Preparation method of exosome protein Pc and application of exosome protein Pc in regulation and control of intestinal flora

Abstract

The invention relates to a preparation method of an exosome protein Pc and application of the exosome protein Pc in regulation and control of intestinal flora. A fungus-derived Pc protein directly interacts with a protein which has an exosome characteristic and contains a beta-N-acetylglucosaminidase (GL) structural domain in intestinal microorganisms and inhibits the enzymatic activity of the protein; the proliferation of beneficial microorganisms is regulated and controlled by relieving cell iron and ROS pressure; the Pc protein can regulate and control the expression of the difunctional autolysin, can enrich staphylococcus beneficial bacteria with the difunctional autolysin in the intestinal tract of an insect, or can enrich beneficial bacteria with the difunctional autolysin in the intestinal tract of a healthy mammal mouse, or can enrich Blauria bacteria in the intestinal tract of an obese mouse induced by high fat diet, and can enrich the beneficial bacteria with the difunctional autolysin in the intestinal tract of the healthy mammal mouse, or can enrich the beneficial bacteria with the difunctional autolysin in the intestinal tract of the healthy mammal mouse, or can enrich the beneficial bacteria with the difunctional autolysin in the intestinal tract of the healthy mammal mouse and the beneficial bacteria with the difunctional autolysin in the intestinal tract of the healthy mammal mouse. Or Akkermansia bacteria in the intestinal tract of the DSS-induced colitis mouse can be enriched; the Pc protein can be used for remarkably reducing the formation of a staphylococcus aureus (S. aureus) biological membrane with the difunctional autolysin. The Pc protein can be used as a novel potential prebiotic, can be used for regulating proliferation of intestinal beneficial microorganisms with difunctional autolysin, and has potential application value in preparation of food and drugs and disease treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biological preparations, and in particular relates to a method for preparing an exocrine protein Pc and an application thereof in regulating intestinal flora. Background Art

[0002] The ecological barrier composed of a large number and a wide variety of intestinal flora can resist the invasion of pathogenic bacteria and potential pathogens, and is of great significance to the growth and health of animals. Intestinal microbial homeostasis is the key to maintaining host health and growth. Studies have shown that a variety of substances and methods can regulate the balance of intestinal flora, such as probiotics, prebiotics, antibiotics, immunoglobulins, and fecal microbiota transplantation. These methods and means are non-targeted regulation and most of them have potential risks and side effects. Summary of the invention

[0003] In order to solve the above technical problems, the present invention provides a method for preparing an exocrine protein Pc and its application in regulating intestinal flora.

[0004] The technical solution adopted by the present invention is: application of exocrine protein Pc in regulating intestinal flora.

[0005] Preferably, the exoprotein Pc regulates the protein having exosome properties and containing the β-N-acetylglucosaminidase (GL) domain, and promotes the proliferation of bacteria containing the protein having exosome properties and containing the β-N-acetylglucosaminidase (GL) domain.

[0006] Preferably, the protein having exocrine properties and containing a β-N-acetylglucosaminidase (GL) domain is an autolysin.

[0007] Preferably, the Pc protein binds to the β-N-acetylglucosaminidase domain of the autolysin, thereby inhibiting the enzymatic activity of the autolysin, resulting in the obstruction of cell wall degradation during cell division.

[0008] Preferably, the expression of genes related to iron absorption is downregulated to reduce cellular iron absorption and alleviate cellular ROS pressure.

[0009] Preferably, the Pc protein promotes the proliferation of one or more of bacteria of the genus Staphylococcus, bacteria of the family Lachnospiraceae, bacteria of the genus Blautia of the family Lachnospiraceae, and bacteria of the genus Akkermansia;

[0010] Preferably, the Pc protein promotes the enrichment of beneficial bacteria of the genus Staphylococcus in the insect gut;

[0011] Preferably, the Pc protein promotes the enrichment of beneficial bacteria of the Lachnospiraceae family in the intestines of healthy mammals;

[0012] Preferably, the Pc protein promotes the enrichment of Blautia bacteria in the intestines of obese mice induced by a high-fat diet;

[0013] Preferably, Pc protein promotes the enrichment of Akkermansia bacteria in the intestines of mice with DSS-induced colitis.

[0014] Preferably, the formation of S. aureus biofilms having a bifunctional autolysin is inhibited.

[0015] An additive comprising one or more of an exogenous protein Pc, a natural microorganism containing the Pc protein, and an engineered bacterium capable of heterologously expressing the Pc protein;

[0016] Preferably, the natural microorganism containing Pc protein is Penicillium herquei cultivated by Polygonum cuspidatum leaf weevil;

[0017] Preferably, a vector engineering bacterium for heterologously expressing Pc protein is constructed, the engineering bacterium is cultured, and the expression of Pc protein is induced by BL21 (DE3); primary Pc protein is preliminarily purified using a nickel affinity purification column, and then eluted using a Tris-HCl (pH 7.8-8.0) solution containing 0.2 M sodium chloride through a DEAE-Sepharose FF anion exchange column to obtain Pc protein.

[0018] Preferably, it can be used in food, feed or medicine;

[0019] Preferably, it is used in health food.

[0020] Application of exoprotein Pc in drugs for treating enteritis.

