Application of hnRNP A1 and composition for treating drug-resistant melanoma

Abstract

The invention relates to the field of malignant melanoma treatment, and discloses application of hnRNP A1 and a composition for treating drug-resistant melanoma. The research finds that the mRNA and protein levels of the hnRNP A1 are reduced, so that the treatment of vimofenib generates drug resistance, and meanwhile, the capability of killing melanoma cells by T cells can be weakened. And the hnRNP A1 is over-expressed in a vimofenib drug-resistant A375-VR cell line and a cytotoxic T cell drug-resistant A375-TR cell line, so that the drug resistance to vimofenib can be reduced, and the tolerance to CD8 + T cell cytotoxicity can be reduced. In addition, experiments prove that patients with low hnRNP A1 expression are related to EFS shortening. The results show that the hnRNP A1 has a key effect in the aspect of mediating a multi-effect drug resistance mechanism of the melanoma, and a new theoretical basis can be provided for analysis, detection and treatment of the drug-resistant melanoma.

Description

Technical Field

[0001] The present application relates to the field of malignant melanoma treatment, and in particular to the application of hnRNP A1 and a composition for treating drug-resistant melanoma. Background Art

[0002] Malignant melanoma is a highly malignant tumor that is prone to lymph node metastasis and distant metastasis, with a high mortality rate, accounting for 75% of all skin malignancies. In addition to the skin, malignant melanoma can also occur in mucosa (including colorectal mucosa, nasal mucosa, etc.), extremities, uveal tract, etc.

[0003] The MAPK pathway plays an important role in malignant melanoma. It is mainly composed of RAS / RAF / MEK / ERK, which can transmit extracellular signals, including hormones, cytokines, growth factors, etc., to the cell nucleus, thereby changing cell gene expression to regulate cell proliferation, differentiation, and apoptosis. Since the discovery of BRAF mutation in 2002, dozens of mutation types have been detected. 95% of mutations are caused by a missense mutation in exon 15, that is, the thymine at the 1799th nucleotide mutates to adenosine (T>A), which leads to a mutation at the protein level, with valine (V) replacing glutamic acid (E) at amino acid 600. This mutation is called BRAF V600E. The BRAF V600E mutation increases the activity of BRAF by 500 times, resulting in increased activity of downstream MEK and ERK, thereby activating the entire MAPK pathway.

[0004] BRAF inhibitors developed for BRAF V600E mutation have achieved good efficacy in malignant melanoma and are widely used in clinical practice. Typical representative drugs include vemurafenib, dabrafenib, and encorfenib, among which vemurafenib was the first to be used in clinical practice. The BRIM-3 clinical study compared the efficacy of vemurafenib and dacarbazine. At 6 months of treatment, the overall survival rate of the vemurafenib group was 84%, and the overall survival rate of the dacarbazine group was 64%. The remission rate of vemurafenib was 48%, and that of dacarbazine was 5%. Based on the good trial results of BRIM-3, vemurafenib was approved by the US FDA in August 2011 for the treatment of BRAF V600E mutation-positive malignant melanoma.

[0005] However, most patients will develop resistance to BRAF inhibitors, including vemurafenib, within one year of taking the drugs. Even combined use of MEK inhibitors can only delay the onset of resistance, but cannot avoid the onset of resistance. There is currently no recognized biomarker that can predict the efficacy of targeted therapy. In addition, vemurafenib and other BRAF inhibitors have some common resistance mechanisms when used alone or in combination with MEK inhibitors. Understanding these resistance mechanisms is of great significance for overcoming the resistance to BRAF inhibitors and improving the prognosis of melanoma patients. How to overcome the resistance of malignant melanoma to the BRAF inhibitor vemurafenib has become a major research hotspot.

[0006] In addition to targeted therapy, immunotherapy has also become one of the main treatment methods for patients with malignant melanoma. The KEYNOTE001 trial is the earliest clinical trial of pembrolizumab in patients with malignant melanoma. According to the latest follow-up results, among 655 advanced patients, the OS of all patients and first-line patients were 23.8 months and 38.6 months, respectively, and the median PFS was 8.3 months and 16.9 months, respectively. In the KEYNOTE054 trial comparing the efficacy of pembrolizumab and placebo, compared with placebo treatment, at a median follow-up of 42.3 months, the 3.5-year metastasis-free survival rate of the pembrolizumab treatment group was 65.3%, and that of the placebo group was 49.4%, which was statistically significant.

