Application of circRNA 3254 in preparation of preparation or medicine for preventing early apoptosis of transplanted islet cells

Abstract

The invention provides application of circRNA 3254 in preparation of a preparation or a medicine for preventing early apoptosis of transplanted islet cells, belongs to the technical field of islet transplantation, and aims to solve the important problems of relieving the early transplanted islet apoptosis, improving the transplanted islet function and prolonging the time of completely separating from insulin after transplantation in the current islet transplantation field. A circRNA sequencing result finds that circRNA participates in a process of improving the curative effect of transplanted pancreas islet by bone marrow mesenchymal stem cells (BMSCs) for the first time, and circRNA 3254 which is not reported in literatures is screened as a research target. The specific regulation effect of circRNA 3254 on the apoptosis condition of the early transplanted pancreas islet is verified in in-vivo and in-vitro models for the first time, and a mechanism network for improving the survival rate of the transplanted pancreas islet by the BMSCs is further improved. The specific regulation effect of circRNA 3254 on the apoptosis condition of the early transplanted pancreas islet is verified in in-vivo and in-vitro models for the first time, and a mechanism network for improving the survival rate of the transplanted pancreas islet by the BMSCs is further improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of islet transplantation, and specifically relates to the application of circRNA3254 in preparing a preparation or a medicine for preventing early apoptosis of transplanted islet cells. Background Art

[0002] Diabetes is currently increasing at a very fast rate around the world, bringing huge medical and economic burdens every year. Globally, diabetes affects more than 382 million people and is expected to increase to 642 million by 2040. The prevalence of diabetes in China has increased from less than 1% in 1980 to 10.9% in 2013, and the latest statistics show that the prevalence of diabetes in my country has risen to 12.4% and is still increasing. Islet transplantation has the advantages of less invasiveness, simple operation and fewer complications, and has developed rapidly in recent years.

[0003] At present, there is a large amount of experimental data showing that islet transplantation is a safe and effective treatment for diabetes. Although clinical and basic research on islet transplantation has made good progress in recent years, there are still many problems that affect the efficacy of islet transplantation and hinder its widespread clinical application.

[0004] (1) Insufficient source of pancreatic islet cells

[0005] Organ shortage is a major problem currently faced by all organ and cell transplants, and is particularly prominent in islet transplantation, which requires islet cells to be isolated and extracted from the pancreas. Since islet cells themselves only account for 1%-2% of the total volume of the pancreas, in order to ensure the effectiveness of islet transplantation, islet cells from 3-4 donor pancreases need to be isolated for one transplant. It is reported that even in some experienced transplant centers, about 18% of islet cells are still lost after purification, and only less than half of the islet cells can meet the transplantation standards after separation. With the continuous improvement of separation and purification technology, some centers can now transplant a single pancreas donor to a single recipient.

[0006] (2) Seeking the best transplant site

[0007] Existing clinical transplantation programs have achieved certain improvements, but the selection of the best transplantation site is still under debate. After transplantation into the human body, the environment in which the islet cells are located plays a crucial role in their short-term and long-term survival and insulin secretion function. Therefore, finding the best site for islet transplantation is one of the current priorities.

[0008] (3) Improving the microenvironment of pancreatic islet transplantation

[0009] In addition to the selection of transplantation sites, researchers are also committed to creating a better microenvironment for transplanted islet cells. During the separation and extraction of islet cells, the chemical digestion of collagenase and mechanical physical stimulation destroy the microenvironment of natural islet cells. Transplanted islet cells lose the extracellular matrix (ECM) and rich vascular support, causing severe ischemia and hypoxia in the early stage of islet cells.

[0010] (4) Inhibit immune rejection

[0011] Immunology has confirmed that autoreactive T cells and B cells are involved in the pathogenesis of T1DM. Since T1DM has its own immune response against β cells, when the transplanted islets enter the body, the antigen exposure will trigger an autoimmune response again and attack the transplant. Therefore, the transplanted islets in T1DM patients will be attacked by recurrent autoimmune reactions and allogeneic immune recognition and rejection reactions. It is reported that chronic rejection mediated by activated T cells is the most important type of rejection reaction after allogeneic islet transplantation. The immune response seriously affects the survival of the transplant. At present, there are four main strategies to reduce the immune response after transplantation: the use of immunosuppressants, islet encapsulation technology, gene modification and cell therapy.

[0012] 2. A large number of transplanted islets are lost due to apoptosis

[0013] Islet cells are dispersed in the pancreas. Although they only account for 1%-2% of the total pancreatic volume, they are highly vascularized and receive about 10%-20% of the pancreatic blood supply. Due to their own low expression of antioxidant enzymes, pancreatic β cells have a weak ability to defend against ROS attacks and are particularly susceptible to oxidative stress damage. During the isolation, extraction and purification of islet cells, the digestion of collagenase P and mechanical stress will cause the islet cells to separate from their extracellular matrix, making them more susceptible to oxidative stress and cell death. In existing clinical protocols, freshly isolated islet cells usually need to be cultured in vitro for 24 to 72 hours for quality control and functional evaluation, and to initiate an immunosuppressive induction program in transplant recipients. However, during this period, up to 20% of β cell clusters will be lost due to apoptosis every 24 hours.

[0014] During pancreatic cold storage and in vitro cell culture, islet cells are in a state of cold ischemia, and when the transplantation process is completed, significant ischemia / reperfusion injury will occur, resulting in the loss of a large number of transplanted islets. Ischemia / reperfusion injury of islet cells triggers a series of biochemical reactions, leading to the production of a large number of reactive oxygen species, such as superoxide free radicals, hydrogen peroxide, and hydroxyl free radicals, which destroy enzymes, lipids, and DNA in cells, promote the expression of pro-apoptotic factors (such as Fas and Bax), and cause severe apoptosis through intracellular pathways, thereby leading to the failure of functional islet transplantation.