[0021] The advantages and positive effects of the present invention are: providing a Pc protein that can target and regulate intestinal flora, which can be used in food, medicine or feed as a new potential prebiotic; by interacting with exoproteins in bacteria in the intestinal flora that need to have a GL domain, regulating the proliferation of such bacteria, thereby promoting host health;

[0022] Pc protein can regulate the expression of bifunctional autolysins, and can enrich beneficial bacteria of the genus Staphylococcus with bifunctional autolysins in the intestines of insects, or can enrich beneficial bacteria of the family Lachnospiraceae with bifunctional autolysins in the intestines of healthy mice, or can enrich bacteria of the genus Blautia in the intestines of obese mice induced by a high-fat diet, or can enrich bacteria of the genus Akkermansia in the intestines of mice with colitis induced by DSS; Pc protein can significantly reduce the formation of biofilms of Staphylococcus aureus with bifunctional autolysins;

[0023] Pc protein can be used as a new potential prebiotic to regulate the proliferation of beneficial intestinal microorganisms with bifunctional autolysins, and has potential application value in the preparation of food, medicine and disease treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Subcellular localization of Pc protein after fusion with mCherry;

[0025] Figure 2 Effects of hyphae of Pc gene knockout strain on body weight of Tenebrio molitor;

[0026] Figure 3 Effects of mycelial exosomes of Pc gene knockout strain on body weight of Tenebrio molitor;

[0027] Figure 4 Effect of purified Pc protein on body weight of Tenebrio molitor;

[0028] Figure 5 Effects of hyphae of Pc gene knockout strain on intestinal microorganisms of Tenebrio molitor;

[0029] Figure 6 Effects of heterologous expression of purified Pc protein on intestinal microorganisms of Tenebrio molitor;

[0030] Figure 7 The antibiotic feeding method was used to construct the intestinal sterile mealworm larvae; a, the culture of intestinal microorganisms of the control group (CK) and the antibiotic treatment group (FB) larvae in different culture media under aerobic and anaerobic conditions; b, the verification of the intestinal bacteria retention of the control group and the antibiotic treatment group larvae;

[0031] Figure 8 Effects of Pc protein on the body weight of sterile mealworms;

[0032] Fig. 9Effects of Staphylococcus bacteria on the body weight of intestinal sterile mealworms; CK, blank control group with PBS; Pc, group fed with Pc protein; Ssu, group with S.succinus bacteria; Skl, group with S.kloosii bacteria; Sxy, group with S.xylosus bacteria; Sga, group with S.gallinarum bacteria; Ssa, group with S.saprophyticus bacteria; Hhu, group with Herbaspirillum huttiense bacteria; Tin, group with Tenebrionibacter intestinalis bacteria; Kin, group with Kluyvera intermedia bacteria;

[0033] Fig.10 Effect of Pc protein on the proliferation of Staphylococcus bacteria in liquid culture in vitro; a is the growth of S. kloosii, b is the growth of S. succinus; c is the growth of S. gallinarum;

[0034] Fig.11 Schematic diagram of the docking of Pc protein and bifunctional autolysin (Atl) molecule;

[0035] Fig.12 Verify the binding of Pc protein to the bifunctional autolysin (Atl) of Staphylococcus bacteria;

[0036] Fig.13 Pc proteins inhibit the activity of the bifunctional autolysin enzyme;

[0037] Fig.14 Pc proteins regulate the expression of S. kloosii bifunctional autolysin and other iron absorption-related genes;

[0038] Fig.15 Pc protein down-regulates S. kloosii autolysin-dependent iron uptake and cellular ROS stress;

[0039] Fig.16 Pc protein enriches Lachnospiraceae bacteria with bifunctional autolysins in the intestines of disease-free mice;

[0040] Fig.17 Pc can bind to the exosome-type GL domain-containing proteins of various bacteria; a1-a28 in the figure are the molecular simulation docking results of Pc and the exosome-type GL domain-containing proteins of different bacteria in Table 2; blue represents Pc protein, green represents exosome-type GL domain-containing proteins, and brown represents GL domain;

[0041] Fig.18Pc can significantly reduce the biofilm formation of Staphylococcus aureus;

[0042] Fig.19 Pc can effectively alleviate high-fat diet-induced obesity by regulating intestinal microorganisms; a, DIO mouse model feeding experimental plan; b, mouse body weight changes before Pc protein gavage; c, mouse body weight changes during Pc protein gavage; d, total body fat weight of mice after feeding; e, H&E staining of epididymal adipose tissue; f, average size of epididymal adipocytes; g, H&E and Oil Red O (ORO) of liver tissue

[0043] staining; h, Changes in intestinal microorganisms of each group of mice;

[0044] Fig. 20 Pc can effectively alleviate DSS-induced colitis by regulating intestinal microorganisms. a, Experimental scheme for feeding colitis (UC) model mice; b, Results of weight changes of mice before DSS treatment; c, Results of weight changes of mice during DSS treatment; d, Results of changes in disease index (DAI) of each group of mice during DSS treatment; e, Statistical results of colon length of each group of mice after DSS treatment; f, Comparison results of colon length of each group of mice after DSS treatment; g, Comparison of spleen index of each group of mice after DSS treatment; h, Comparison of spleen size of each group of mice after DSS treatment; i, H&E staining results of paraffin-embedded sections of colon tissue of each group of mice after DSS treatment; j, Results of changes in intestinal microorganisms of each group of mice after DSS treatment. DETAILED DESCRIPTION

[0045] The embodiments of the present invention are described below with reference to the accompanying drawings.

[0046] The present invention relates to a novel preparation method of exoprotein Pc and its application in targeted regulation of intestinal flora. Exoprotein Pc was originally extracted from the protruding appendages outside the hyphae of Penicillium herquei, a fungus cultivated by leaf weevils. Exoprotein Pc regulates proteins with exosome properties and containing β-N-acetylglucosidase (GL) domains, and promotes the proliferation of bacteria containing proteins with exosome properties and containing β-N-acetylglucosidase (GL) domains. Exoprotein Pc is expected to be used as a new potential prebiotic for regulating the proliferation of beneficial intestinal microorganisms including those with exosome properties and containing β-N-acetylglucosidase (GL) domain proteins, such as Staphylococcaceae or Lachnospiraceae bacteria. Based on this characteristic, exoprotein Pc has potential application value in the preparation of food and medicine and in the treatment of diseases.

[0047] The nucleotide sequence of the exoprotein Pc (including introns) is shown in GenBank accession number PP496239. The gene is derived from the Penicillium herquei fungus, which is cultivated by leaf weevils. The exoprotein Pc is prepared by constructing a heterologous expression vector of the gene and expressing it in Escherichia coli BL21 (DE3). The purified Pc protein can be used for experimental research on its function or directly used as an additive in food or feed.