[0007] However, there are still some patients with malignant melanoma who cannot benefit from immunotherapy, or whose disease progresses in the early stages of treatment and who develop resistance to immunotherapy. Currently, there is no unified, recognized biomarker to predict the efficacy of immunotherapy, so it is impossible to predict which patients will benefit from immunotherapy before immunotherapy. In addition, finding the mechanism of resistance to immunotherapy in malignant melanoma is also important for improving the prognosis of patients with malignant melanoma. Summary of the invention

[0008] In view of this, the purpose of the present application is to provide an application of hnRNP A1, by targeting hnRNP A1, revealing the key pleiotropic effects of related research in regulating the resistance of melanoma cells to BRAF inhibitors (such as vemurafenib) and T cell-mediated cytotoxicity, thereby providing new related drugs for the treatment of drug-resistant melanoma.

[0009] In order to achieve the above object or partially achieve the above object, as a first aspect of the present application, a use of hnRNPA1 as a target in the preparation of a drug for treating drug-resistant melanoma is provided.

[0010] Optionally, the drug-resistant melanoma includes a melanoma resistant to vemurafenib and / or a melanoma resistant to T cell killing.

[0011] Further optionally, the drug-resistant melanoma includes a melanoma having a BRAF V600E mutation.

[0012] Optionally, the drug for treating drug-resistant melanoma includes targeted drugs and immune preparations.

[0013] As a second aspect of the present application, a method for preparing a drug for treating drug-resistant melanoma is provided, wherein hnRNP A1 is used as a target, melanoma cells with hnRNP A1 knocked out or knocked down are artificially designed in vitro, and the melanoma cells are used as experimental subjects to screen and / or design drugs that can increase the expression level of hnRNP A1.

[0014] As a third aspect of the present application, provided is the use of any one or more of a drug for promoting the expression of hnRNP A1 and a vector for overexpressing hnRNP A1 in the preparation of a drug for treating drug-resistant melanoma.

[0015] As a fourth aspect of the present application, a composition for combined treatment of drug-resistant melanoma is provided, comprising any one or more components of a drug that promotes the expression of hnRNP A1, a vector that overexpresses hnRNP A1, and any one or more components selected from miR-18a mimics, a drug that promotes the expression of miR-18a, a BRAF inhibitor, a MEK inhibitor, an AJUBA inhibitor, a YAP inhibitor, a THBS1 inhibitor, and a CD47 inhibitor.

[0016] Optionally, the inhibitor includes siRNA that reduces the expression level of AJUBA, YAP, THBS1, and CD47, or includes a drug that reduces the activity of AJUBA, YAP, THBS1, and CD47.

[0017] Optionally, the BRAF inhibitor includes vemurafenib, and the MEK inhibitor includes trametinib.

[0018] As a fifth aspect of the present application, provided is the use of a reagent for detecting a biomarker in the preparation of a product for predicting the efficacy of targeted therapy and immunotherapy for malignant melanoma, wherein the biomarker includes hnRNP A1.

[0019] This study found that hnRNP A1 的 Reduced mRNA and protein levels lead to resistance to vemurafenib treatment and also impair the ability of T cells to kill melanoma cells. Overexpression of hnRNP A1 in vemurafenib-resistant A375-VR and cytotoxic T cell-resistant A375-TR cell lines alleviated resistance to vemurafenib and reduced CD8+ Tolerance to T cell cytotoxicity. In addition, the experiments in this application have shown that patients with low hnRNP A1 expression are associated with shortened EFS. The above results indicate that hnRNP A1 plays a key role in mediating the pleiotropic drug resistance mechanism of melanoma, and can provide a new theoretical basis for the analysis, detection and treatment of drug-resistant melanoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The drawings constituting a part of the present application are used to provide a further understanding of the present application. The illustrative embodiments and descriptions of the present application are used to explain the present application and do not constitute an improper limitation on the present application.