[0015] Studies have shown that hypoxia and IBMIR can cause more than 60% of islet cell clusters to undergo apoptosis and be destroyed within the first 72 hours after infusion into the portal vein. IBMIR is a strong vascular inflammatory response. Islet cells are exposed to a mixed environment of proinflammatory cytokines such as interferon-γ (IFN-γ), IL-1β and TNF-α. The insulin secretion function is significantly impaired, and endoplasmic reticulum stress and endogenous cell apoptosis are significantly increased, which can eventually lead to increased β-cell death. On the other hand, it takes 10-14 days to complete the revascularization of transplanted islets, so early transplanted islets are subjected to severe ischemia and hypoxia stimulation. Previous studies have shown that in rodents, β cells are mainly located in the center of the islet cell cluster, so central necrosis can often be observed in transplanted islets. In addition to early induced islet cell apoptosis, subsequent transplanted islets are also faced with immune rejection and recurrent autoimmune reactions, which are important factors leading to the long-term loss of transplanted islets.

[0016] In summary, due to the weak antioxidant capacity of pancreatic islet cells themselves, and the presence of oxidative stressors in each step of islet transplantation, including isolation, purification, in vitro culture, transplantation, and post-transplantation, and the long-term islet cell ischemia and hypoxia, a large number of transplanted islets suffer from apoptosis and are lost, seriously affecting the efficacy of islet transplantation.

[0017] 3. Strategies to mitigate apoptosis of transplanted islets

[0018] As mentioned above, more than half of the transplanted islets will undergo apoptosis in the early stage, significantly reducing the survival rate of the transplanted islets. This is a key issue affecting the efficacy of islet transplantation and its widespread clinical application. Therefore, how to safely and effectively inhibit the early apoptosis of transplanted islets has become a research hotspot in the field of islet transplantation. Currently, there are three main strategies to reduce islet apoptosis:

[0019] 1) Application of antioxidant drugs

[0020] Existing literature shows that antioxidant therapy has potential clinical application value in each step of islet cell transplantation. Islet cells are exposed to multiple stressors throughout the transplantation process, and different drugs have been developed for different stages. During the isolation and preservation of islets, UW solution containing reactive oxygen scavengers (glutathione and allopurinol, etc.) is used. It is reported that the addition of glutathione ethyl ester during the perfusion and digestion of mouse islets can reduce the intracellular ROS content of islets and attenuate islet cell apoptosis. In order to destroy the oxidative stress after isolation and minimize cell loss before transplantation, exogenous antioxidants such as manganese superoxide dismutase can be supplemented in the islet cell culture medium. During the portal vein infusion stage of islet cells, α1-antitrypsin has been shown to have islet protection function in animal islet transplantation models. The Caspase family is the most important star molecule family in the apoptosis pathway. In vivo and in vitro experiments by PepperAR et al. have confirmed that the pan-caspase inhibitor F573 can significantly reduce apoptosis of human and mouse islet cells. Direct pretreatment with the Caspase-3 inhibitor DEVD-CMK for 24h20 or pretreatment with Z-DEVD-FMK for 48h before transplantation can significantly reduce the apoptosis of transplanted islets and improve the ability of transplanted islets to restore normal blood sugar in diabetic mice.

[0021] 2) Application of stem cells and their derivatives

[0022] Mesenchymal stem cells (MSCs) are the most widely used type of stem cells in pancreatic islet-related cell therapy. They can protect endogenous β cells by inhibiting hypoxia-induced apoptosis and immunomodulation. Studies have shown that the function of MSCs in protecting transplanted islet cells can be largely attributed to their powerful paracrine effects, which can build a microenvironment for transplanted islets, such as vascular endothelial growth factor (VEGF) and transforming growth factor (TGF)-β. Previous studies by the research group have also confirmed that the combined transplantation of MSCs and pancreatic islet cells can significantly increase the survival rate of transplanted islet cells, promote insulin secretion and neovascularization, and thus improve the efficacy of transplanted islets.

[0023] Although MSCs are becoming the most promising source of allogeneic cell therapy, the safety issues caused by the undirected differentiation of MSCs have been controversial, so researchers have focused their subsequent research on stem cell derivatives. A large number of studies have shown that a variety of active factors that are beneficial to pancreatic β cells have been identified in the conditioned medium of MSCs, including ANXA1, SDF-1 and C3a, which can protect pancreatic islets alone or in combination. In recent years, extracellular vesicles (EVs), especially exosomes, have been widely studied. Exosomes derived from MSCs can carry intracellular cytokines, proteins, miRNAs and other substances to target cells or target tissues, thereby participating in intercellular material exchange. Exosomes can act as carriers to target drugs to pancreatic islet cells, thereby regulating the expression of related genes in pancreatic islet cells and changing signal pathways to improve pancreatic cell apoptosis. Our previous studies have shown that BMSCs can transmit miR-21 to pancreatic islet cells through exosomes, thereby inhibiting endoplasmic reticulum stress and cell apoptosis of transplanted islets.

