Yolk antibodies specifically recognizing the cat allergens fel d1 and fel d4 and uses thereof

Abstract

The present disclosure belongs to the field of biotechnology, and particularly relates to a kind of egg yolk antibody specifically recognizing cat allergen FEL D1 and FEL D4 and its use.The present disclosure provides an egg yolk antibody composition, wherein the egg yolk antibody composition comprises egg yolk antibody specifically recognizing and neutralizing cat allergen FEL D1 and egg yolk antibody specifically recognizing and neutralizing cat allergen FEL D4.The egg yolk antibody composition can more effectively reduce the occurrence of allergic reaction, and can be applied using liquid preparation, directly acting on the allergen on the surface of the environment or cat body, and is more convenient to store and use.

Description

[0001] This application claims priority to the Chinese patent application No. 202311435718.9, filed on October 30, 2023, and entitled "YOLK ANTIBODIES SPECIFICALLY RECOGNIZING CAT ALLERGENS FEL D1 AND FEL D4 AND USES THEREOF", the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0002] The present application belongs to the field of biotechnology, and particularly relates to a kind of yolk antibodies specifically recognizing cat allergen FEL D1 and FEL D4 and its composition, preparation method and use. BACKGROUND

[0003] Contacting proteins from other species can cause an immune response in humans, which can induce rhinitis and even life-threatening asthmatic inflammatory diseases. Allergens from domestic cats in the environment are one of the most common and powerful allergens in the world, and more than 90% of cat-allergic patients will have an immune response to the major cat allergen FEL D1 (Felis domesticus allergen No. 1). FEL D1 is produced in the sebaceous glands, saliva, lacrimal glands and anal glands of cats, and exists in saliva, tears, skin and fur. It is spread from cats to the environment through dander. Currently, there are the following solutions to cat allergy: (1) remove all objects that may contain allergens or are contaminated in the home, such as pillows, blankets, carpets, etc., to avoid contact with allergens; (2) clean the environment and use air humidifiers and filters to alleviate symptoms; (3) avoid contact with cats that produce allergens. However, the above methods not only have limited effect, but also are difficult to achieve for cat-keeping families, which can easily lead to abandonment. Another way to solve the problem of cat allergy is to reduce the FEL D1 of the feline itself, which does not involve the separation of cats from their owners. One of the ways to do this is to actively immunize cats, with the aim of inducing anti-FEL D1 antibodies in the animal's body, but cat FEL D1 vaccines are expensive, have unstable effects, and regular injections are not conducive to animal welfare for pets. In addition to FEL D1, FEL D4 is also an important allergen from cats. FEL D4 is a lipocalin protein, which is secreted by the salivary gland and mainly exists in saliva. It can also be found in fur and can be scattered in the environment in large quantities. FEL D4 can cause IgE-mediated allergic reactions in 63% of cat-allergic people. There is currently no product on the market that specifically reduces FEL D4 allergic reactions.

[0004] The yolk antibodies and their compositions provided by the present application simultaneously target FEL D1 and FEL D4, neutralize allergens together, can more effectively reduce the occurrence of allergic reactions, and can be applied using liquid formulations to directly act on allergens on the surface of the environment or the cat's body, making storage and use more convenient. SUMMARY

[0005] The present application relates to a yolk antibody specifically recognizing cat allergens FEL D1 and FEL D4, and a composition, a preparation method and a use thereof.

[0006] In one aspect, the present application provides a yolk antibody composition, wherein the yolk antibody composition comprises a yolk antibody specifically recognizing and neutralizing cat allergen FEL D1 and a yolk antibody specifically recognizing and neutralizing cat allergen FEL D4.

[0007] In another aspect, the present application provides a preparation method of the aforementioned yolk antibody composition, comprising:

[0008] S1: preparing antigen proteins comprising FEL D1 and FEL D4;

[0009] S2: immunizing laying hens with the antigen proteins comprising FEL D1 and FEL D4 respectively or jointly to obtain immune eggs of the immunized hens;

[0010] S3: purifying the immune eggs to obtain yolk antibodies.

[0011] In another aspect, the present application provides an immunogenic composition comprising an isolated cat allergen FEL D1 or an immunogenic fragment thereof and an isolated cat allergen FEL D4 or an immunogenic fragment thereof.

[0012] In another aspect, the present application provides a liquid preparation, wherein the liquid preparation comprises the aforementioned yolk antibody composition.

[0013] In another aspect, the present application provides a food-grade powder, wherein the powder comprises the yolk antibody composition according to any one of claims 1-5.

[0014] In another aspect, the present application provides a use of the aforementioned yolk antibody composition, liquid preparation or food-grade powder in the preparation of a product for preventing and / or alleviating allergic symptoms of humans to cats.

[0015] In another aspect, the present application provides a nucleotide encoding the yolk antibody in the aforementioned yolk antibody composition or the cat allergen or the immunogenic fragment thereof in the immunogenic composition.

[0016] In another aspect, the present application provides an expression system constructed by introducing an expression vector comprising a FEL D1 gene fragment as shown in nucleotide sequence SEQ ID NO: 1, 3, 5, 7 and / or a FEL D4 gene fragment as shown in nucleotide sequence SEQ ID NO: 9 into a host cell respectively.