[0021] Figure 1 Shown are the construction of the vemurafenib-resistant cell line A375-VR and the T cell-tolerant cell line A375-TR; A: The construction process of A375-VR and A375-TR; B: Cell proliferation of A375 and A375-VR with the addition of vemurafenib; C: Cell proliferation of A375 and A375-TR treated with T cells;

[0022] Figure 2 Shown are the RT-qPCR results (A, B) and Western blot results (C) of wild-type A375, vemurafenib-resistant cell line A375-VR, and T cell-tolerant cell line A375-TR;

[0023] Figure 3 Shown are the results of normal expression and overexpression of hnRNP A1 in A375-VR and A375-TR cell lines; A: protein level verification of normal expression and overexpression of hnRNPA1 in A375-VR and A375-TR cell lines; B: mRNA level verification of normal expression and overexpression of hnRNPA1 in A375-VR and A375-TR cell lines; -: normal expression; +: overexpression;

[0024] Figure 4 The figure shows the CCK8 experiment comparing the cell proliferation of hnRNPA1-overexpressing A375-VR cell line (A) and A375-TR cell line (B); A375 is a wild-type cell line, A375-VR is a vemurafenib-resistant cell line, A375-TR is a T cell-tolerant cell line, A375-VR-hnRNPA1 is an A375-VR cell line overexpressing hnRNPA1, and A375-TR-hnRNPA1 is an A375-TR cell line overexpressing hnRNPA1;

[0025] Figure 5The figure shows the effect of hnRNPA1 expression on the prognosis of melanoma patients receiving BRAFi / MEKi targeted therapy; Not down represents the results of patients with high expression of hnRNPA1, and Down represents the results of patients with low expression of hnRNPA1;

[0026] Figure 6 Shown are the results of hnRNP A1 protein levels assessed by IHC staining analysis (A) and the results of patients grouped according to hnRNPA1 expression levels determined by IHC and associated with reduced EFS during targeted therapy and immunotherapy (B). DETAILED DESCRIPTION

[0027] The present application discloses the application of hnRNP A1 and a composition for treating drug-resistant melanoma. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly pointed out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all deemed to be included in this application. The products and processes described in this application have been described through preferred embodiments. Relevant personnel can obviously modify or appropriately change and combine the products and processes described in this article without departing from the content, spirit and scope of this application to implement and apply the technology of this application. Obviously, the described embodiments are part of the embodiments of this application, not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.

[0028] It should be noted that, in this article, if relational terms such as "first" and "second", "step 1" and "step 2", and "(1)" and "(2)" appear, they are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "comprise", "include" or any other variants thereof are intended to cover non-exclusive inclusion, so that the process, method, article or equipment including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or equipment. In the absence of further restrictions, the elements defined by the sentence "comprise one..." do not exclude the presence of other identical elements in the process, method, article or equipment including the elements. At the same time, the embodiments in this application and the features in the embodiments may be combined with each other without conflict.

[0029] Heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) is a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. It is an RNA-binding protein that can bind to mRNA to form a complex, thereby participating in the regulation of mRNA splicing, transcription, translation and other processes, and plays a role in development, cancer, neurodegenerative diseases and other processes. hnRNPA1 is mainly located in the cell nucleus and contains two regions, namely the N-terminus that can interact with RNA and the C-terminus that can bind to RNA. The C-terminus is rich in glycine residues and contains an RNA motif and a nuclear targeting sequence. This nuclear targeting sequence is called M9, which allows hnRNPA1 to shuttle back and forth between the nucleus and the cytoplasm.

[0030] hnRNPA1 has multiple functions in both DNA and RNA metabolism, including affecting transcription, participating in mRNA splicing, nucleocytoplasmic shuttling, and microRNA biosynthesis. The role of hnRNPA1 in tumors is still controversial. Some studies have shown that hnRNPA1 can promote tumor metastasis, while other studies have reached the opposite conclusion. For example, in chronic lymphocytic leukemia, hnRNPA1 overexpression can promote cell proliferation and inhibit apoptosis. The study by Han et al. showed that knockout of hnRNPA1 in lung cancer led to enhanced migration, invasion, and epithelial-mesenchymal (EMT) of lung cancer cells. This complexity suggests that the role of hnRNPA1 in tumors may depend on specific cell types, tumor stages, and microenvironmental factors.

[0031] In-depth study of the specific mechanism of action of hnRNPA1 in different tumor types and the development of precision medicine will help to better understand its role in tumor development and may provide targets for the development of new treatment strategies. In addition, exploring the interaction between hnRNPA1 and other molecules and its function in the tumor microenvironment may also reveal new therapeutic intervention points and bring new hope for tumor treatment.