[0048] Pc protein can play a probiotic role by regulating intestinal microorganisms. Feeding experiments have shown that Pc protein can enrich beneficial bacteria of the genus Staphylococcus with bifunctional autolysins in the insect intestine, thereby achieving a probiotic effect. In addition, Pc protein can also enrich beneficial bacteria of the family Lachnospiraceae with bifunctional autolysins in the intestines of disease-free C57BL / 6J mice, and also play a regulatory role in the regulation of intestinal microorganisms in mammalian mice. In addition, for diseased mouse models, Pc protein can also produce certain therapeutic effects, enriching Blautia bacteria in the intestines of obese mice induced by a high-fat diet, or enriching Akkermansia bacteria in the intestines of DSS-induced colitis mice, thereby promoting host health.

[0049] The molecular simulation docking results also show that Pc protein can bind to a variety of exocytotic proteins with β-N-acetylglucosaminidase (GL) domains of beneficial bacteria that can be used in food production. Pc protein can regulate the expression of bacterial bifunctional autolysins. Pc protein binds to the β-N-acetylglucosaminidase domain of autolysins, thereby inhibiting the enzymatic activity of autolysins, resulting in the obstruction of cell wall degradation during cell division. In addition, Pc protein can also regulate the expression of iron absorption-related genes, thereby reducing bacterial iron absorption and relieving cellular ROS pressure, thereby promoting the proliferation of beneficial bacteria. When regulating intestinal microorganisms, Pc protein directly binds to the bifunctional autolysins of insect intestinal microorganisms to inhibit their enzymatic activity, and then regulates the proliferation of beneficial microorganisms with bifunctional autolysins (Atl) by relieving cellular iron and ROS pressure, thereby promoting host growth.

[0050] In addition, Pc protein can significantly reduce the formation of biofilm of Staphylococcus aureus (S. aureus) with bifunctional autolysins. Therefore, this protein is expected to be used as a new potential prebiotic to regulate the proliferation of beneficial intestinal microorganisms with bifunctional autolysins. Pc protein is derived from the insect symbiotic system and can be eaten by symbiotic host insects without toxic effects; this protein can also bind to the β-N-acetylglucosaminidase (GL) domain in the exoproteins of intestinal bacteria to directly target and regulate the proliferation of probiotic bacteria containing exoproteins containing the GL domain, thereby promoting host health.

[0051] The scheme of the present invention is described below in conjunction with the accompanying drawings, wherein the experimental methods without specific operating steps are all carried out in accordance with the corresponding product instructions, and the instruments, reagents, and consumables used in the examples can all be purchased from commercial companies unless otherwise specified.

[0052] Example 1: Preparation of exoprotein Pc

[0053] The gene sequence of Pc protein is derived from Penicillium herquei, a fungus cultivated by leaf weevils. The gene sequence (including introns) has been uploaded to the NCBI database, and its gene sequence accession number is PP496239. The pET-32M plasmid was used as a heterologous protein expression vector, and the plasmid vector was linearized and the TrxA tag sequence was removed by double restriction digestion with XbaI and XhoI. The Pc gene was amplified using a high-fidelity enzyme with cDNA as a template using primers shown in SEQ ID No.1 and SEQ ID No.2, and connected to the linear vector by seamless cloning.

[0054] The primer sequences are as follows:

[0055] SEQ ID No.1Pc3-3:

[0056] GGATAACAATTCCCCTCTAGAAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTTTGATAAGTGGCAGCCA

[0057] SEQ ID No.2Pc4:

[0058] GTGGTGGTGGTGGTGCTCGAGAGCAGTAATAGTAAACGGGCCAG

[0059] The ligated plasmid was first transformed into E. coli DH5α competent cells by heat shock transformation for plasmid amplification, and then the amplified plasmid was used to transform E. coli expression strain BL21 (DE3) and the primers shown in SEQ ID No. 3 and SEQ ID No. 4 were used to verify the positive transformants.

[0060] The primer sequences are as follows:

[0061] SEQ ID No.3Pet-YF1

[0062] ATACCCACGCCGAAACAA

[0063] SEQ ID No.4Pet-YR

[0064] GCTTTGTTAGCAGCCGGATCT

[0065] The positive transformants were cultured in LB medium until OD 600 It was about 0.8, and then 500 μM isopropyl-β-D-thiogalactoside (IPTG) was used to induce protein expression at 16°C and 150 rpm for 12 h or overnight.

[0066] Use 50 ml centrifuge tubes to collect induced expression bacteria by centrifugation at 4°C and 10,000 rpm for 3 min, and collect 150 ml of bacterial culture fluid in each tube. Then, add 15-20 ml of lysis buffer (300 mM NaCl, 50 mM NaH 2 PO 4 .2H 2 O, 10mM imidazole, pH7.8-8.0) to fully resuspend the cells, ultrasonically disrupt them and centrifuge at 4°C for 15min, collect the supernatant and filter it with a 0.45μm filter. The Pc protein with the His tag was adsorbed using nickel affinity filler and eluted with 250mM imidazole (300mM NaCl, 50mM NaH 2 PO 4 .2H 2 The protein was eluted with 10 mM imidazole (pH 7.8-8.0) and the target protein was collected. The target protein was dialyzed using a Tris-HCl solution (20 mM Tris, HCl adjusted to pH 7.8-8.0). The dialyzed protein solution was passed through a DEAE-Sepharose FF anion exchange column, and the Pc protein was eluted and purified using a Tris-HCl (20 mM Tris, HCl adjusted to pH 7.8-8.0) eluent containing 0.2 M NaCl, and dialyzed into PBS for storage.