[0017] The egg yolk antibody and the composition thereof provided by the application are simultaneously directed against FEL D1 and FEL D4, and the small molecule structure of FEL D1 and FEL D4 allows it to adhere to fabrics, carpets and cushion furniture, so that it is difficult to be cleaned from the home, and can be transmitted from a cat living family to a place without cat living by being adsorbed on clothes and other articles. After the high-titer anti-FEL D1 and FEL D4 egg yolk antibody is purified by the application, the allergen is neutralized, the allergic reaction can be more effectively reduced, and the application can be in the form of a liquid preparation or a food-grade powder. The liquid preparation can be directly sprayed on the surface of the cat body to neutralize the allergen, and after being licked by the cat, the allergen in the oral cavity is neutralized; or it is sprayed on the environment and the surface of clothes to reduce the amount of allergen in the environment, or it is further used to prepare pet touching gloves wet wipes, mouthwash, pet washing and care products, etc. The food-grade powder can be added to pet food, such as complete cat food, pet main food companions, cat snacks or pet nutritional supplements, etc., so as to further reduce the possibility of allergic reaction, and the storage and application are more convenient. The liquid preparation of the egg yolk antibody provided by the application can be stored at room temperature for 12 months. BRIEF DESCRIPTION OF DRAWINGS

[0018] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the application and serve to explain the principles of the application, together with the description.

[0019] Figure 1 The results of colony PCR of FEL D1-V1 gene fragments and FEL D4 gene fragments are shown.

[0020] Figure 2 The WB verification results of cell supernatant are shown, wherein (a) is the CHO-FEL D1 cell production test supernatant, and (b) is the CHO-FEL D4 cell production test supernatant.

[0021] Figure 3 The effect of FEL D1 egg yolk antibody on neutralizing cat hair samples is shown.

[0022] Figure 4 The effect of FEL D1 egg yolk antibody on neutralizing cat saliva samples is shown.

[0023] Figure 5 The effect of FEL D4 egg yolk antibody on neutralizing cat saliva samples is shown.

[0024] Figure 6 The active Fel d1 content in saliva and the reduction ratio are shown.

[0025] Figure 7 The active Fel d1 content in hair and the reduction ratio are shown.

[0026] Figure 8 The active Fel d4 content in saliva and the percentage of reduction are shown. DETAILED DESCRIPTION

[0027] I. DEFINITIONS

[0028] In the present disclosure, the scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art, unless otherwise indicated. Also, the terms and experimental procedures in protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology, and related field are those widely used in the corresponding field. Meanwhile, for better understanding of the present disclosure, the definitions and explanations of the related terms are provided as follows.

[0029] As used herein and unless otherwise indicated, the term "about" or "approximately" means within 10% of a given value or range. In the case of integers, the term means within 10% of a given value or range, rounded to the nearest integer.

[0030] As used herein, the term "allergen" refers to an antigenic portion of an antigen or molecule that can elicit an allergic response when contacted by an individual. Typically, whether an individual is allergic to an allergen can be determined by clinical testing, by estimation of the subject's medical history, or by any other suitable method known in the art. An antigen can be referred to as an allergen if a small percentage of individuals exhibit an immune response upon exposure to the molecule. A variety of isolated allergens are known in the art. For example, the present disclosure relates to the cat allergen FEL D1 and the cat allergen FEL D4.

[0031] As used herein, the term "allergy" is synonymous with "allergic response" or "allergic reaction." Each of these terms refers to a state of immune response in an animal to an allergen (or "foreign antigen") that would not otherwise be harmful to the animal. A "symptom" of an allergic response refers to any measure of immune response, for example, at the molecular level (including measures of protein or transcript or gene activity or expression), cellular level, organ level, system level, or organism level. Such symptoms can include one or more of such levels. "Reducing symptoms" includes reducing such symptoms prior to their occurrence, such that there is an absence of symptoms of an allergic response, thereby preventing the allergic response. Symptoms can include general phenomena such as inflammation, respiratory disease, swelling or discomfort, rhinitis, edema, and allergic dermatosis, including but not limited to atopic dermatitis (e.g., eczema), urticaria (e.g., hives), and angioedema, and allergic contact dermatitis. More specific phenomena of an allergic response "symptom" include, for example, any measurable or observable change at the cellular level, including but not limited to local or systemic changes in cell populations, eosinophilia, recruitment and / or activation of immune cells including, for example, mast cells and / or basophils, changes in antigen presenting cells including but not limited to FcεRI-bearing dendritic cells, intracellular or molecular changes including measures or observations of one or more steps in the immune cascade, release of intracellular compounds that mediate allergic response (e.g., mediator factors), and changes in one or more cytokines (e.g., IL-3, IL-5, IL-9, IL-4, or IL-13) or their related compounds or antagonists.

[0032] As used herein, the term "protective agent" means a pharmaceutical excipient used to protect labile active ingredients (e.g., proteins, particularly, yolk antibodies as in the present disclosure) from destabilizing conditions during the lyophilization process and subsequent storage and reconstitution. Protective agents include, but are not limited to, the group consisting of sugars, polyols (such as sugar alcohols), and amino acids. Preferred protective agents can be selected from the group consisting of sugars such as sucrose, trehalose, lactose, glucose, mannose, maltose, galactose, fructose, sorbose, raffinose, neuraminic acid; amino sugars such as glucosamine, galactosamine, N-methylglucosamine ("meglumine"); polyols such as mannitol and sorbitol; and amino acids such as arginine and glycine; or mixtures thereof.

[0033] As used herein, the term "liquid formulation" refers to a formulation in liquid form and includes formulations that are originally in liquid form as well as purified yolk antibodies, i.e., so-called reconstituted solutions. Liquid formulations of the present disclosure are stable upon storage and their stability is independent of purification (or other state-changing methods).

[0034] As used herein, the term "spray" refers to a preparation in which a drug substance (e.g., a composition provided herein or a corresponding liquid formulation) is filled into a specially designed device with pharmaceutically acceptable excipients, and the contents are released in the form of mist or the like using a manual pump, high-pressure gas, ultrasonic vibration, or any other suitable method at the time of use. The term "pharmaceutically acceptable excipient" refers to an auxiliary material used in the production of a drug, which imparts necessary physicochemical properties to a drug, is compatible with a drug active ingredient, and does not cause adverse reactions to an individual to whom it is administered. Common pharmaceutically acceptable excipients include, but are not limited to, diluents (or fillers), binders, disintegrants, lubricants, wetting agents, humectants, thickening agents, glidants, bacteriostatic agents (or preservatives), antioxidants, pH adjusting agents (or acidity adjusting agents), osmotic pressure adjusting agents, flavoring agents, odorants, fragrances (or aromatics), solvents, solubilizers, co-solvents, surfactants, and the like.