[0032] In order to verify the key role of hnRNP A1 in mediating the pleiotropic drug resistance mechanism of melanoma, the present invention treated A375 cells with increasing doses of vemurafenib or activated CD8 + The proportion of T cells increased (corresponding to the A375-VR group and the A375-TR group, see Figure 3-A) Established an acquired tolerance model, and the results showed that both the vemurafenib-resistant strain (A375-VR group) and the T cell cytotoxicity-resistant strain (A375-TR group) showed a sustained tolerance effect, even after stopping drug induction, this persistent drug and T cell tolerance effect was still present ( Figure 3 -B, C).

[0033] In certain embodiments of the present application, RT-qPCR and Western blot analysis performed simultaneously on the A375-VR group and the A375-TR group showed that the hnRNP A1 mRNA and protein levels in the vemurafenib-resistant A375-VR and cytotoxic T cell-resistant A375-TR cell lines were downregulated compared with the wild-type A375 cells ( Figure 2 This observation suggests that hnRNPA1 is a potential regulator of dual drug resistance in melanoma.

[0034] In certain embodiments of the present application, the core region of the mRNA CDs sequence of hnRNP A1 was synthesized by BGI and cloned into the overexpression vector plvx-FLAG-puro (purchased from Suzhou Genema Gene). The hnRNP A1 overexpression vector was packaged by lentivirus to infect A375-VR and A375-TR cell lines to construct A375-VR / TR stable overexpression cell lines. Figure 3 The results showed that hnRNPA1 was overexpressed in A375-VR and A375-TR cell lines, and the A375-VR cell line A375-VR-hnRNPA1 overexpressing hnRNPA1 and the A375-TR cell line A375-TR-hnRNPA1 overexpressing hnRNPA1 were successfully constructed, and the expression of hnRNPA1 was verified at the protein level and mRNA level.

[0035] Figure 4 The results showed that the enhancement of hnRNPA1 expression alleviated the resistance to vemurafenib and reduced the tolerance to CD8+ T cell cytotoxicity, indicating that hnRNPA1 overexpression reversed vemurafenib resistance and T cell tolerance and played a regulatory role in the treatment of drug resistance. Figure 4 -A In the case of adding vemurafenib, the cell proliferation of A375-VR was significantly higher than that of A375, while the cell proliferation of A375-VR-hnRNPA1 was significantly lower than that of A375-VR. Moreover, with the increase of vemurafenib concentration, the trend of A375-VR-hnRNPA1 cell proliferation being lower than that of A375-VR became more obvious. Figure 4-B results showed that A375-TR and A375-TR-hnRNPA1 were co-cultured with T cells, and it was found that the cell proliferation of A375-TR was significantly higher than that of A375, while the cell proliferation of A375-TR-hnRNPA1 was significantly lower than that of A375-TR. In addition, as the proportion of T cells increased, the trend of A375-TR-hnRNPA1 cell proliferation being lower than that of A375-TR became more obvious.

[0036] Figure 5 The results showed that hnRNPA1 expression can affect the prognosis of patients receiving targeted therapy. Patients with high hnRNPA1 expression had better survival than those with low hnRNPA1 expression, and the difference was statistically significant.

[0037] The hnRNP A1 protein level was evaluated by IHC staining analysis, and the patient samples were divided into two groups (high expression and low expression). Figure 6 The results showed that the prognosis of patients with high expression of hnRNPA1 was significantly lower than that of patients with high expression of hnRNPA1.

[0038] According to all the above verification test results, in the first aspect of the present application, the use of hnRNPA1 as a target in the preparation of a drug for treating drug-resistant melanoma is provided. Among them, the Chinese name of hnRNP A1 is heterogeneous nuclear ribonucleoproteins A1, which has a well-known sequence and meaning in the art and will not be repeated here.