[0067] Example 2: Study on the expression of Pc protein in the fungus cultivated by leaf weevils

[0068] The Pc-mCherry fusion red fluorescent protein was constructed using the pFGL815N plasmid as a backbone, and then transferred into the leaf weevil culturing fungus Penicillium herquei and cultured to form hyphae. The formed hyphae were observed to explore the expression position of the Pc protein. The results are as follows Figure 1 As shown, the extrahyphae appendages were visible with red fluorescence, confirming the excretion of Pc protein into the hyphal appendages.

[0069] Example 3: Effects of feeding exoprotein Pc on mealworm larvae

[0070] 3.1 Effects of Pc protein-containing cultured mycelium on the body weight of mealworm larvae

[0071] The yellow mealworm larvae (body length 0.8-1cm) were selected as the feeding model, and the mycelium of the fungus Penicillium herquei cultivated by the leaf curling weevil was taken, freeze-dried and added to the basic feed wheat bran. After feeding at room temperature for 6 days, the weight gain was detected. The model yellow mealworm larvae were divided into 5 groups. Before the experiment, 1g of yellow mealworm larvae were accurately weighed in each group; 40mg of freeze-dried cultivated mycelium, cultivated Pc gene knockout strain 1, cultivated Pc gene knockout strain 2 and wild-type mycelium isolated and purified from the environment were added in turn. Among them, cultivated mycelium refers to the symbiotic Penicillium herquei cultivated by the leaf curling weevil, Pc knockout strains 1 and 2 are two Pc knockout strains obtained by knocking out the double-copy Pc gene based on the pFGL815N and pAg1-H3 plasmid backbones, and the wild-type mycelium refers to the Penicillium herquei isolated and purified from the environment.

[0072] The mycelium of each group was ground and added to 4g of basic feed wheat bran, and the moisture content of the feed was adjusted to 18%. The experimental group of mealworm larvae was fed at room temperature, and the mealworm larvae directly fed with basic feed wheat bran without addition were used as the control group. After feeding for 6 days, the weight of the mealworm larvae of each group was weighed, and the results were as follows: Figure 2 As shown, the results showed that the cultivated hyphae containing Pc protein could significantly promote the growth of larvae, while the cultivated hyphae of Pc gene knockout strain lacked the expression of Pc protein, so the larvae grew slower than other groups.

[0073] The mycelial exocytosis of cultivated mycelia, cultivated Pc gene knockout mycelia and wild-type mycelia isolated from the environment were extracted and collected using 50% methanol aqueous solution. After freeze-drying, 20 mg of powder was dissolved in an appropriate amount of water and mixed with 4 g of wheat bran to adjust the moisture content of the feed to 18%. After feeding at room temperature for 6 days, the weight of the mealworm larvae in each group was weighed. The results are shown in Figure 2. Figure 3 As shown, the mycelial appendages of the cultivated strain containing Pc protein can significantly promote larval growth, while the exocrine appendages of the mycelium of the cultivated Pc gene knockout strain cannot promote larval growth, indicating that Pc protein has a significant effect on the growth of Tenebrio molitor larvae; by feeding the mycelium of the Pc gene knockout strain and the exocrine appendages of the mycelium of the knockout strain respectively, it was confirmed that Pc protein is a key protein that promotes the growth of Tenebrio molitor larvae.

[0074] 3.2 Effects of heterologous expression of purified Pc protein on the body weight of Tenebrio molitor larvae

[0075] Tenebrio molitor larvae (body length 0.8-1 cm) were selected as the feeding model. 200 μg of purified Pc protein was added to 2g of basic feed wheat bran, and the water content of the feed was adjusted to 18% using PBS. In addition, Uc protein and bovine serum albumin BSA were used as control proteins. The weight of each group of Tenebrio molitor larvae was weighed after 6 days of feeding at room temperature. Among them, Uc protein is also an unknown protein identified from mycelial exosomes, and it is named Uc because its content in mycelial exosomes is second only to Pc protein, and it is also a low molecular weight protein (about 12kDa), so Uc protein was selected as the control protein.

[0076] The results are as follows Figure 4 As shown, the results showed that heterologous expression of purified Pc protein could significantly promote larval growth.

[0077] Example 4: Effect of Pc protein on intestinal flora of mealworm larvae

[0078] The intestinal flora of the mealworms obtained in Example 3 was analyzed. The intestinal tracts of the mealworms fed with the Pc gene knockout strain hyphae and the mealworms fed with purified Pc protein were extracted, and the abundance of intestinal bacteria was determined by 16S amplicon sequencing. The results showed that both feeding with hyphae containing Pc protein and feeding with heterologously expressed purified Pc protein could significantly enrich Staphylococcus bacteria. Figure 5 As shown, the blank control group refers to the group fed with only basic wheat bran feed; the Pc knockout strain mycelium group refers to the group fed with cultivated mycelium with Pc gene knockout; the Pc non-knockout strain mycelium group refers to the group fed with cultivated mycelium with Pc gene not knocked out; from the comparison of the results, it can be seen that the intestinal tract of the cultivated mycelium group with Pc gene not knocked out was significantly enriched with Staphylococcus bacteria. Figure 6 As shown, the Pc protein group is a group fed with wheat bran supplemented with Pc protein. Similarly, the intestine of the mealworm in this group is significantly enriched with Staphylococcus bacteria. The above results further prove that Pc protein can promote the growth of mealworm larvae and can significantly enrich Staphylococcus bacteria in the intestine of larvae.