[0024] 3) Gene therapy provides a new treatment concept for preventing apoptosis of early transplanted islets

[0025] In vitro target gene modification of isolated islet cells before transplantation is one of the important measures to inhibit islet cell apoptosis. It has been reported that different gene therapy methods, such as adenovirus, adeno-associated virus, lentivirus, gene vaccination and other non-viral vector methods, can be used in islet cells to regulate the expression of apoptosis and oxidative stress-related genes, such as Bcl-2, Bcl-XL and adiponectin, which can improve the survival rate of transplanted islets. Studies have found that overexpression of hepatocyte growth factor in pancreatic β cells can promote β cell proliferation, improve insulin secretion function and upregulate the survival rate of transplanted islets, thereby reducing the number of islets required for successful transplantation. Another study used plasmids to transfect VEGFA into islet cells and found that although VEGFA can significantly improve the early vascular reconstruction level of transplanted islets, it can cause a large number of islet cell damage in the long-term efficacy due to abnormal vascular proliferation. In our previous study, we also successfully used lipo3000 to transfect miR-21-5p mimics into islet cells. The results showed that the apoptosis level of transplanted islets was significantly reduced in the short term. Studies have shown that siRNA delivery can silence endothelial genes in multiple non-human primate organs and is a promising therapeutic approach. Therefore, in the field of islet transplantation, finding safe and effective targets to inhibit early apoptosis of transplanted islets is an important way and method to solve the clinical problem of poor long-term efficacy of transplanted islets.

[0026] In summary, for islet transplantation, early apoptosis of transplanted islets is a key scientific issue that affects the transplantation effect. Therefore, how to reduce the apoptosis of early transplanted islets, improve the function of transplanted islets, and prolong the time of complete insulin independence after transplantation are important issues that need to be urgently addressed in the field of islet transplantation.

[0027] Inhibiting early apoptosis of transplanted islets has become a research hotspot in the field of islet transplantation. Currently, there are several main strategies to reduce islet apoptosis:

[0028] 1) Application of antioxidant drugs

[0029] Their clinical application is limited by a lack of data to define their window of use in human islet transplantation, whether they are directly toxic to pancreatic β cells or the vascular remodeling process, and questions about the drug's half-life and durability of action.

[0030] 2) Application of stem cells and their derivatives

[0031] Although MSCs are becoming the most promising source of allogeneic cell therapy, they have always been controversial due to ethical issues and safety issues caused by non-directional differentiation. In addition, the combined transplantation of MSCs and pancreatic islet cells for clinical application still requires further exploration of theoretical and technical difficulties such as the optimal stem cell type, transplantation time window and quantity requirements. In addition, the mechanism by which MSCs improve the efficacy of transplanted islets has not yet been fully elucidated, and the complexity of their secretome still requires further basic and clinical research exploration.

[0032] 3) Gene therapy

[0033] Gene therapy provides a new therapeutic strategy for preventing apoptosis of early transplanted islets. Therefore, in the field of islet transplantation, finding a safe and effective target gene to inhibit apoptosis of early transplanted islets is an important way and method to solve the clinical problem of poor long-term efficacy of transplanted islets.

[0034] Data from multiple studies have shown that co-transplantation of mesenchymal stem cells (MSCs) from different tissue sources can achieve short-term anti-apoptotic effects by inhibiting the expression of apoptosis-related factors and regulating apoptosis-related pathways, but has not yet achieved the goal of significantly improving the survival rate of transplanted islets. The applicant’s previous research results found that the transplantation of bone mesenchymal stem cells (BMSCs) and islet cells resulted in a better vascularization level in the grafts and significantly reduced apoptosis of the transplanted islets. For islet transplantation, gene therapy provides a new treatment concept for preventing apoptosis of early transplanted islets. It can intervene in the in vitro culture stage of islet cells and regulate the expression level of apoptosis-related genes in islet cells, thereby constructing islet cells with good activity and carrying anti-apoptotic genes, providing an effective strategy to solve the massive loss of transplanted islets caused by early apoptosis. Summary of the invention

[0035] The technical problem solved by the present invention is to overcome the defects and shortcomings of the prior art. The present invention detects a circular RNA circRNA 3254 with a length of 328nt, and proposes the use of circRNA 3254 in the preparation of a preparation or a drug for preventing early apoptosis of transplanted islet cells.

[0036] The technical solution adopted by the present invention is:

[0037] In a first aspect, the present invention protects the use of a substance for knocking down the expression of circRNA 3254 in the preparation of a reagent or a drug for preventing early apoptosis in pancreatic islet transplantation.

[0038] In a second aspect, the present invention also protects a circRNA 3254 inhibitor, which comprises a substance that knocks down the expression of the circRNA 3254 gene.

[0039] In a third aspect, the present invention also protects a drug for preventing early apoptosis in pancreatic islet transplantation, wherein the drug comprises a substance that knocks down the expression of circRNA 3254 gene.

[0040] The substance for knocking down the expression of circRNA 3254 gene described above is siRNA that specifically interferes with the expression of circRNA 3254 gene. The forward primer of the siRNA sequence is shown in SEQ ID NO: 2, and the reverse primer is shown in SEQ ID NO: 3.

[0041] The sequence of the circRNA 3254 gene described above is shown in SEQ ID NO: 1.

[0042] In a fourth aspect, the present invention also protects the use of pancreatic islet cells modified by the circRNA 3254 gene in the preparation of a drug for improving or enhancing the effect of allogeneic pancreatic islet transplantation.

[0043] In a fifth aspect, the present invention also protects the use of pancreatic islet cells modified by the circRNA 3254 gene in the preparation of drugs for preventing and / or treating diabetes.

[0044] The circRNA 3254 gene-modified pancreatic islet cells described above are pancreatic islet cells in which the expression of the circRNA 3254 gene is knocked down.

[0045] The pancreatic islet cells for knocking down the expression of circ3254 gene mentioned above are pancreatic islet cells for specifically interfering the expression of circRNA 3254 gene using siRNA, the forward primer of the siRNA sequence is shown in SEQ ID NO: 2, and the reverse primer is shown in SEQ ID NO: 3.