[0039] In certain embodiments of the present application, the drug-resistant melanoma includes a melanoma that is resistant to vemurafenib and / or a melanoma that is resistant to T cell killing, and the drug for treating drug-resistant melanoma includes a targeted drug and an immune preparation. Furthermore, the drug-resistant melanoma includes a melanoma with a BRAF V600E mutation. According to the key role of hnRNP A1 in drug-resistant melanoma in the present application, in the actual drug development process, the hnRNP A1 target can be used to develop related drugs in vitro. Therefore, in the second aspect of the present application, a method for preparing a drug for treating drug-resistant melanoma is provided, using hnRNP A1 as a target, artificially designing melanoma cells that knock out or knock down hnRNP A1 in vitro, using the melanoma cells as experimental subjects, and screening and / or designing drugs that can increase the expression level of hnRNP A1.

[0040] In the process of drug development, artificial design can be used through biotechnology means, including but not limited to gene silencing, gene knockout, etc., to construct melanoma cells with target phenotypes in vitro for drug screening and verification.

[0041] Based on the positive effect of the hnRNP A1 target in drug-resistant melanoma, drug-resistant melanoma can be treated by increasing its level and activity in the body, including but not limited to targeted therapy and immunotherapy. Therefore, in the third aspect of the present application, there is provided the use of any one or more of a drug that promotes the expression of hnRNP A1 and a vector that overexpresses hnRNP A1 in the preparation of a drug for treating drug-resistant melanoma.

[0042] In the previous prior application 202411382813.1 (Application of miR-18a and its downstream targets and compositions for treating drug-resistant melanoma), multiple studies have verified the potential of miR-18a or its downstream targets AJUBA, YAP, THBS1, and CD47 as biomarkers for targeted therapy and immunotherapy of malignant melanoma and the possibility of using them as therapeutic targets to overcome drug resistance. The specific mechanism by which miR-18a causes resistance to targeted therapy or immunotherapy is also revealed, namely, drug resistance can be generated or eliminated by regulating the expression of corresponding downstream key target proteins. The relevant records in the prior application can be used as the content of this application and will not be repeated here. To this end, in the fourth aspect of the present application, a composition for combined treatment of drug-resistant melanoma is provided, comprising any one or more components selected from a drug that promotes the expression of hnRNP A1, a mimetic of hnRNP A1, and a vector that overexpresses hnRNP A1, and any one or more components selected from miR-18a mimics, a drug that promotes the expression of miR-18a, a BRAF inhibitor, a MEK inhibitor, an AJUBA inhibitor, a YAP inhibitor, a THBS1 inhibitor, and a CD47 inhibitor. The composition can be used in combination, and the application methods include but are not limited to sequential use, use together, etc.

[0043] Wherein, the inhibitor includes siRNA that reduces the expression level of AJUBA, YAP, THBS1, and CD47, or includes drugs that reduce the activity of AJUBA, YAP, THBS1, and CD47, for example, the drug that reduces the activity of YAP can be selected as verteporfin. The BRAF inhibitor includes vemurafenib, and the MEK inhibitor includes trametinib.

[0044] The siRNA for silencing AJUBA in the prior application can be selected from any one of the following:

[0045] (1) Sense strand: GCACCUGUAUCAAGUGCAATT; Antisense strand: UUGCACUUGAUACAGGUGCTT; as shown in SEQ ID No. 1-2;

[0046] (2) Sense strand: GGACCGGGAUUAUCACUUUTT; Antisense strand: AAAGUGAUAAUCCCGGUCCTT; as shown in SEQ ID No. 3-4;

[0047] (3) Sense strand: GGCUUUCUACAGUGUCAAUTT; antisense strand: AUUGACACUGUAGAAAGCCTT; shown in SEQ ID No. 5-6.

[0048] Note: Since the ST.26 standard sequence table creation software needs to replace the base U with T when creating RNA sequences, the actual sequence shall be subject to the instructions (the same below).

[0049] The siRNA for knocking down THBS1 in the prior application can be selected from any one of the following:

[0050] (1) Sense strand: GCCUGAUGACAAGUUCCAATT; Antisense strand: UUGGAACUUGUCAUCAGGCTT; as shown in SEQ ID No. 7-8;

[0051] (2) Sense strand: GGUUUCCUCCUUCUGGCAUTT; Antisense strand: AUGCCAGAGGAGGAAACCTT; as shown in SEQ ID No. 9-10;

[0052] (3) Sense strand: GCGUGAAGUGUACUAGCUATT; Antisense strand: UAGCUAGUACACUUCACGCTT; as shown in SEQ ID No. 11-12;

[0053] (4) Sense strand: CCAACAAACAGGUGUGCAATT; antisense strand: UUGCACACCUGUUUGUUGGTT; as shown in SEQ ID No. 13-14.