[0079] Example 5: Effect of Pc on intestinal sterile mealworm larvae

[0080] 5.1 Preparation of intestinal sterile mealworm larvae

[0081] An appropriate amount of mealworm larvae were placed in a sterile culture dish, and wheat bran containing bacterial and fungal antibiotics was used as feed. 300 μl of fungal antibiotics (0.5 mg / ml fluconazole, 0.1 mg / ml amphotericin-B and 1 mg / ml 5-fluorocytosine) and 300 μl of bacterial antibiotics (0.125 mg / ml ciprofloxacin, 0.1 mg / ml metronidazole, 0.05 mg / ml vancomycin, 100 U streptomycin, 100 U penicillin) were added to each gram of feed. New culture dishes and feed were replaced every day. Feeding was continued for 5 days. Three larvae were randomly selected, and the larval intestines were obtained using a sterile scalpel and tweezers and placed in a 1.5 ml sterile centrifuge tube. 1 ml of sterile water was added, and the intestines were crushed with a sterile grinding rod, centrifuged at low speed, and the supernatant was taken and diluted 10 times, and then coated with LA, PDA, M17 and Lactobacillus (Lact) culture media respectively, and cultured under anaerobic and aerobic conditions respectively. The growth of microorganisms was observed and the results showed that no microorganisms remained in the larvae's intestines after 5 days of antibiotic intake. Figure 7 As shown in a.

[0082] Five larval intestines were used to extract intestinal bacterial genomic DNA using the CTAB method. The specific operation was as follows: the obtained intestines were crushed in a centrifuge tube; the intestinal fluid was briefly centrifuged at 800 rpm to obtain the supernatant; PBS was added to the precipitate, and the supernatant was obtained by shaking and briefly centrifuging. The lower layer of bacteria was centrifuged at 12,000 rpm, and the precipitate was washed twice with PBS; the obtained bacterial supernatant was mixed and 400 μl was added. CTAB lysis solution (containing 1 mg / ml lysozyme); incubate at 37°C for 10 min, water bath at 65°C for 10 min, centrifuge at 12000 rpm for 5 min, and take the supernatant; add 400 μl phenol: chloroform: isopropanol (25:24:1), centrifuge at 12000 rpm for 10 min, and take the supernatant; add an equal volume of chloroform: isopropanol (24:1), and centrifuge at 12000 rpm for 10 min; aspirate the supernatant and add 0.6 times the volume of isopropanol, shake up and down, and place in a -20 refrigerator for precipitation; centrifuge at 12000 rpm for 15 min, collect DNA precipitate, wash DNA with 500 μl 75% alcohol, centrifuge at 12000 rpm for 10 min, dry and dissolve in ultrapure water, use universal primers 27F and 1492R to perform PCR amplification of 16S sequence to verify whether there are bacteria in the intestine. The results show that no bacteria remain in the intestine after taking antibiotics for 5 days. The results are as follows Figure 7 As shown in b.

[0083] 5.2 Effects of Pc protein on the growth of aseptic mealworm larvae

[0084] The intestinal sterile larvae were randomly divided into a blank control group, a Pc group, and a BSA group; each group had 0.5 g of larvae and was provided with 1 g of wheat bran as feed, and the water content of the feed was controlled to 18% using PBS solution. The blank control group was provided with wheat bran only; the Pc group was provided with wheat bran containing 100 μg of Pc protein; and the BSA group was provided with wheat bran containing 100 μg of BSA protein. The larvae were raised in a black plastic lunch box at room temperature and away from light for 6 days. Each group was repeated three times. After the experiment, the total weight of each group of larvae was weighed, and the results are as follows: Figure 8 The results showed that Pc protein could not promote the growth of sterile mealworm larvae, which further proved the role of Pc protein in regulating intestinal microorganisms. 5.3 Effect of Staphylococcus bacteria on the growth of sterile mealworm larvae

[0085] Take the mealworm larvae fed with the cultivated mycelium as mentioned above, use sterile tweezers and scalpel to extract the intestines of 3-5 larvae, add appropriate amount of sterile and use a sterile grinding rod to grind them, place them in a centrifuge for short centrifugation at 3000 rpm, draw an appropriate amount of supernatant and dilute it, then spread it on LA solid plates, culture at 37°C overnight, pick up a single colony, amplify the 16S sequence by using universal primers 27F and 1492R and sequence it, and identify, separate and purify the intestinal bacteria. The isolated and purified Staphylococcus bacteria S. gallinarum (Sga), S. kloosii (Skl), S. succinus (Ssu), S. saprophyticus (Ssa), S. xylosus (Sxy) and other Gram-negative control bacteria Herbaspirillum huttiense (Hhu), Tenebrionibacter intestinalis (Tin) and Kluyvera intermedia (Kin) were selected and cultured overnight in LB liquid medium. After centrifugation, the OD was adjusted with sterile water. 600 The value is 1. Take 400 μl of bacterial solution and mix it with 1g of wheat bran and feed it to 0.5g of mealworm larvae. After feeding for 6 days, the weight of larvae in each group was measured. Fig. 9 As shown, the results showed that bacteria from the genus Staphylococcus, S. gallinarum, S. kloosii and S. succinus, could significantly promote larval growth.

[0086] 5.4 Effect of Pc protein on the proliferation of Staphylococcus bacteria in vitro

[0087] S. gallinarum, S. succinus and S. kloosii bacteria that can promote the growth of intestinal sterile mealworm larvae were cultured in LB liquid medium containing 20 μg / ml Pc at 32°C and 100 rpm. Samples were taken at different time points to measure OD 600 Value, the result is Fig.10 As shown, the results showed that Pc protein can significantly promote the proliferation of Staphylococcus bacteria.

[0088] Example 6: Analysis of the interaction between Pc protein and bacterial bifunctional autolysin (Atl)

[0089] 6.1 Screening of potential interacting proteins of Pc protein

[0090] S.kloosii was cultured overnight in TSB medium, centrifuged at 10000rpm for 5min, and the supernatant was discarded to collect the cells. An appropriate amount of PBS solution was added to resuspend the cells, and after ultrasonic disruption, the cells were centrifuged at 4°C and 12000rpm for 15min, filtered through a 0.22μm filter membrane, concentrated using a 3kDa ultrafiltration centrifuge tube, and the concentration was determined using a protein quantifier. Based on the plasmid pGEX-GST backbone, the pGEX-GST-Pc protein expression plasmid was designed and constructed according to the specific restriction sites BamHI and XhoI. The plasmid and the empty plasmid were heterologously expressed in the BL21 (DE3) strain, and GST-Pc and GST proteins were purified using GST affinity media. GST protein, GST affinity media, GST-Pc and S.kloosii cell disruption protein solution were mixed, rotated at low speed at room temperature for 3h, and washed with PBS and SDS-PAGE was used to detect potential interacting proteins of Pc protein. The specific protein bands were identified by protein spectrum. The results showed that there were three obvious specific protein bands, and the mass spectrometry identification results were bifunctional autolysin protein (about 143kDa), carbamoyl-phosphate synthetase (about 117kDa) and 2-oxoglutarate dehydrogenase (about 105kDa), among which only the bifunctional autolysin protein Atl was an exogenous protein. It is speculated that Atl is most likely an interacting protein of Pc protein. AlphaFold3 was then used to perform docking experiments between protein molecules, and the results are as follows Fig.11 As shown, it indicates that only Atl can bind to Pc protein.