[0046] Beneficial effects:

[0047] The research results of the present invention show that for the first time, circRNA sequencing results were used to find that circRNA was involved in the process of bone marrow mesenchymal stem cells (BMSCs) improving the efficacy of transplanted islets, and circRNA 3254, which has not been reported in the literature, was screened out as a research target. The circular characteristics of circRNA 3254 were identified in pancreatic β cells for the first time, and by constructing primary pancreatic islet cells and INS-1 cells that knocked down or overexpressed circ3254, it was verified for the first time in vivo and in vitro models that circRNA 3254 had a clear regulatory effect on the apoptosis of early transplanted islets, which is conducive to further improving the mechanism network of BMSCs to improve the survival rate of transplanted islets. And by constructing primary pancreatic islet cells and INS-1 cells that knocked down or overexpressed circRNA 3254, it was verified for the first time in vivo and in vitro models that circRNA 3254 had a clear regulatory effect on the apoptosis of early transplanted islets, which is conducive to further improving the mechanism network of BMSCs to improve the survival rate of transplanted islets.

[0048] The present invention clarifies for the first time the regulatory effect of circRNA 3254 on the apoptosis of transplanted islet cells and its molecular mechanism, namely, the Bcl-2 / Bax protein ratio is significantly increased, which can provide a sufficient theoretical basis for the subsequent development of targeted circRNA vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0050] Figure 1 The schematic diagram for screening and identifying circ3254.

[0051] Figure 2 A circuit diagram for studying how circRNA 3254 affects pancreatic cell activity.

[0052] Figure 3 To study the circuit diagram of knocking down circ3254 to alleviate early apoptosis of transplanted islets.

[0053] Figure 4 circ3254 is downregulated in islet cells after co-culture with BMSCs; (AC) CircRNA-seq data, circRNAs with significant differences in islets + BMSCs compared with islets. (D) RT-qPCR validation of the top 5 differentially expressed circRNAs. (E) NCBI Blast was used to align the sequences of rno-circRNA3254 and hsa_circ_0002934. (F) RT-qPCR was used to detect the expression difference of circ3254 between INS-1 and INS-1 + BMSCs.

[0054] Figure 5 Characterization of circ3254 in islet cells. (A) Schematic diagram showing the genomic location of circ3254, indicating that circ3254 is transcribed from the PTEN gene. (B) Sanger sequencing to detect the backsplicing sites of circ3254. (C) Circ3254 was detected from cDNA but not from gDNA by PCR and agarose gel electrophoresis using dispersed primers. (D) Relative expression levels of circ3254 in islet cells with or without RNase R digestion, confirming its circular form. (EF) RT-qPCR experiments to identify the distribution of circ3254 in the cytoplasm and nucleus.

[0055] Figure 6circ3254 can regulate the apoptosis of INS-1 cells; (A) After 24 hours of transfection with circ3254 siRNA and overexpression plasmid, the transfection efficiency was observed by RT-qPCR. (B) Cell viability was detected by CCK8 assay. (CD) The expression of Bcl-2 and Bax mRNA levels in each group of cells was detected by RT-qPCR. (EF) Cells in different groups were analyzed by Western Blot to determine the levels of Bcl-2, Bax and Cleaved Caspase-3.

[0056] Figure 7 Knockdown of circ3254 can improve islet cell activity; (A) Quantitative analysis of islet cell transfection efficiency. (BC) AO-PI dual fluorescence staining for islet viability. Live islets are green and dead islets are red. Scale bar: 100 μm. (D) GSIS assay in islets transfected with si-NC and si-circ3254. The expression levels of apoptotic markers (Bcl-2, Bax, and Cleaved Caspase-3) in islet cells were detected by RT-qPCR (E) and Western Blot (F). (GH) Islet cell apoptosis was measured and quantified by flow cytometric analysis of AnnexinV / 7-AAD staining.

[0057] Figure 8 To construct a plasmid for overexpressing circ3254.

[0058] Fig. 9 Transplantation of pancreatic islet cells knocked down for circ3254 significantly accelerated the normalization of blood glucose in diabetic rats; (A) Islet transplantation grouping pattern. (BC) Changes in blood glucose and body weight in the normal control group, diabetic model group, si-NC group, and si-circ3254 group. IPGTT (2 g / kg) was performed 7 (D) and 14 (F) days after transplantation. (E) and (G), quantitative results of the area under the curve. DETAILED DESCRIPTION

[0059] To make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0060] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent stores.

[0061] Circular RNA (circRNA) is a type of endogenous noncoding RNA (ncRNA) that does not have a 5' end cap and a 3' end poly(A) tail and forms a circular structure by covalent bonds. In recent years, it has been found that it has potential associations with a variety of diseases and plays an important regulatory role in them. It has great potential to become a new clinical diagnostic and therapeutic target.