[0035] As used herein, the term "food grade" refers to an agent or substance that can be added to a food or intended for use in a feedstock for animal consumption. These agents or substances can be added directly to a food or feedstock, or used in a food contact application. Thus, their use is safe for animal consumption and safe in a food contact application.

[0036] As used herein, "expression" refers to the process by which polypeptides are produced by transcription and translation of a polynucleotide. The level of expression of a polypeptide can be assessed using any method known in the art, including, for example, methods that determine the amount of polypeptide produced from a host cell. Such methods can include, but are not limited to, quantification of polypeptides in cell lysates by ELISA, Coomassie blue staining after gel electrophoresis, Lowry protein assay, and Bradford protein assay.

[0037] As used herein, a "host cell" is a cell that is used to accept, maintain, replicate, and amplify a vector. A host cell can also be used to express a polypeptide encoded by a vector. As a host cell divides, the nucleic acid contained in the vector replicates, thereby amplifying the nucleic acid. A host cell can be a eukaryotic cell or a prokaryotic cell. Suitable host cells include, but are not limited to, CHO cells, various COS cells, HeLa cells, HEK cells, such as HEK 293 cells.

[0038] As used herein, a "vector" is a replicable nucleic acid from which one or more heterologous proteins can be expressed when the vector is transformed into an appropriate host cell. Vectors with respect include those into which a nucleic acid encoding a polypeptide or fragment thereof can be inserted by standard recombinant cloning techniques. Vectors with respect also include those that comprise a nucleic acid encoding a polypeptide. Vectors are used to introduce nucleic acids encoding polypeptides into host cells, for amplification of the nucleic acid or for expression / display of the polypeptide encoded by the nucleic acid. Vectors are typically episomal, but can be designed to integrate the gene or portion thereof into a chromosome of the genome. Vectors of artificial chromosomes, such as yeast artificial vectors and mammalian artificial chromosomes, are also contemplated. The selection and use of such vehicles is well known to those skilled in the art.

[0039] As used herein, the terms "drug," "pharmacologically active agent," and the like are used interchangeably herein and generally refer to any substance that alters animal physiology, i.e., any chemical that affects the physiological function of an organ of the body and the metabolic activities of the cells.

[0040] As used herein, "treatment" of an individual having a disease or condition means partial or complete alleviation of symptoms of the individual, or remaining unchanged after treatment. Thus, treatment includes prevention, therapy, and / or cure. Prevention refers to preventing the underlying disease and / or preventing the worsening of symptoms or disease progression. Treatment also includes any pharmaceutical use of any antibody or antigen-binding fragment thereof provided herein and compositions provided herein.

[0041] As used herein, the term "therapeutically effective amount" refers to the amount of a subject compound that will elicit the biological or medical response of a tissue, system, or subject that is being sought by a researcher, veterinarian, medical doctor, or other clinician. The term "therapeutically effective amount" includes an amount of a compound that, when administered, is sufficient to prevent the development or to alleviate to some extent one or more of the signs or symptoms of the disorder or disease being treated. The therapeutically effective amount will vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject to be treated.

[0042] II. DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS

[0043] In one aspect, the present disclosure provides an egg yolk antibody composition, wherein the egg yolk antibody composition comprises an egg yolk antibody that specifically recognizes and neutralizes a cat allergen FEL D1 and an egg yolk antibody that specifically recognizes and neutralizes a cat allergen FEL D4.

[0044] In some embodiments, the FEL D1 comprises at least one of the following amino acid sequences:

[0045] SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8.

[0046] In some embodiments, the FEL D4 comprises an amino acid sequence as set forth in SEQ ID NO: 10.

[0047] In some embodiments, the yolk antibody composition has a neutralization titer of at least 1:640000 against FEL D1, at least 1:1280000 against FEL D4; and / or a neutralization titer of at least 1:320000 against FEL D1, at least 1:80000 against FEL D4 in cat hair.

[0048] In another aspect, a method for preparing the yolk antibody composition described above comprises: S1: preparing antigen proteins comprising FEL D1 and FEL D4; S2: immunizing laying hens with the antigen proteins comprising FEL D1 and FEL D4 respectively or jointly to obtain immune eggs of the immunized hens; S3: purifying the immune eggs to obtain yolk antibodies.

[0049] In some embodiments, the S2 further comprises: a. mixing the antigen proteins comprising FEL D1 and FEL D4 with a primary immunization adjuvant to obtain a mixture; b. injecting the mixture to the laying hens for immunization.

[0050] In some preferred embodiments, the primary immunization adjuvant is Freund's complete adjuvant.

[0051] In some preferred embodiments, the antigen proteins of FEL D1 and / or FEL D4 are mixed with the Freund's complete adjuvant at a volume ratio of 1:1, and the concentration of the mixture is 2 mg / mL.

[0052] In some embodiments, the method for preparing further comprises: c. performing booster immunization every two weeks thereafter, and the antigen proteins of FEL D1 or FEL D4 are mixed with a booster immunization adjuvant at a volume ratio of 1:1.

[0053] In some preferred embodiments, the booster immunization is performed twice in c.

[0054] In some preferred embodiments, the booster immunization adjuvant is Freund's incomplete adjuvant.

[0055] In some embodiments, the antigen proteins of FEL D1 and FEL D4 are prepared by molecular cloning or genetic engineering recombinant expression method.

