / or treating liver cancer contains an effective amount of sorafenib and an effective amount of GK921.
[0015] Furthermore, the drug for preventing and / or treating liver cancer contains a pharmaceutically acceptable carrier and / or excipient. The excipient is selected from one of a filler, a disintegrant, a binder, an excipient, a diluent, a lubricant, a sweetener or a colorant.
[0016] Furthermore, the dosage form of the drug for preventing and / or treating liver cancer is selected from one of granules, tablets, pills, capsules, injections and dispersants.
[0017] In the third aspect of the present invention, provided is the use of GK921 in the preparation of a medicament for preventing and / or treating liver cancer.
[0018] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:
[0019] The present invention proves through a large amount of experimental data that GK921 can inhibit the proliferation activity of liver cancer. Furthermore, by combining GK921 and sorafenib, a synergistic inhibitory effect can be produced on liver cancer cells, that is, the inhibitory effect of the two drugs on liver cancer cells when used in combination is stronger than the sum of the inhibitory effects exerted when the two drugs are used alone. Therefore, it can be used as a combined pharmaceutical composition in the preparation of a drug for preventing and / or treating liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 The results of the experiment on the proliferation of liver cancer cell lines by GK921 alone in Example 1 are as follows; wherein, Figure 1 A is the result that GK921 has a significant inhibitory effect in the colony formation test of liver cancer cell lines (Huh 7, HCC-LM3), Figure 1 B is the CCK8 test result of GK921 on liver cancer cell lines (Huh 7, HCC-LM3);
[0021] Figure 2 is the result of the organoid monotherapy experiment in Example 2; wherein, Figure 2 A is a picture of the growth status of organoids after drug administration. Figure 2 B is the statistical results of cell activity.
[0022] Figure 3 These are the experimental results showing that GK921 and sorafenib have synergistic effects. Figure 3 A is the experimental flow chart of subcutaneous tumor model. Figure 3 B is the tumor size picture. Figure 3 C is tumor volume and weight; Figure 3 D is the experimental flow chart of mouse HTVI model. Figure 3 E and 3F are in vivo bioluminescence images and data statistics. Figure 3 G is HE staining of mouse liver tissue. Figure 3 H is the ratio of liver weight to body weight of mice.
[0023] Figure 4 The results show that GK921 does not cause significant toxicity in preclinical models. Figure 4 A is the HE staining result of mouse heart, liver, spleen, lung and kidney tissues. Figure 4 B is the blood routine index of mice, Figure 4 C is a blood biochemical index. DETAILED DESCRIPTION
[0024] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.
[0025] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.
[0026] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.
[0027] In order to solve the technical problem of the present invention, the overall idea of the present invention is as follows:
[0028] GK921, the structural formula of GK921 is:
[0029]
[0030] GK921 is a transglutaminase 2 (TGase 2) inhibitor with an IC50 of 8.93 μM. For details, see the literature: Kim N, et al. Amino Acids. 2018, 50 (11): 1583-1594. The GK921 of the present application can be purchased commercially, such as from Selleck, catalog number S6417.
[0031] The inventors of the present application discovered through experiments that GK921 can inhibit the proliferation of liver cancer cells.
[0032] Furthermore, the combination of GK921 and sorafenib was found to have a synergistic inhibitory effect on the proliferation of liver cancer cells, and GK921 can enhance the in vitro response of sorafenib.
[0033] These results suggest that GK921 and its combination with sorafenib may be a potential therapeutic approach for HCC treatment.
[0034] The application of the combined pharmaceutical composition of the present application in the preparation of a drug for preventing and / or treating liver cancer will be described in detail below in conjunction with examples and experimental data.
[0035] The term "combination" or "combination therapy group" as used herein means that two or more active substances can be administered to a subject simultaneously as a single preparation, or sequentially in any order as a single preparation.
[0036] "Effective amount" as described herein refers to an amount sufficient to prevent or treat the symptoms or diseases of a medical condition. After use in a specific patient or medical subject, the following changes may occur: the condition to be treated, the overall health of the patient / subject is improved. An effective amount may also be a dosage regimen below the maximum dose to avoid significant side effects or toxic effects.
[0037] The GK921 in the embodiment of the present invention was purchased from Selleck.