[0062] Thanks to the rapid development of high-throughput sequencing technology and bioinformatics technology, circRNA has been proven to affect the function of β cells. Zhen Wang et al. found that in the initial stage of type 1 diabetes, long-term exposure of pancreatic β cells to proinflammatory factors (such as IL-1β, TNF-α and IFN-γ) led to a decrease in the ability to produce and release insulin and promoted apoptosis of pancreatic β cells. ciRS-7 / CDR1as is the first circRNA studied in pancreatic islet cells. It contains about 7 conserved miR-7 binding sites and is therefore called Cdr7as or ciRS-733. Xu et al. observed that overexpression of ciRS-7 in MIN6 and mouse islet cells promoted insulin secretion and increased content in pancreatic islet cells. CircRNA Cdr1as also regulates insulin transcription and secretion in pancreatic islet cells through miR-7 and its target Myrip, as well as another target Pax6 that enhances insulin transcription. hsa_circ_0054633 inhibits NES3Y cell apoptosis and insulin secretion impairment by regulating the miR-409-3p / caspase-8 axis. circHIPK3 is one of the most abundantly expressed circRNAs in pancreatic islets. After effective silencing of circHIPK3, apoptosis of MIN6 cells and rat islet cells increased, while the proliferation capacity of β cells was weakened. CircHIPK3 works by sponging a group of miRNAs, including miR-124-3p and miR-338-3p, and regulating the expression of key β cell genes, such as Slc2a2, Akt1, and Mtpn. Silencing circAFF1 in MIN6 cells or primary rat β cells led to increased apoptosis. Silencing circRNA LRP6 in INS-1 cells can downregulate PRMT1 by sponging miR-9-5p, thereby improving streptozotocin (STZ)-induced oxidative stress, β cell damage, and insulin secretion. In summary, circRNAs can directly participate in regulating the function of β cells and play an important role in the disease process of T1DM.

[0063] Although BMSCs play an important role in protecting transplanted islets, they still have the risk of adverse differentiation such as teratogenesis and tumorigenesis, so it is urgent to explore the molecular mechanism by which BMSCs play a protective function for islets. The applicant previously screened regulated circular molecules (circular RNAs, circRNAs) in pancreatic islet cells co-cultured with BMSCs, of which 33 were upregulated and 79 were downregulated. Subsequently, 25 circRNAs with high expression levels in pancreatic islet cells were screened. RT-qPCR was used to verify the top 5 circRNAs with the highest expression difference, and finally circRNA 3254 (circ3254), which has not been reported in the literature and is highly homologous in humans and rats, was selected as the object of applied transformation research.

[0064] Circ3254 is a circRNA encoded by PTEN pre-mRNA, and its function has not been reported. In addition, studies have found that another circRNA encoded by PTEN pre-mRNA, hsa_circ_0094343 (circPTEN), is lowly expressed in colorectal cancer tissues and cells, and can inhibit the proliferation, migration and invasion of colorectal cancer by regulating the PTEN / AKT pathway, while promoting cell apoptosis. ZhanY et al. demonstrated that circPTEN can inhibit the expression of its parent gene PTEN by reducing the methylation of the PTEN promoter, and inhibit the expression of GLUT1 by reducing the m6A methylation of GLUT1, thereby inhibiting the progression of ccRCC and resistance to mTOR inhibitors. The applicant successfully constructed pancreatic islet cells and INS-1 cells with knockdown of circ3254 in vivo and in vitro experiments, and found that the survival rate of transplanted islets was significantly increased, and the level of apoptosis was significantly reduced.

[0065] Sequence of Circ3254:

[0066] SEQ ID NO: 1:

[0067] >circRNA3254

[0068] GTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTATGTGCTGAGAGACATTATGACACCGCCAAATTTAACTGCAGAGTTGCACAGTATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACC AATGGCTAAGTGAAGACGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGGAAAGGACGGACTGGTGTAATGATTTGTGCATATTTATTGCATCGGGGCAAGTTTTTAAAGGCACAAGAGGCCCTGGATTTTTATGGGGAAGTAAGGACCAGAGATAAAAAG

[0069] Example 1: Screening and identification of circ3254

[0070] like Figure 1 As shown in the figure, the basic process of screening and identifying circ3254 is as follows:

[0071] (1) Screening of circRNA

[0072] Two groups of omics samples were prepared, namely primary islet cells co-cultured with BMSCs for 48 hours and islet cells cultured alone for high-throughput circRNA sequencing. The top five circRNAs with the largest fold difference (circ576, circ701, circ4172, circ971, circ3254) were screened under the conditions of P<0.05 and logFc>1.5. RT-qPCR was used to verify the candidate genes, and screening was performed based on species homology, and circ3254 was determined as the research target.

[0073] (2) Identification of circRNA

[0074] Sanger sequencing was used to verify the splicing region of circRNA; convergent primers and divergent primers of circ3254 were designed and identified by PCR to exclude gene recombination; RNase R digestion experiment was subsequently used to exclude trans-splicing and genome rearrangement. Since circRNA has no 3' and 5' ends, it is not easily degraded by nuclease, thus identifying circ3254 as a circular form.

[0075] The nuclear and cytoplasmic RNA of islets and INS-1 were extracted respectively, and the nuclear and cytoplasmic localization of circ3254 in cells was detected.

[0076] The results are as follows Figure 4 As shown in Figure 2, in order to discover circRNAs that specifically play a role in BMSCs protecting pancreatic islets, we performed circRNA sequencing between islets and islets co-cultured with BMSCs, and identified 112 circRNAs with significant differences (p<0.05) between the two groups, including 33 up-regulated and 79 down-regulated circRNAs ( Figure 4 A) Then we Figure 4 C, 25 circRNAs with high expression levels were screened. Then RT-qPCR was used to detect the top five circRNAs with the highest fold difference: circRNA 576, circRNA 701, circRNA4172, circRNA 971, and circRNA 3254. Then we used Blast sequence alignment and found that the sequence similarity between rno-circRNA 3254 and has_circ_002934 was as high as 96% ( Figure 4 D). Similarly, we found that the expression level of circ3254 was significantly reduced after co-culture in the INS-1 cell line, which was the same as the result of primary islet cells. Therefore, we chose circ3254 for further study.