[0056] In some preferred embodiments, the above preparation method comprises inserting into the vector respectively a FEL D1 gene fragment selected from the group consisting of nucleotide sequences of SEQ ID NO: 1, 3, 5, 7 and a FEL D4 gene fragment selected from the group consisting of nucleotide sequences of SEQ ID NO: 9.

[0057] In some preferred embodiments, a FEL D1 gene fragment as shown in the nucleotide sequence of SEQ ID NO: 1 is inserted into the vector.

[0058] In some preferred embodiments, the above preparation uses an amplification primer selected from the group consisting of nucleotide sequences of SEQ ID NO: 11-20.

[0059] In another aspect, the present application provides an immunogenic composition comprising an isolated cat allergen FEL D1 or an immunogenic fragment thereof and an isolated cat allergen FEL D4 or an immunogenic fragment thereof.

[0060] In some embodiments, the immunogenic composition is used for preparing the above yolk antibody composition.

[0061] In some preferred embodiments, the above isolated cat allergen FEL D1 or an immunogenic fragment thereof is as shown in the amino acid sequence of SEQ ID NO: 2, 4, 6, 8.

[0062] In some preferred embodiments, the above isolated cat allergen FEL D4 or an immunogenic fragment thereof is as shown in the amino acid sequence of SEQ ID NO: 10.

[0063] In another aspect, the present application provides a liquid preparation comprising the above yolk antibody composition.

[0064] In some preferred embodiments, the above liquid preparation is prepared as a spray, a mouthwash or an irrigation.

[0065] In some preferred embodiments, the above liquid preparation further comprises a protective agent.

[0066] In some preferred embodiments, the above protective agent is selected from one or more of sorbitol and Tween 80.

[0067] In another aspect, the present application provides a food-grade powder, wherein the food-grade powder comprises the above yolk antibody composition of any one of the above aspects.

[0068] In some preferred embodiments, the above food-grade powder is used for preparing a pet food, a pet nutritional supplement. The pet food includes a complete cat food, a pet main food companion, a cat snack and the like.

[0069] In another aspect, the present application provides use of the yolk antibody composition, the liquid preparation or the food-grade powder as described above in the preparation of a product for preventing and / or reducing allergic symptoms of humans to cats.

[0070] In some preferred embodiments, the product as described above comprises a spray, a mouthwash, a pet-petting glove wet wipe, a pet care product, a pet food or a pet nutritional supplement. Among them, the pet food comprises a complete cat food, a pet main food companion, a cat treat and the like.

[0071] In some preferred embodiments, the use as described above comprises administering an effective amount of the yolk antibody composition or the liquid preparation as described above to the cat in vitro, or administering the yolk antibody composition or the food-grade powder as a part of the pet food in an effective amount.

[0072] In some preferred embodiments, the effective amount produces a neutralization titer of at least 1:640000 against FEL D1 and at least 1:1280000 against FEL D4 in cat saliva; and / or a neutralization titer of at least 1:320000 against FEL D1 and at least 1:80000 against FEL D4 in cat hair.

[0073] In another aspect, the present application provides a nucleic acid encoding the yolk antibody in the yolk antibody composition or the cat allergen or the immunogenic fragment thereof in the immunogenic composition as described above.

[0074] In some preferred embodiments, the cat allergen or the immunogenic fragment thereof in the immunogenic composition as described above is as shown in the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 9.

[0075] In another aspect, the present application provides an expression system constructed by introducing an expression vector comprising a FEL D1 gene fragment as shown in the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7 and / or a FEL D4 gene fragment as shown in the nucleotide sequence of SEQ ID NO: 9 into a host cell, respectively.

[0076] In some preferred embodiments, the host cell as described above is a CHO cell.

[0077] In another aspect, the present application provides a method for preventing and / or reducing allergic symptoms of humans to cats, the method comprising:

[0078] comprising administering an effective amount of the yolk antibody composition or the liquid preparation as described above to the cat in vitro, or administering the yolk antibody composition or the food-grade powder as a part of the pet food in an effective amount.

[0079] In some preferred embodiments, the effective amount produces a neutralization titer of at least 1 :640000 against FEL D1 and at least 1 :1280000 against FEL D4 in feline saliva; and / or a neutralization titer of at least 1 :320000 against FEL D1 and at least 1 :80000 against FEL D4 in feline hair.

[0080] For the purpose of clarity and brevity, features are described herein as part of some embodiments, either individually or in separate groups, it being understood, however, that the scope of the disclosure can include embodiments having combinations of all or some of the described features.

[0081] Example 1 : FEL D1 and FEL D4 molecular construction and expression

[0082] (1) Four FEL D1 gene fragments, such as FEL D1 -V1 to FEL D1 -V4, and FEL D4 gene fragments were synthesized respectively and ligated into cloning vectors.

[0083] FEL D1 -V1 nucleotide sequence (SEQ ID NO: 1):

[0084] ATGAAGGGCGCCTGTGTGCTGGTGCTGCTGTGGGCCGCTCTGCTGCTGATCTCCGGCGGCAACTGCGTGAAGATGGCCGAGACCTGCCCCATCTTCTATGACGTGTTCTTCGCCGTGGCCAACGGCAACGAGCTGCTGGACCTGAGCCTGACCAAGGTGAATGCTACCGAGCCCGAGAGGACCGCCATGAAGAAGATCCAGGATTGTTATGTGGAGAATGGCCTGATCAGCCGGGTGCTGGACGGCCTGGTCATGACCACCATCAGCTCCAGCAAGGATTGCATGGGCGAGGCCGTGCAGAACACCGTGGAGGACCTGAAGCTGAACACCCTGGGCCGGGAGATCTGCCCTGCTGTGAAGCGGGATGTGGACCTGTTCCTGACCGGCACCCCCGATGAGTATGTGGAGCAGGTGGCCCAGTATAAGGCCCTGCCTGTGGTGCTGGAGAACGCTCGGATCTTGAAGAATTGCGTGGATGCCAAGATGACCGAGGAGGATAAGGAGAACGCCCTGTCCGTGCTGGACAAGATCTATACCAGCCCCCTGTGTCACCACCACCACCATCACTGA.