[0054] Citing the description of miR-18a mimics in the prior application, the miR-18a mimics include miR-18a-5p and / or miR-18a-3p mimics, which are artificially synthesized RNA reagents with the same sequence as endogenous miR-18a, miR-18a-5p, and miR-18a-3p. The miR-18a-5pmimic has any one of the following sequences:

[0055] (1) UAAGGMGCAUCUAGMGCAGAUAG; shown in SEQ ID No. 15;

[0056] (2) AUCΜGCACUAGAΜGCACCUUAUU; shown in SEQ ID No.16;

[0057] The miR-18a-3p mimic has any one of the following sequences:

[0058] (1) ACMGCCCUAAGMGCUCCUUCMGG; shown in SEQ ID No. 17;

[0059] (2) AGAAGGAGCACUUAGGGCAGUUU; shown in SEQ ID No. 18;

[0060] Here, M represents a degenerate base, which is A or C.

[0061] According to the above-mentioned experimental results, the present application has found the potential of hnRNP A1 as a biomarker for targeted therapy and immunotherapy of malignant melanoma and the possibility of it as a therapeutic target for overcoming drug resistance, that is, drug resistance can be generated or eliminated by regulating the expression of hnRNP A1. Therefore, in the fifth aspect of the present application, a reagent for detecting biomarkers is provided for the preparation of a product for predicting the efficacy of targeted therapy and immunotherapy of malignant melanoma, wherein the biomarker includes hnRNP A1.

[0062] In each group of comparative experiments provided in the present application, if not otherwise specified, except for the differences indicated in each group, other experimental conditions, materials, etc. are kept consistent so as to be comparable. In addition, materials used in the present application can be purchased and obtained through commercial channels. The above is only a specific implementation mode of the present application, so that those skilled in the art can understand or implement the present application. It will be apparent to those skilled in the art that various modifications to these embodiments, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown in this article, but will comply with the widest scope consistent with the principles and novel features applied for herein.

Claims

1. Application of hnRNP A1 as a target in the preparation of drugs for the treatment of drug-resistant melanoma.

2. The use according to claim 1, characterized in that: The drug-resistant melanoma includes a melanoma that is resistant to vemurafenib and / or a melanoma that is resistant to T cell killing.

3. The use according to claim 1 or 2, characterized in that: The drug-resistant melanoma includes melanoma with BRAFV600E mutation.

4. The use according to claim 1, characterized in that: The drugs for treating drug-resistant melanoma include targeted drugs and immune preparations.

5. A method for preparing a drug for treating drug-resistant melanoma, characterized in that: Taking hnRNP A1 as a target, melanoma cells with hnRNP A1 knockout or knockdown are artificially designed in vitro, and the melanoma cells are used as experimental subjects to screen and / or design drugs that can increase the expression level of hnRNP A1.

6. Use of any one or more of a drug for promoting hnRNP A1 expression and a vector for overexpressing hnRNP A1 in the preparation of a drug for treating drug-resistant melanoma.

7. A combination composition for treating drug-resistant melanoma, characterized in that: The invention comprises any one or more components selected from the group consisting of a drug for promoting the expression of hnRNP A1 and a vector for overexpressing hnRNP A1, and any one or more components selected from the group consisting of a miR-18a mimic, a drug for promoting the expression of miR-18a, a BRAF inhibitor, a MEK inhibitor, an AJUBA inhibitor, a YAP inhibitor, a THBS1 inhibitor, and a CD47 inhibitor.

8. The use according to claim 7, characterized in that: The inhibitor includes siRNA that reduces the expression level of AJUBA, YAP, THBS1, and CD47, or includes drugs that reduce the activity of AJUBA, YAP, THBS1, and CD47.

9. The composition according to claim 7, characterized in that The BRAF inhibitor includes vemurafenib, and the MEK inhibitor includes trametinib.

10. Use of a reagent for detecting biomarkers in the preparation of a product for predicting the efficacy of targeted therapy and immunotherapy for malignant melanoma, characterized in that: The biomarkers include hnRNP A1.

Images