[0077] like Figure 5 As shown in Figure 3, Circ3254 is a 328-nt circRNA generated by reverse transcription of the pre-RNA of the phosphatase and tensin homolog PTEN. Figure 5 As shown in A. We used RT-PCR products and Sanger sequencing to detect the head-tail splicing region of circ3243 ( Figure 5 B). Subsequently, two pairs of primers were applied, one pair of divergent primers (SEQ ID NO: 5 and SEQ ID NO: 6, the amplified fragment size of circRNA3254-F2R2 was 188 bp) to detect circRNA and gene recombination, and the other pair of convergent primers (SEQ ID NO: 7 and SEQ ID NO: 8, the amplified fragment size of circRNA3254-linear-F1R1 was 125 bp) to detect mRNA and circRNA, as shown in Figure 5As shown in Figure 3, two pairs of reference gene sequences, SEQ ID NO: 9-SEQ ID NO: 12 in Table 1, were used to identify the circular form of circ3254. When cDNA was used as a template, both pairs of primers produced products, while only the convergent primer produced products when gDNA was used as a template, indicating that the detected circ3254 was not produced by gene recombination. In order to further characterize the circular form of circ3254, the stability of this form was detected using the exonuclease RNase R. Circ3254 showed strong resistance to RNase R digestion, while the linear RNA of GAPDH was highly degraded ( Figure 5 D), indicating that circ3254 is indeed a circular RNA. In our nuclear fractionation experiments using RT-qPCR analysis, circ3254 was mainly localized in the cytoplasm ( Figure 5 E, 5F). Taken together, these data describe that circRNA 3254 does exist in a circular form in pancreatic islet cells.

[0078] The primers, probes and their sequences used in the following examples are shown in the table below:

[0079] Table 1 Primer sequences

[0080] Sequence number Primer / probe name Primer sequence (5'-3') SEQ ID NO:2 si-circ3254-F CCAGAGAUAAAAAGAGAUATT SEQ ID NO:3 si-circ3254-R UAUCUCUUUUUAUCUCUGGTT SEQ ID NO:5 circRNA3254-F2 GACCATAACCCACCACAGC SEQ ID NO:6 circRNA3254-R2 ACACCAGTCCGTCCTTTCC SEQ ID NO:7 circRNA3254-linear-F1 GACCATAACCCACCACAGC SEQ ID NO:8 circRNA3254-linear-R1 ACACCAGTCCGTCCTTTCC SEQ ID NO:9 RAT-circGAPDH-F2 GGCTGGCATTGCTCTCAAT SEQ ID NO:10 RAT-circGAPDH-R2 CACCGACCTTCACCATTTAC SEQ ID NO:11 RAT-Linear-GAPDH-F1 GTGATGGGTGTGAACCACGA SEQ ID NO:12 RAT-Linear-GAPDH-R1 TGATGGCATGGACTGTGGTC

[0081] Example 2: In rat pancreatic islet cells, determining whether circ3254 can affect apoptosis

[0082] Technical lines such as Figure 2 As shown, including the following:

[0083] (1) Knockdown of circ3254 at the cellular level

[0084] The siRNA synthesized by Genetix was transfected into INS-1 cell line and primary islets using lipo3000. The transfection efficiency was first detected by RT-qPCR. The primers were designed and synthesized by Beijing Qingke Biotechnology. After confirming that the siRNA was successfully transfected ( Figure 6 A; Figure 7 A), cells were collected, RNA and protein were extracted, and the expression changes of Bcl-2 and Bax at the transcriptional and protein levels were detected, followed by flow cytometry analysis using Annexin V / PI dye. The activity of pancreatic islet cells was subsequently detected using AO / PI staining and insulin secretion assay (GSIS).

[0085] Glucose-stimulated insulin secretion test (GSIS)

[0086] A 0.4 μm chamber was placed in a 24-well plate, and 30 IEQ of pancreatic islet cells transfected with si-NC and si-circ3254 were added to the upper layer of the chamber. After treatment with 500 μL of serum-free low-glucose DMEM medium (concentration of 2.8 mM / L) for 1 hour, the supernatant was collected. After that, the cells were rinsed with PBS three times and replaced with 500 μL of serum-free high-glucose DMEM medium (concentration of 25 mM / L) for 1 hour, and the supernatant was collected again.

[0087] Results: To simulate the ischemic hypoxia state of pancreatic islet cells in vitro, we treated the INS-1 cell line with STZ. Using the CCK8 method, we found that the survival rate of INS-1 cells decreased by 40% after 24 hours of 3mM STZ treatment, and when circ3254 expression was decreased, cell viability was significantly increased ( Figure 6 B). We then used RT-qPCR to detect the mRNA levels of Bcl-2 and Bax in cells ( Figure 6 D). In addition, we used Western Blot to detect the levels of apoptosis-related factors in si-circ3254 and si-NC cells and found that the Bcl-2 / Bax protein ratio was significantly increased, while the expression level of Cleaved Caspase-3 was significantly decreased ( Figure 6 E). In summary, these results indicate that successful knockdown of circ3254 in INS-1 cells can significantly reduce the level of STZ-induced β-cell apoptosis.

[0088] In addition, we performed AO-PI staining in these primary islet cells to distinguish between live and dead cells in the islets. The results showed that the survival rate of islet cells transfected with si-circ3254 was 1.5 times that of the control group ( Figure 7 BC). To further test the effect of si-circ3254 on pancreatic islet cell survival, we evaluated the function of β cells by insulin release experiment. The results showed that the level of insulin released by pancreatic islet cells transfected with si-circ3254 was significantly higher than that of the control group, and the difference was statistically significant ( Figure 7 D) Then, we detected the protein expression levels of Bcl-2, Bax and cleaved Caspase-3. Figure 7 As shown in EF, the changes in these apoptosis-related factors are consistent with the change trends in INS-1 cells. In addition, we performed flow cytometry analysis on primary pancreatic islet cells and obtained the same results ( Figure 7 GH). Taken together, these results indicate that knockdown of circ3254 can alleviate apoptosis in primary pancreatic β cells.