[0085] FEL D1-V1 amino acid sequence (SEQ ID NO: 2):

[0086] MKGACVLVLLWAALLLISGGNCVKMAETCPIFYDVFFAVANGNELLLDLSLTKVNATEPERTAMKKIQDCYVENGLISRVLDGLVMTTISSSKDCMGEAVQNTVEDLKLNTLGREICPAVKRDVDLFLTGTPDEYVEQVAQYKALPVVLENARILKNCVDAKMTEEDKENALSVLDKIYTSPLCHHHHHH.

[0087] FEL D1-V2 nucleotide sequence (SEQ ID NO: 3):

[0088] ATGAAGGGCGCCTGTGTGCTGGTGCTGCTGTGGGCCGCTCTGCTGCTGATCAGCGGCGGCAATTGTGTGAAGATGGCTGAGACCTGTCCTATCTTTTATGATGTGTTTTTCGCCGTGGCCAACGGCAATGAGCTGCTGCTGGATCTGTCCCTGACCAAGGTGAATGCCACCGAGCCTGAGCGGACCGCCATGAAGAAGATCCAGGATTGCTATGTGGAGAACGGCCTGATCAGCAGGGTGCTGGATGGCCTGGTCATGACCACCATCAGCTCCTCCAAGGACTGCATGGGCGAGGCCGTGCAGAATACCGTGGAGGATCTGAAGCTGAACACCCTGGGCAGGGGCGGCGGCGGATCTGGAGGAGGAGGATCTGGCGGCGGCGGCTCTGAGATCTGTCCCGCTGTGAAGCGGGACGTGGACCTGTTCCTGACCGGCACCCCCGATGAGTATGTGGAGCAGGTGGCTCAGTATAAGGCCCTGCCCGTGGTGCTGGAGAATGCCCGGATCTTGAAGAACTGCGTGGATGCTAAGATGACCGAGGAGGATAAGGAGAACGCTCTGTCCGTGCTGGACAAGATCTACACCAGCCCTCTGTGTCACCACCACCACCATCACTGA.

[0089] FEL D1-V2 amino acid sequence (SEQ ID NO: 4):

[0090] MKGACVLVLLWAALLLISGGNCVKMAETCPIFYDVFFAVANGNELLLDLSLTKVNATEPERTAMKKIQDCYVENGLISRVLDGLVMTTISSSKDCMGEAVQNTVEDLKLNTLGRGGGGSGGGGSGGGGSGGGGSEICPAVKRDVDLFLTGTPDEYVEQVAQYKALPVVLENARILKNCVDAKMTEEDKENALSVLDKIYTSPLCHHHHHH.

[0091] FEL D1-V3 nucleotide sequence (SEQ ID NO: 5):

[0092] ATGAAGGGCGCCTGCGTGCTGGTGCTGCTGTGGGCTGCCCTGCTGCTGATCTCCGGCGGCAATTGCGTGAAGATGGCTGAGACCTGTCCTATCTTCTATGACGTGTTTTTCGCTGTGGCTAACGGCAACGAGCTGCTGGACCTGAGCCTGACCAAGGTGAATGCCACCGAGCCTGAGAGGACCGCTATGAAGAAGATCCAGGATTGTTACGTGGAGAACGGCCTGATCAGCCGGGTGCTGGATGGCCTGGTCATGACCACCATCAGCAGCAGCAAGGACTGTATGGGCGAGGCCGTGCAGAACACCGTGGAGGACCTGAAGCTGAACACCCTGGGCAGGGCTACCAATTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCTGGCCCTGAGATCTGCCCTGCTGTGAAGAGGGATGTGGATCTGTTTCTGACCGGCACCCCTGACGAGTATGTGGAGCAGGTGGCTCAGTATAAGGCTCTGCCCGTGGTGCTGGAGAACGCCAGGATCTTGAAGAATTGCGTGGACGCTAAGATGACCGAGGAGGACAAGGAGAACGCTCTGAGCGTGCTGGACAAGATCTACACCAGCCCTCTGTGTCACCACCACCACCATCACTGA.

[0093] FEL D1-V3 amino acid sequence (SEQ ID NO: 6):

[0094] MKGACVLVLLWAALLLISGGNCVKMAETCPIFYDVFFAVANGNELLLDLSLTKVNATEPERTAMKKIQDCYVENGLISRVLDGLVMTTISSSKDCMGEAVQNTVEDLKLNTLGRATNFSLLKQAGDVEENPGPEICPAVKRDVDLFLTGTPDEYVEQVAQYKALPVVLENARILKNCVDAKMTEEDKENALSVLDKIYTSPLCHHHHHH.

[0095] FEL D1-V4 nucleotide sequence (SEQ ID NO: 7):

[0096] ATGAAGGGCGCTTGTGTGCTGGTGCTGCTGTGGGCCGCCCTGCTGCTGATCAGCGGCGGAAACTGCGAGATCTGTCCTGCCGTGAAGAGGGATGTGGATCTGTTTCTGACCGGCACCCCCGATGAGTACGTGGAGCAGGTGGCTCAGTACAAGGCTCTGCCTGTGGTGCTGGAGAACGCTCGGATCTTGAAGAATTGTGTGGATGCCAAGATGACCGAGGAGGACAAGGAGAACGCCCTGAGCGTGCTGGACAAGATCTATACCAGCCCTCTGTGTGGCGGCGGCGGCTCTGGAGGAGGAGGATCTGGCGGCGGCGGAAGCGTGAAGATGGCCGAGACCTGTCCTATCTTCTACGACGTGTTTTTCGCCGTGGCCAACGGCAATGAGCTGCTGCTGGACCTGAGCCTGACCAAGGTGAATGCCACCGAGCCTGAGAGGACCGCCATGAAGAAGATCCAGGATTGCTACGTGGAGAATGGCCTGATCAGCCGGGTGCTGGATGGCCTGGTCATGACCACCATCTCCAGCTCCAAGGACTGTATGGGCGAGGCTGTGCAGAATACCGTGGAGGATCTGAAGCTGAATACCCTGGGCCGGCACCACCACCACCATCACTGA.