[0038] Example 1: Effect of single-drug GK921 on proliferation of liver cancer cells
[0039] 1. Colony formation assay was used to detect the effects of different concentrations of single drug GK921 (0.1μM, 0.2μM, 0.5μM) on the proliferation of different liver cancer cell lines (Huh7, HCC-LM3). The specific steps are as follows:
[0040] The cells in the exponential growth phase were digested with trypsin, blown into a single cell suspension, counted, and inoculated into a 6-well culture plate (2500 cells / well). After 10-14 days of culture in a cell culture incubator, they were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The results were as follows: Figure 1As shown in A, GK921 inhibits the proliferation of liver cancer cells in a dose-dependent manner.
[0041] 2. The CCK8 method was used to detect the effects of different concentrations of single-drug GK921 (0.1μM, 0.2μM, 0.5μM, 1μM, 2μM) on the proliferation of different liver cancer cell lines (Huh7, HCC-LM3). The specific steps are as follows:
[0042] The cells in the exponential growth phase were digested with trypsin, blown into a single cell suspension, counted, and inoculated into a 96-well culture plate (3000 cells / well). After 24 hours of culture in the incubator, the above-mentioned different concentrations of GK921 were added separately after the cells adhered to the wall. After 72 hours of action, the culture was terminated, 10 μl of CCK8 (5 mg / mL) was added to each well, incubated at 37°C in the dark for 1 hour, and the cell optical density was measured at a wavelength of 450 nm using an ELISA reader, and the cell survival rate was calculated according to the following formula:
[0043] Survival rate % = [(experimental group value - blank group value) ÷ (control group value - blank group value)] × 100%.
[0044] The results are as follows Figure 1 As shown, in the human liver cancer cell line, single-agent GK921 showed a certain effect of inhibiting the proliferation activity of liver cancer cells, and with the increase of drug concentration, the cell activity of the above liver cancer cell line gradually decreased.
[0045] Example 2: Treatment experiment of single drug GK921 in organoids
[0046] 1. In vitro culture of liver cancer tumor organoids
[0047] Clinical liver cancer samples were obtained from Tongji Hospital affiliated to Tongji Medical College of Huazhong University of Science and Technology. Sufficient amount of tumor organoids were obtained by conventional culture protocol of human liver cancer tumor organoids. The specific operation and culture medium composition can be found in the literature: L.Broutier, G.Mastrogiovanni, MMVerstegen, et al., Human primary liver cancer-derived organoid cultures for disease modeling and drug screening, NatMed 23(12)(Dec 2017)1424-1435.
[0048] 2. Dosing
[0049] After the proliferating organoids were digested into single-cell suspensions, they were inoculated into 96-well plates with approximately 3,000 cells per well. They were treated with different concentrations of GK921 (0.1 μM, 0.2 μM, 0.5 μM, 1 μM, 2 μM, 5 μM, and 10 μM) for 5-7 days, and then photographed and cell viability tested.
[0050] The results are as follows Figure 2 As shown, GK921 can inhibit the proliferation activity of liver cancer organoids, and the cell activity gradually decreases with the increase of drug concentration.
[0051] Example 3: GK921 alone inhibits the growth of subcutaneous tumors in nude mice with hepatocellular carcinoma
[0052] 1. Establishment of xenograft model in BALB / C nude mice using MHCC-97H cells
[0053] A total of 20 male BALB / c nude mice (5 weeks old) were used, and each nude mouse was subcutaneously injected with 1 million MHCC-97H cells. Two weeks later, the mice were given control solvent (0.5% CMC-Na), GK921 (3 mg / kg / day), sorafenib (30 mg / kg / day), and GK921 and sorafenib combination (GK921 3 mg / kg / day, sorafenib 30 mg / kg / day) for oral gavage treatment for 3 weeks. After one week of drug withdrawal, the nude mice were killed, dissected and the tumors were completely removed and photographed, and the body weight, tumor mass and volume of the nude mice were weighed.
[0054] The results are as follows Figure 3 As shown in Figure 3 B and Figure 3 C shows the size of subcutaneous tumors in nude mice after GK921 alone, sorafenib alone, and the combination of the two drugs. It can be seen that sorafenib alone, GK921 alone, and the combination of the two drugs can significantly inhibit the growth of subcutaneous tumors; compared with the control group, the tumor volume and weight of the GK921 treatment group decreased significantly. When the dose of GK921 is significantly lower than that of sorafenib, the effect of GK921 is not lower than that of sorafenib, and the combination of GK921 and sorafenib shows a synergistic anti-tumor effect.