[0089] (2) Overexpression of circ3254 at the cellular level

[0090] The overexpression plasmid was synthesized by Genema, and the vector pcDNA3.1(+) was Figure 8 As shown, the plasmid was transiently transfected into the cell line using lipo3000 when the INS-1 cells were 70-80% confluent. The transfection efficiency was then verified, and apoptosis was detected using RT-PCR, Western Blot, PI / Hoechst staining and flow cytometry.

[0091] Real-time fluorescence quantitative polymerase chain reaction (quantitative reverse transcription PCR, RT-qPCR): Prepare the reaction solution in eight strips according to the following table:

[0092] Table 2 Construction of real-time quantitative PCR system

[0093] name Dosage 2×SYBRGreenProTaqHSPremix(ROXplus) 5μL cDNA ≤100ng Primer F (10 μM) 0.7μL PrimerR (10 μM) 0.7μL RNasefreeWater to10μL Total volume 10μL

[0094] The reaction conditions were: 95°C, 30s; [95°C, 5s+60°C, 30s] for 40 cycles; 4°C.

[0095] Table 3 Primer sequence list

[0096]

[0097] Western Blot

[0098] 1) Prepare 1.0mm 12.5% ​​PAGE gel according to the product manual: take 2.7mL of lower gel solution and lower gel buffer into a disposable gel cup, add 60μL of coagulant, mix well and add to the glass plate, then carefully add appropriate amount of ddH2O and let it stand for 15-20min. After the lower gel solidifies, remove water as much as possible, then take 0.75mL of upper gel solution and colored upper gel buffer into a disposable gel cup, add 15μL of coagulant and mix well, add to the gel plate, insert a 15-tooth comb, and let it stand for 15-20min to let the upper gel solidify.

[0099] 2) Take a pack of electrophoresis solution powder in a conical flask, add 1L ddH2O, and use a magnetic stirrer to completely dissolve it. Install the prepared gel in the electrophoresis tank and fill the inner tank with electrophoresis solution. Load the sample according to the results of protein quantification, add protein marker, and pour the rest of the electrophoresis solution into the outer tank, and perform electrophoresis at 80V.

[0100] 3) Take a packet of transfer liquid powder in a conical flask, add 0.2mL methanol and 0.8mL ddH2O, and use a magnetic stirrer to completely dissolve it. Take the cut PVDF membrane and soak it in methanol for 5-10 minutes. Use the wet transfer method and a "sandwich" structure for transfer, that is, the order from negative electrode to positive electrode is: sponge, two layers of filter paper, PAGE gel, PVDF membrane, two layers of filter paper and sponge. Positive electrode to positive electrode, negative electrode to negative electrode, 200mA transfer for 2h.

[0101] 4) Block with 5% BSA for 30 min.

[0102] 5) Cut the membrane according to the molecular weight of the target protein and incubate the primary antibody at 4°C overnight. The specific dilution ratio is as follows:

[0103] Table 4 Antibody concentrations used

[0104]

[0105] 6) Take a packet of TBS powder in a conical flask, add 2L ddH2O, use a magnetic stirrer to completely dissolve it, add 1mL Tween-20 per 1L, mix well to get TBST. Wash the membrane with sufficient TBST on a fast shaker for 5 minutes, repeat 5 times. Then incubate the secondary antibody at room temperature for 1 hour, and then wash the membrane with sufficient TBST 5 times.

[0106] 7) Use luminescent liquid to develop color and image.

[0107] PI / Hoechst staining: After washing twice with PBS, add 1 mL of cell staining buffer, then add 3 μL of Hoechst staining solution and 10 μL of PI staining solution in sequence, incubate at 4°C for 20-30 min, and observe under a fluorescence microscope.

[0108] Flow cytometry: Collect cells from each group (including supernatant) in a flow cytometry tube, wash once with pre-cooled PBS by centrifugation, add 500 μL of ddH2O diluted to 1×Binding Buffer to resuspend the precipitate. Then add 5 μL Annexin V and 10 μL 7-AAD to each tube, mix well, incubate at room temperature in the dark for 5 minutes, and detect on the flow cytometry tube.

[0109] circ3254 overexpression plasmid (SEQ ID NO: 4):

[0110] Sequence (5'-3')

[0111] >circRNA3254

[0112] AGATAAAAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTATGT

[0113] GCTGAGAGACATTATGACACCGCCAAATTTAACTGCAGAGTTGCACAGTATCCTTTTGA

[0114] AGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAAT

[0115] GGCTAAGTGAAGACGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGGAAAGGACG

[0116] GACTGGTGTAATGATTTGTGCATATTTATTGCATCGGGGCAAGTTTTTAAAGGCACAAG

[0117] AGGCCCTGGATTTTTATGGGGAAGTAAGGACCAGAGATAAAAAG

[0118] Results: To further verify the effect of circ3254 on INS-1 cells, we transfected INS-1 cells with a plasmid that overexpressed circ3254. RT-qPCR results showed that our transfection was successful ( Figure 6 A). The CCK8 experiment showed the opposite result to the knockdown of circ3254, and the cell activity was significantly reduced ( Figure 6 B). Secondly, RT-qPCR and Western Blot experiments were used to detect the protein expression levels of Bcl-2, Bax and cleaved Caspase-3 in cells. The results showed that the overexpression of circ3254 significantly increased the level of cell apoptosis under normal culture and 3mM STZ treatment conditions (Figure C, F). In short, these results all indicate that the overexpression of circ3254 significantly increased the level of apoptosis in INS-1 cells. .