[0091] 6.2 Verification of Pc protein binding to bifunctional autolysin

[0092] The binding of Pc to Atl was further verified by using GST- and His-tagged fusion proteins to pull down each other. As above, GST-Atl and Atl-His fusion tag proteins were constructed based on the pGEX-GST and pET28a empty plasmid backbones, and GST-Atl and Atl-His proteins were purified using GST affinity medium and Ni affinity medium, respectively. As above, GST-Atl protein was first used to pull down Pc-His, and the experiment was divided into a GST protein blank control group and a GST-Atl treatment group. The control group was mixed with 8 μl of GST protein solution, 160 μl of Pc-His protein solution, 432 μl of PBS-Triton solution and 50 μl of GST affinity medium, and then selectively bound at low speed for 3 h; the treatment group was simply mixed with 200 μl of GST-Atl, 160 μl of Pc-His protein, 240 μl of PBS-Triton solution and 50 μl of GST affinity medium, and then bound at low speed at room temperature for 3 h. Subsequently, GST-Pc protein was used to pull down Atl-His, and the experiment was divided into a GST protein blank control group and a GST-Pc treatment group. The control group mixed 4μl GST protein solution, 160μl Atl-His protein solution, 436μl PBS-Triton solution and 50μl GST affinity medium; the treatment group mixed 80μl GST-Pc protein solution, 160μl Atl-His protein solution, 360μl PBS-Triton solution and 50μl GST affinity medium. Rotate at low speed for 3h at room temperature, wash the medium with 1ml PBS-Triton solution for 3min, centrifuge at low speed for 3min, and repeat the wash 8 times. Add 45μl PBS and 20μl loading buffer to the medium precipitate, heat at 100℃ for 7min, centrifuge briefly, load on SDS-PAGE electrophoresis and detect Pc-His and Atl-His proteins by Western blot. The results are as follows Fig.12 As shown, it was shown that GST-Atl protein can bind to Pc-His and GST-Pc protein can bind to Atl-His.

[0093] 6.3 Effect of Pc protein on Atl enzyme activity

[0094] The effect of Pc protein on the activity of bifunctional autolysin Atl was determined by Atl lysis experiment. Considering that S.kloosii bacteria express and secrete bifunctional autolysin by themselves, rifamycin sodium (RS) was used to eliminate self-interference. First, a rifamycin sodium mother solution with a mother liquor concentration of 4 mg / ml was prepared, and the S.kloosii bacteria cultured overnight were adjusted to OD 600About 0.65, take 1 ml of bacterial solution and add 2μg / ml, 4μg / ml, 8μg / ml rifamycin sodium mother solution respectively, culture at 37℃, 180rpm for 2h, and then measure OD 600 . Based on the measurement results, 4 μg / ml was selected as the addition standard for the subsequent determination of the activity of the bifunctional autolysin enzyme. After inoculating S. kloosii into LB medium for overnight culture, an appropriate amount of bacterial solution was drawn, centrifuged at 6500 rpm for 3 min, washed twice with PBS solution, and the bacterial OD was adjusted with PBS 600 The value of is 1. Four groups were set up in the subsequent experiments, namely CK+rifamycin sodium group, Atl+rifamycin sodium group, Atl+50μg / ml Pc+rifamycin sodium group, Atl+100μg / ml Pc+rifamycin sodium group. Finally, each group was kept at 1ml system and initial OD 600 The value was 0.92 and the concentration of Atl was 100 μg / ml. The samples were placed in a 35°C incubator and the OD was measured at 3, 7 and 11 h. 600 The detailed components added in each group are shown in Table 1. The concentration of Pc protein stock solution was 1 mg / ml, and the concentration of Atl stock solution was 1.4 mg / ml. Fig.13 As shown, it indicates that Pc protein can significantly reduce bacterial autolysis.

[0095] Table 1 The amount of each component added in the experiment of the effect of Pc protein on Atl enzyme activity

[0096]

[0097] 6.4 Effect of Pc protein on iron-related genes in S. kloosii

[0098] Take an appropriate amount of S.kloosi bacteria and add 1ml of RNAiso Plus to resuspend the bacteria, transfer to an RNA extraction tube containing fine zirconium beads, and use a three-dimensional freezing grinder to grind at low temperature and high speed for 5 times, with an interval of 15s each time; place the centrifuge tube on ice for 5 minutes, add 200μl of phenol chloroform isoamyl alcohol 25:24:1, invert and mix, and centrifuge at 12000rpm for 15min. Take 400μl of supernatant and add 400μl of pre-cooled isopropanol, place in a -20℃ refrigerator and let stand for 20min, take it out and centrifuge at 12000rpm for 20min. After removing the supernatant, add 1ml of pre-cooled 75% ethanol, invert and mix, and centrifuge at 12000rpm for 8min, repeat twice. Add 50μl of sterile enzyme-free water to dissolve RNA. Use a nucleic acid concentration meter to measure the RNA concentration, and perform fluorescent quantitative PCR analysis of the target gene after reverse transcription. Six iron-related genes were selected for verification. Among them, Ftp1 and Ftp2 both encode iron ABC transporter permeases (accession numbers: PTJ74169 and PTJ74168); Ftsb encodes iron ABC transporter substrate binding protein (accession number: PTJ74166); Fstsb encodes siderophore ABC transporter substrate binding protein (accession number: PTJ74927); Fctsb encodes ferrochrome ABC transporter substrate binding protein (accession number: PTJ80362) and atl encodes a bifunctional autolysin (accession number: PTJ79456). tufA encoding the elongation factor EF-Tu1 was used as an internal reference gene, and reference 2 (-ΔΔCT) The relative expression of genes was analyzed by the method. Fig.14 As shown, it was shown that Pc protein (20 μg / ml) could down-regulate the expression of iron-related genes.