[0097] FEL D1-V4 amino acid sequence (SEQ ID NO: 8):

[0098] MKGACVLVLLWAALLLISGGNCEICPAVKRDVDLFLTGTPDEYVEQVAQYKALPVVLENARILKNCVDAKMTEEDKENALSVLDKIYTSPLCGGGGSGGGGSGGGGSVKMAETCPIFYDVFFAVANGNELLLDLSLTKVNATEPERTAMKKIQDCYVENGLISRVLDGLVMTTISSSKDCMGEAVQNTVEDLKLNTLGRHHHHHH.

[0099] FEL D4 nucleotide sequence (SEQ ID NO: 9):

[0100] GGATCCGCCACCATGAAGTTGCTGCTCTTGTGTCTCGGCCTTATTCTGGTGTGTGCCCACGAAGAGGAGAACGTGGTACGAAGTAACATAGATATCTCCAAAATCTCTGGCGAGTGGTACTCCATTCTCCTGGCATCTGACGTAAAGGAAAAAATTGAAGAGAATGGATCAATGCGGGTGTTTGTGGAGCATATTAAGGCTCTCGATAATTCTAGCCTGAGCTTCGTGTTTCACACTAAGGAGAACGGAAAGTGCACCGAGATCTTCTTGGTAGCTGATAAGACCAAGGACGGCGTGTACACCGTCGTGTACGATGGTTACAACGTCTTCAGCATCGTGGAAACAGTCTACGATGAGTACATTCTGCTGCACTTGCTGAATTTCGACAAAACACGGCCTTTTCAGCTGGTGGAGTTTTACGCTAGAGAGCCAGACGTCTCCCAGAAACTGAAGGAAAAGTTTGTCAAATACTGCCAGGAACATGGGATCGTGAATATCTTGGACCTGACTGAAGTTGATCGTTGTCTCCAGGCTCGGGGTTCCGAAGTGGCTCAGGATAGTAGCGTGGAGCACCACCATCACCACCATTAGGTCGAC.

[0101] FEL D4 amino acid sequence (SEQ ID NO: 10):

[0102] MKLLLLCLGLILVCAHEEENVVRSNIDISKISGEWYSILLASDVKEKIEENGSMRVFVEHIKALDNSSLSFVFHTKENGKCTEIFLVADKTKDGVYTVVYDGYNVFSIVETVYDEYILLHLLNFDKTRPFQLVEFYAREPDVSQKLKEKFVKYCQEHGIVNILDLTEVDRCLQARGSEVAQDSSVEHHHHHH.

[0103] (2) The primer pairs shown in Table 1 below were designed and synthesized.

[0104] Table 1: Primer pair sequences

[0105] Primer Sequence SEQ ID NO: FEL D1-V1-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGGGCGCTTGT 11 FEL D1-V1-R TGATTATGATCAATGAATTCTCAGTGATGGTGGTGGTGGTGCC 12 FEL D1-V2-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGGGCGCCT 13 FEL D1-V2-R TGATTATGATCAATGAATTCTCAGTGATGGTGGTGGTGGTGACACA 14 FEL D1-V3-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGGGCGCCT 15 FEL D1-V3-R TGATTATGATCAATGAATTCTCAGTGATGGTGGTGGTGGTGACACA 16 FEL D1-V4-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGGGCGCTTGT 17 FEL D1-V4-R TGATTATGATCAATGAATTCTCAGTGATGGTGGTGGTGGTGCC 18 FEL D4-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGTTGCTGCTCTTGTG 19 FEL D4-R TGATTATGATCAATGAATTCCTAATGGTGGTGATGGTGGTGCTCCAC 20

[0106] (3) The CHO cell expression plasmid was obtained by double enzyme digestion with Hind III / EcoR I, and the inserted fragment was obtained by PCR and gel recovery of the synthetic fragment using the primer pairs FEL D1-V1-F / R and FEL D4-F / R, respectively;

[0107] The PCR reaction system (50 μL) was as follows: buffer 5 μL; dNTP 5 μL, MgSO4 3 μL, KOD 1 μL, H2O 32 μL, template 2 μL, and each of the upstream and downstream primers (10 μM) 1 μL; and the PCR reaction conditions were as follows: 95 °C pre-denaturation for 30 s, 95 °C denaturation for 30 s, 64 °C annealing for 30 s, 68 °C extension for 1 min, and 34 cycles.

[0108] (4) The enzyme-digested plasmid and inserted fragment were recombined using a seamless cloning kit (ABclonal, RM20523) and transformed into DH5α competent cells, which were then coated on an LB plate containing ampicillin and cultured at 37 °C overnight.

[0109] (5) The next day, single colonies were picked and subjected to PCR identification, and the FEL D1-V1 gene fragment and the FEL D4 gene fragment were subjected to colony PCR using the primer pairs FEL D1-V1-F / R and FEL D4-F / R, respectively. The PCR system was as described in step (3), and positive strains were selected and subjected to sequencing verification. Figure 1 )。

[0110] (6) The strains with correct sequencing were named DH5α-FEL D1 and DH5α-FEL D4.