[0119] Example 3: In vivo experiments to determine whether knocking down circ3254 can alleviate early apoptosis of transplanted islets

[0120] Technical lines such as Figure 3 As shown, including the following:

[0121] (1) Isolation and purification of SD rat pancreatic islet cells

[0122] 10 ml of 1 mg / ml collagenase was retrogradely injected into the common bile duct of 8-12 week old, 200 g Sprague Dawley rats of SPF grade for in situ perfusion, and then transferred into a 50 ml centrifuge tube containing Hank's solution and digested at 38°C for 12 min. The rat islet cells were purified by discontinuous density gradient centrifugation with 1.084 lymphocyte separation medium. The purity and activity of the islet cells were identified by DTZ and AO-PI staining, respectively.

[0123] (2) Construction of diabetic rat model

[0124] SPF SD rats were fasted for 12 hours but not water, and then weighed and injected with STZ at 50 mg / kg per rat. Then, random blood glucose and body weight were measured every 2 days. When random blood glucose > 16.7 mol / L and maintained for more than 15 days, polydipsia, polyphagia, polyuria and weight loss appeared, the diabetic rat model was successfully established. The experimental groups were divided into 4 groups (12 rats in each group): blank control group, diabetic rat model group, pancreatic islet cell treatment group transfected with negative control, and pancreatic islet cell treatment group transfected with si-circ3254.

[0125] (3) Directly transplant the modified islet cells into the subrenal capsule of diabetic rat models

[0126] 1000 IEQ fresh islets with good activity in each group were transplanted under the renal capsule of diabetic rats. The following indicators were observed:

[0127] ①Observe the characteristics of pancreatic islets and the physiological indicators of rats after transplantation, including: the animals' food intake, water intake and body weight changes; fasting blood sugar levels, glucose tolerance test, blood C2 peptide and insulin levels;

[0128] ②Observe the condition of rat islets after transplantation through pathological sections;

[0129] ③ Observe the apoptosis of transplantation using fluorescence staining technology: After transplantation, the transplantation of rats in each group was taken out for smear, fixed with 4% paraformaldehyde and made into wax blocks, double-stained with insulin and Cleaved Caspase-3, and TUNEL staining, and then the survival of the transplantation was observed under a confocal microscope.

[0130] result:

[0131] A type 1 diabetes model was established in adult male SD rats by destroying pancreatic islet cells with a single injection of high-dose STZ. Then, we selected rats with blood glucose measurements greater than 16.7 mM / L for three consecutive experiments. In order to study the effect of circ3254 knockdown on islet cell transplantation, the experimental groups were as follows: 1) normal control group (n = 12); 2) diabetic model group (n = 12); 3) si-NC islet cell transplantation group (n = 12); 4) si-circ3254 islet cell transplantation group (n = 12) ( Fig. 9 A) Random blood glucose and body weight were monitored for 14 days after transplantation. Fig. 9 As shown in B, blood glucose levels decreased significantly after islet cell transplantation. On POD 5, blood glucose levels in the si-circ3254 group decreased significantly compared with those in the si-NC group. From day 7 after transplantation, the difference in blood glucose levels between the two groups was more significant. However, in our study, there was no significant difference in body weight between the two groups ( Fig. 9 C). To further evaluate the efficacy of islet transplantation, we performed glucose tolerance tests at 7 and 14 days after transplantation. In all islet transplantation groups, the area under the curve (AUC) of blood glucose levels was significantly lower than that in the diabetic model group, and si-circ3254 islet cells showed improved glucose tolerance compared with transplanted si-NC islets ( Fig. 9 DG). Taken together, these results indicate that knockdown of circ3254 in islets improves the function of transplanted islets.

[0132] The embodiments described above are only preferred specific implementation modes of the present invention, and the protection scope of the present invention is not limited thereto. Any simple changes or equivalent replacements of the technical solutions that can be obviously obtained by any technician familiar with the field within the technical scope disclosed in the present invention belong to the protection scope of the present invention.

Claims

1. Use of a substance for knocking down the expression of circRNA 3254 in the preparation of a reagent or drug for preventing early apoptosis in pancreatic islet transplantation.

2. A circRNA 3254 inhibitor, characterized in that The circRNA 3254 inhibitor includes a substance that knocks down the expression of the circRNA 3254 gene.

3. A drug for preventing early apoptosis of pancreatic islet transplantation, characterized in that: The drug contains a substance that knocks down the expression of the circRNA3254 gene.

4. The use according to any one of claims 1 to 3, characterized in that: The substance for knocking down the expression of circRNA 3254 gene is siRNA that specifically interferes with the expression of circRNA 3254 gene. The forward primer of the siRNA sequence is shown in SEQ ID NO: 2, and the reverse primer is shown in SEQ ID NO:

3.

5. The use according to claim 4, characterized in that: The sequence of the circRNA 3254 gene is shown in SEQ ID NO:

1.

6. Application of pancreatic islet cells modified by circRNA 3254 gene in the preparation of drugs for improving or enhancing the effect of allogeneic pancreatic islet transplantation.

7. Application of pancreatic islet cells modified by circRNA 3254 gene in the preparation of drugs for preventing and / or treating diabetes.

8. The use according to claim 6 or 7, characterized in that The circRNA 3254 gene-modified pancreatic islet cells are pancreatic islet cells in which the expression of the circRNA 3254 gene is knocked down.

9. The use according to claim 8, characterized in that: The pancreatic islet cells for knocking down the expression of circ3254 gene are pancreatic islet cells in which the expression of circRNA 3254 gene is specifically interfered with by siRNA. The forward primer of the siRNA sequence is shown in SEQ ID NO: 2, and the reverse primer is shown in SEQ ID NO: 3.

Images