[0099] Effects of 6.5Pc protein on iron and ROS in S. kloosii cells

[0100] Use TSB liquid medium to adjust the OD of S. kloosii 600 The value is 3. Prepare a stock solution with a concentration of 50 mM FeCl 3 .6H 2O solution, and sterilized by filtration with a 0.22μm filter membrane. The cell iron content determination experiment was divided into 4 groups, namely, blank control group, 50μM Fe group, Pc+50μM Fe group and Pc+100μM Fe group. Each group contained 2.836ml bacterial solution, and the final concentration of protein in the Pc group was 20μg / ml; the volume of each group was adjusted to 3ml using PBS solution. Each group of bacterial solution was placed in a 37℃ incubator for shaking culture for 1h, centrifuged to collect the bacteria, and washed the bacterial solution precipitate twice with ultrapure water. The bacteria were placed in a freeze dryer and freeze-dried and weighed. The bacteria were completely transferred to a glass tube, digested with concentrated nitric acid at 65℃ for 45min, placed in a 90℃ metal heater to volatilize nitric acid, and then 5ml of deionized water was added to fully dissolve it. A 0.22μm filter membrane was used to determine the iron content of each group of samples using ICP. Similarly, the cellular ROS content assay was divided into three groups: blank control group, 50 μM Fe group, and Pc+50 μM Fe group. TSB liquid medium was used to adjust the OD of S. kloosii 600 The value was 2. 1.9 ml of bacterial solution was added to each group. The final concentration of protein in the Pc group was 20 μg / ml; PBS was used to adjust the final volume of each group to 2 ml. After 1 hour of culture, the OD of each group was measured. 600 The values ​​were obtained, and 900 μl of bacterial solution was taken out to measure the intracellular ROS content using the ROS assay kit, and the remaining 900 μl of bacterial solution was used to measure the protein content. The ROS content of each group was normalized using the protein content. The experimental results are shown in Fig.15 As shown, it was shown that under 50 μM Fe conditions, Pc protein could significantly promote bacterial proliferation and reduce bacterial cell iron content and ROS pressure.

[0101] Example 7: Effect of Pc protein on intestinal flora of normal mice

[0102] Six-week-old normal disease-free male mice (C57BL / 6J) were selected as the gavage model and divided into a control group and a Pc treatment group (6 mice in each group). The control group was gavaged with 200 μl PBS every day, and the treatment group was gavaged with 200 μl Pc protein (250 μg / ml) every day. After 7 consecutive days of gavage, the mouse feces were collected and the intestinal bacterial abundance was determined by 16S amplicon sequencing. Fig.16 As shown, Pc protein also plays a regulatory role in the regulation of intestinal microorganisms in mammalian mice. This protein can regulate the significant proliferation of Lachnospiraceae bacteria in the intestines of normal disease-free mice.

[0103] According to the UniProt protein database, Lachnospiraceae bacteria have bifunctional autolysins. Given that Pc protein mainly binds to the conserved GL domain, in order to verify whether Pc protein binding to the GL domain is universal, other bacteria (including Lachnospiraceae bacteria) with bifunctional autolysins or exosome-type GL domain proteins were investigated, and bifunctional autolysins or exosome-type GL domain-containing proteins of representative strains (as shown in Table 2) were selected for molecular docking with Pc protein. The molecular docking results of AlphaFold3 are shown in Figure 2. Fig.17 As shown, it shows that in addition to the bifunctional autolysins of a few bacteria with potential pathogenic characteristics that can achieve molecular docking with Pc protein, most bifunctional autolysins or exotype GL domain-containing proteins of probiotic bacteria that can be used in food can also achieve molecular docking with Pc protein. This shows that the binding of Pc protein to bacterial bifunctional autolysins or exotype GL domain-containing proteins has a universal effect. Considering that some Staphylococcus bacteria are pathogenic or opportunistic pathogens, such as Staphylococcus aureus, the effect of Pc protein on the biofilm formation of pathogenic Staphylococcus aureus was further explored, and the results are shown in the figure. Fig.18 As shown, Pc protein can significantly reduce the formation of pathogenic biofilm. This result further proves the safety of Pc protein in regulating intestinal microorganisms and promoting host health and growth.

[0104] Table 2 Molecular simulation docking information of Pc protein and exocytic GL domain-containing proteins of various bacteria

[0105]

[0106]

[0107] Example 8: Effects of Pc protein on high-fat diet-induced obese (DIO) mice

[0108] 11-week-old male mice (C57BL / 6J background) purchased from Weitong Lihua Company (China) and induced with a high-fat diet (feed: XTHF60) for 6 weeks since 5 weeks of age were selected as the gavage model and divided into a control group (CK) and a Pc treatment group (8 mice in each group). After grouping, the mice were adaptively fed in an SPF-grade mouse house facility for 7 days; subsequently, the control group was gavaged with 200 μl PBS every day, and the treatment group was gavaged with 200 μl Pc protein (250 μg / ml) every day for 33 consecutive days. During the entire 40-day feeding period (such as Fig.19a) The mice were weighed every 2 days. After 40 days, the subcutaneous fat, visceral fat, epididymal white fat, intestinal fat, liver and feces of the mice were collected. The wet weight of each fat and the size of epididymal white adipocytes were measured; the liver tissue was stained with H&E and ORO respectively; the fresh feces of the mice were sequenced by 16S amplicon to determine the abundance of intestinal bacteria. The results are shown in Fig.19 As shown, 7 days before oral administration of Pc protein, there was no significant difference in the body weight of mice in each group (e.g. Fig.19 b); Pc protein can significantly reduce the weight gain of high-fat diet obese mice (such as Fig.19 c); it can also significantly reduce the accumulation of body fat, the size of epididymal adipocytes, and the accumulation of liver fat (such as Fig.19 dg); the results of 16S amplicon sequencing of intestinal bacteria showed (such as Fig.19 h), Pc protein can significantly enrich the Blautia bacteria in the intestines of DIO mice, and a large number of literature reports have shown that this genus of bacteria can effectively alleviate obesity.