[0111] (7) The verified correct strains were inoculated into LB liquid medium containing ampicillin and cultured at 37 °C, 200 rpm overnight. The next day, the plasmid was extracted using a plasmid extraction kit, and the extracted plasmid was named plasmid FEL D1 and plasmid FEL D4.

[0112] (8) The plasmids FEL D1 and FEL D4 were stably transfected into CHO cells, and after the viability rebounded, the cells were subjected to pressure screening using CD04+50 μM Msx 30. The medium was replaced every 3 days during the culture process, and after the cell viability decreased and rebounded to more than 80%, the cells were preserved and subjected to production measurement.

[0113] (9) During the production measurement, the medium was replaced every two days to maintain normal cell growth, and the production measurement was terminated when the cell viability decreased to less than 50%. The cell supernatant was subjected to WB verification. Figure 2

[0114] ​(10) After verification, the successfully transfected cells were named CHO-FEL D1 and CHO-FEL D4, respectively.

[0115] Example 2: FEL D1 and FEL D4 protein purification

[0116] The cat allergen FEL D1 / FEL D4 cell supernatant was obtained, and the NaCl final concentration of the cat allergen FEL D1 / FEL D4 cell supernatant was adjusted to 0.5M and pH 7.5. Further, the Polar MC60-Ni Excel was used as the filler for purification, the column was equilibrated, and the column was equilibrated to conductivity and pH with 5CV Buffer 1 (20mM PB, 500mM NaCl, pH 7.5) at a linear flow rate of 150cm / h, and the sample was loaded at a linear flow rate of 150cm / h, and the column was eluted with Buffer 1 at a linear flow rate of 150cm / h for a total of 20CV, and the column was equilibrated to conductivity and pH; the column was eluted with 0-100% linear gradient of Buffer 2 (20mM PB, 500mM NaCl, 500mM imidazole, pH 7.5) at a linear flow rate of 150cm / h for a total of 20CV; the column was eluted with 100% linear gradient of Buffer 2 at a linear flow rate of 150cm / h for a total of 5CV; and the elution peak solution was collected, which was the purified cat allergen FEL D1 / FEL D4 antigen. The FEL D1 molecules used in the subsequent examples were all obtained by FEL D1-V1 expression.

[0117] Example 3: FEL D1 and FEL D4 immunized laying hens

[0118] The purified FEL D1 and FEL D4 proteins described above were diluted to a concentration of 2mg / mL; the FEL D1 and FEL D4 proteins described above were respectively compounded with Freund's complete adjuvant at a volume ratio of 1:1, and a high-speed stirrer was used for emulsification, and finally water-in-oil Freund's complete adjuvant antigens were prepared, with a concentration of 1mg / mL. The FEL D1 and FEL D4 proteins described above were respectively compounded with Freund's incomplete adjuvant at a volume ratio of 1:1, and a high-speed stirrer was used for emulsification, and finally water-in-oil Freund's incomplete adjuvant antigens were prepared, with a concentration of 1mg / mL.

[0119] Select the mother hen chicks that have not produced eggs for feeding, and start immunization 35-55 days before egg production, half for FEL D1 immunization and the other half for FEL D4 immunization; the initial immunization uses Freund's complete adjuvant antigen, the immunization dose is 1.0 mL per chicken, and the immunization is performed by subcutaneous multiple point injection and intramuscular injection; the first booster immunization is performed 14 days after the initial immunization, the booster immunization uses Freund's incomplete adjuvant antigen, the immunization dose is 1.0 mL per chicken; the second booster immunization is performed 14 days later, the booster immunization uses Freund's incomplete adjuvant antigen, the immunization dose is 1.0 mL per chicken. A total of three immunizations, collect the chicken eggs in time after the hens lay eggs and separate the egg yolks for freeze-drying or purification.

[0120] Example 4: Yolk antibody titer detection

[0121] Reagents: FEL D1 antigen (2.378 mg / mL), FEL D4 antigen (2.013 mg / mL), Goat anti-Chicken IgY (H+L) secondary antibody, HRP (product number: 10A16054; specification: 1 mg, thermofisher), blocking solution (PBS+3% BSA), PBST (0.1% Tween 20) washing solution, PBS buffer (pH 7.4), sample diluent (PBS+0.5% BSA), TMB developing solution, 1M H2SO4 stop solution. Among them, 10x PBS: weigh sodium chloride 160 g, add dodecahydrate sodium hydrogen phosphate 58 g, potassium dihydrogen phosphate 4 g, add 1.8 L ultrapure water to dissolve, adjust pH to 7.3±0.1, purify water to 2 L, store at room temperature, valid for 3 months. Blocking solution: 3% BSA in PBS buffer. PBST (0.1% Tween 20) washing solution: measure 1x PBS solution 1000 mL, add 1 mL Tween 20, mix well, prepare fresh. Sample diluent: 0.5% BSA in PBS buffer. Stop solution (1M H2SO4): measure 850 mL of purified water into a glass cup. Slowly add 50 mL of 98% concentrated sulfuric acid along the wall, stir and disperse heat while adding, store at room temperature. Carbonate buffer (pH 9.6): weigh 1.59 g of sodium carbonate, 2.93 g of sodium bicarbonate, add to about 800 mL of ultrapure water, stir to dissolve thoroughly. Adjust pH to 9.6±0.1, dilute to 1 L with ultrapure water, can be scaled down proportionally as needed, fill in the reagent label on the bottle. Store at 2-8°C, valid for 3 months. TMB developing solution: use Thermo 1-StepTM Ultra TMB-ELISA.

[0122] Specific experimental steps:

[0123] (1) Plate coating: Dilute the CHO-expressed FEL D1 antigen and FEL D4 antigen to 1 pg / mL with carbonate buffer (pH 9.6), 100 pL / well, and coat at 4°C overnight.