[0055] 2. Establishment of HTVI model in C57BL / 6J mice
[0056] Male C57BL / 6J mice (6-8 weeks old) were used, and each mouse was injected with 2 mL of HTVI model plasmid mixture through the tail vein. The mixture included 10 μg pT3-EF1α-MYC-IRES-luciferase (addgene #180149 vector inserted into the MYC-IRES-luciferase coding sequence), 10 μg PX458-U6-sgTP53-SpCas9 (addgene #48138 vector inserted into the mouse TP53-sgRNA target sequence CCTCGAGCTCCCTCTGAGCC) and 0.8 μg SB transposon pCMV (CAT) T7-SB100 (addgene #34879). Two weeks later, control solvent (0.5% CMC-Na), GK921 (3 mg / kg / day), sorafenib (30 mg / kg / day), and the combination of GK921 and sorafenib (GK921 at 3 mg / kg / day and sorafenib at 30 mg / kg / day) were treated by gavage for 4 weeks, and in vivo imaging was performed every week.
[0057] like Figure 3 E and Figure 3 As shown in F, the analysis of the in vivo imaging fluorescence signal showed that the fluorescence intensity of the GK921-treated group was significantly lower than that of the control group; and the bioluminescence of the GK921-treated group was lower than that of the sorafenib-treated group; further, the fluorescence intensity of the GK921 and sorafenib combined treatment group was significantly lower than that of the GK921-treated group or the sorafenib-treated group.
[0058] like Figure 3 As shown in H, compared with the control group, the liver / body weight ratio of mice in the GK921-treated group or the sorafenib-treated group was lower, and the liver / body weight ratio of mice in the GK921-treated group was lower than that in the sorafenib-treated group. Furthermore, the liver / body weight ratio of mice in the GK921 and sorafenib combined treatment group was significantly lower than that in the GK921-treated group or the sorafenib-treated group.
[0059] like Figure 3 As shown in G, HE staining of liver tissue in the GK921-treated group or the sorafenib-treated group was significantly less than that in the control group. And HE staining of liver tissue in the GK921 and sorafenib combined treatment group was significantly less than that in the GK921-treated group or the sorafenib-treated group.
[0060] In conclusion, GK921 and the combination of GK921 and sorafenib can effectively inhibit the growth of HCC in vivo.
[0061] Example 4: Drug toxicity evaluation
[0062] 1. Model establishment:
[0063] Wild-type C57BL / 6J mice were intragastrically administered with GK921 (3 mg / kg / day) for 12 weeks, and 0.5% CMC-Na was used as a control.
[0064] 2. Tissue, blood routine and serum biochemical tests
[0065] Routine blood tests and serum biochemical tests were performed in the laboratory department of Tongji Hospital.
[0066] like Figure 4 As shown in A, HE staining of mouse tissues showed no significant difference in tissue morphology between the drug-treated group and the control group.
[0067] like Figure 4 As shown in B, there were no significant differences in the numbers of white blood cells, lymphocytes, red blood cells, and hemoglobin in the GK921-treated mice compared with the control group.
[0068] like Figure 4 As shown in Figure C, there was no significant difference in liver function indicators such as AST and ALT after GK921 treatment compared with the control group. In summary, GK921 has no obvious toxicity.
[0069] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.
[0070] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0071] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.
Claims
1. Use of a combined pharmaceutical composition in the preparation of a drug for preventing and / or treating liver cancer, characterized in that: The combined pharmaceutical composition contains sorafenib and GK921, and the structural formula of GK921 is:
2. The use according to claim 1, characterized in that: The drug for preventing and / or treating liver cancer inhibits the proliferation of liver cancer cells.
3. The use according to claim 1, characterized in that: The mass ratio of GK921 to sorafenib is 1:1-100.
4. A drug for preventing and / or treating liver cancer, characterized in that: The drug for preventing and / or treating liver cancer contains GK921 and sorafenib, and the structural formula of GK921 is:
5. The drug for preventing and / or treating liver cancer according to claim 4, characterized in that: The medicine for preventing and / or treating liver cancer contains an effective amount of sorafenib and an effective amount of GK921.
6. The drug for preventing and / or treating liver cancer according to claim 4, characterized in that: The medicine for preventing and / or treating liver cancer contains a pharmaceutically acceptable carrier and / or auxiliary material.
7. The use according to claim 4, characterized in that: The dosage form of the drug for preventing and / or treating liver cancer is selected from one of granules, tablets, pills, capsules, injections and dispersants.
8. Use of GK921 in the preparation of drugs for preventing and / or treating liver cancer.