[0109] Example 9: Effect of Pc protein on DSS-induced colitis (UC) mice

[0110] Five-week-old C57BL / 6J male mice purchased from Weitong Lihua Company (China) were divided into a control group (CK), a DSS group, and a DSS+Pc group, with 8 mice in each group. After grouping, the mice were adaptively fed in an SPF-grade mouse house facility for 7 days; in the second week, the DSS group was gavaged with 200 μl PBS every day, and the DSS+Pc group was gavaged with 200 μl Pc protein (250 μg / ml) every day; in the third week, the mice in the DSS group and the DSS+Pc group drank 3% DSS aqueous solution freely every day, and the DSS group was gavaged with 200 μl PBS every day, and the DSS+Pc group was gavaged with 200 μl Pc protein (250 μg / ml) every day (as Fig. 20 a). Within 14 days before DSS treatment, the body weight of mice in each group was measured every 2 days; during DSS treatment, the body weight of mice was measured every day, and the softness and hardness of the feces and blood in the feces were recorded. After 7 days of DSS treatment, the spleen of mice was collected and measured to calculate the spleen index (ratio of spleen weight to body weight); the colon tissue of mice was collected, its length was measured and paraffin-embedded sections were used for H&E staining; fresh feces of mice were collected for 16S amplicon sequencing to determine the abundance of intestinal bacteria. The results are shown in Fig. 20 As shown, there was no difference in the weight changes of mice in each group within 2 weeks before DSS induction (e.g. Fig. 20 b); After 4 days of DSS treatment, the weight of mice decreased significantly, but Pc treatment could effectively alleviate the weight loss (e.g. Fig. 20 c); At the same time, Pc protein can significantly reduce the disease index of mice induced by DSS (such as Fig. 20 d) Relieve colon shortening (such as Fig. 20e,f), reduce spleen index (such as Fig. 20 g, h) and relief of colonic lesions, such as reduction of marked epithelial degeneration, crypt destruction, extensive focal ulceration, and inflammation (e.g. Fig. 20 i); The results of intestinal bacterial abundance determination showed that Pc protein could significantly enrich Akkermansia bacteria in the intestines of colitis mice (such as Fig. 20 j). A large number of literature reports that Akkermansia bacteria can effectively relieve colitis, regulate immune response and maintain intestinal health as an intestinal barrier. It can be seen that Pc protein can relieve colitis and maintain intestinal health.

[0111] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and cannot be considered to limit the scope of implementation of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. Application of exocytic protein Pc in regulating intestinal flora.

2. The use according to claim 1, characterized in that: The exocytic protein Pc regulates proteins with exocytic properties and containing the β-N-acetylglucosaminidase (GL) domain, promoting the proliferation of bacteria containing proteins with exocytic properties and containing the β-N-acetylglucosaminidase (GL) domain.

3. The use according to claim 2, characterized in that: Proteins with exocytic properties and containing β-N-acetylglucosaminidase (GL) domain are autolysins.

4. The use according to claim 3, characterized in that: Pc protein binds to the β-N-acetylglucosaminidase domain of autolysin, thereby inhibiting the enzymatic activity of autolysin, resulting in the obstruction of cell wall degradation during cell division.

5. The use according to claim 4, characterized in that: Down-regulate the expression of genes related to iron absorption, reduce cellular iron absorption and alleviate cellular ROS pressure.

6. The use according to claim 1, characterized in that: The Pc protein promotes the proliferation of one or more of the bacteria of the genus Staphylococcus, the bacteria of the family Lachnospiraceae, the bacteria of the genus Blautia of the family Lachnospiraceae, and the bacteria of the genus Akkermansia; Preferably, the Pc protein promotes the enrichment of beneficial bacteria of the genus Staphylococcus in the insect gut; Preferably, the Pc protein promotes the enrichment of beneficial bacteria of the Lachnospiraceae family in the intestines of healthy mammals; Preferably, the Pc protein promotes the enrichment of Blautia bacteria in the intestines of obese mice induced by a high-fat diet; Preferably, Pc protein promotes the enrichment of Akkermansia bacteria in the intestines of mice with DSS-induced colitis.

7. The use according to claim 1, characterized in that: Inhibits biofilm formation of Staphylococcus aureus S. aureus with a bifunctional autolysin.

8. An additive, characterized in that: It includes one or more of the exogenous protein Pc, natural microorganisms containing Pc protein, and engineered bacteria capable of heterologously expressing Pc protein; Preferably, the natural microorganism containing Pc protein is Penicillium herquei cultivated by Polygonum cuspidatum leaf weevil; Preferably, a vector engineering bacterium for heterologously expressing Pc protein is constructed, the engineering bacterium is cultured, and the expression of Pc protein is induced by BL21 (DE3); primary Pc protein is preliminarily purified using a nickel affinity purification column, and then eluted using a Tris-HCl (pH 7.8-8.0) solution containing 0.2 M sodium chloride through a DEAE-Sepharose FF anion exchange column to obtain Pc protein.

9. The additive according to claim 8, characterized in that: Can be used in food, feed or medicine; Preferably, it is used in health food.

10. Application of exocrine protein Pc in drugs for the treatment of enteritis.

Images