[0124] (2) Wash plate: Wash the plate with 0.1% PBST, 300 pL / well, and wash 3-5 times.

[0125] (3) Blocking: Add blocking solution (PBS + 3% BSA) 200 pL / well to the 96-well plate, incubate at 25°C, 100 rpm for 1.5 h.

[0126] (4) Wash plate: Wash the plate with 0.1% PBST, 300 pL / well, and wash 3-5 times.

[0127] (5) Sample addition: Dilute the purified egg yolk antibody test sample and negative sample 10,000-fold first, then perform 2-fold gradient dilution to dilute the remaining 7 points, 100 pL / well, and incubate at 25°C, 100 rpm for 1.5 h. (Note: Use 0.5% BSA instead of sample for blank control).

[0128] (6) Wash plate: Wash the plate with 0.1% PBST, 300 pL / well, and wash 3-5 times.

[0129] (7) Add secondary antibody: Dilute Goat anti-Chicken IgY (H+L) secondary antibody HRP (Cat No: A16054; Size: 1 mg, thermofisher) 4000-fold with sample diluent (PBS + 0.5% BSA), then add 100 pL per well, incubate at 25°C, 100 rpm for 1.5 h.

[0130] (8) Wash plate: Wash the plate with 0.1% PBST, 300 pL / well, and wash 3-5 times.

[0131] (9) TMB color development: Add 100 pL of TMB color developing solution per well for color development, and incubate at room temperature for 17 min.

[0132] (10) Stop the reaction with stop solution: Add 100 pL of 1M H2SO4 solution per well to stop the reaction.

[0133] Calculation: Egg yolk antibody titer (p / n) = OD value of test sample / OD value of negative sample corresponding to dilution. The maximum dilution when p / n is greater than 2.1 is taken as the egg yolk antibody titer.

[0134] The partial egg yolk antibody titers are shown in Table 2.

[0135] Table 2: Partial egg yolk antibody titers

[0136] Number 1 2 3 4 5 6 FELD1-IGY 1:640000 1:320000 1:640000 1:640000 1:1280000 1:640000 FELD4-IGY 1:1280000 1:640000 1:640000 1:1280000 1:640000 1:640000

[0137] Example 5: Purification of egg yolk antibodies

[0138] (1) Solution preparation

[0139] The reagents used for purification are shown in Table 3.

[0140] Table 3: Reagents used for purification

[0141] Number Reagent name Specification Form 1 Hydrochloric acid Analytically pure Liquid 2 Ammonium sulfate Analytically pure Solid 3 Sodium hydroxide Analytically pure Solid

[0142] (2) Preparation of saturated ammonium sulfate solution: 767 g of saturated ammonium sulfate was dissolved in 1 L of distilled water.

[0143] (3) Two-step ammonium sulfate precipitation

[0144] The egg yolk was collected, diluted with distilled water at a ratio of 1:9 at 4°C, homogenized for 1 minute, and the egg yolk dilution was adjusted to pH 5.0 with 1 M HCL (overnight), centrifuged (11000 rpm, 4°C, 20 min), and the supernatant was collected. The supernatant was clarified by passing it through a 0.22 μm membrane.

[0145] The clarified solution was salted out with saturated ammonium sulfate at a final concentration of 40%, and allowed to stand overnight at 4°C to allow the proteins to fully precipitate. Then, it was centrifuged at 11000 rpm for 20 min, and the supernatant was discarded. 10 mL of PBS was added to dissolve the precipitate (Note: Before use, the saturated ammonium sulfate should be adjusted to pH 7.0 with ammonium hydroxide).

[0146] The solution was salted out with saturated ammonium sulfate at a final concentration of 40%, and allowed to stand for 2 h at 4°C with stirring, then precipitated, and then centrifuged at 11000 rpm for 20 min. The precipitate was resuspended in 10 mL of PBS.

[0147] The solution was transferred to a dialysis bag and dialyzed overnight in PBS buffer. The next day, the solution in the dialysis bag was removed, which was the purified egg yolk antibody solution.

[0148] Example 6: Preparation of liquid formulation

[0149] (1) Formulation

[0150] The liquid formulation is shown in Table 4.

[0151] Table 4: Liquid formulation

[0152]

[0153]

[0154] (2) Preparation of IgY liquid formulation

[0155] Collection of purified egg yolk antibody solution

[0156] Add sorbitol at a final concentration of 40 mg / mL and Tween 80 at 0.2 mg / mL to the purified solution and mix well.

[0157] Filter the above preparation stock solution with a 0.22 μm filter to remove bacteria and obtain the final liquid preparation stock solution.

[0158] (3) Titer determination of liquid preparation stock solution

[0159] The titer determination results are shown in Table 5.

[0160] Table 5: Titer of liquid preparation stock solution

[0161] Number Titer FELD1-IGY liquid preparation 1:640000 FELD4-IGY liquid preparation 1:1280000

[0162] Example 7: Neutralization effect experiment of FEL D1 and FEL D4 egg yolk antibody liquid preparation

[0163] 1. Indirect sandwich ELISA for detecting the neutralization activity of egg yolk antibody against FEL D1 in hair and saliva

[0164] Reagents: 6F9 anti FEL D1 (indoor, MA-6F9), biotin-3E4 anti FEL D1 (indoor, MA-3E4, biotinylated), Streptavidin (HRP) (Abcam, ab7403), blocking solution (PBS + 3% BSA), PBST (0.1% Tween 20) washing solution, PBS buffer (pH 7.4), sample diluent (PBS + 0.5% BSA), TMB color developing solution, 1M H2SO4 stop solution.

[0165] Among them, 10xPBS: take sodium chloride 160g, add disodium hydrogen phosphate 58g, potassium dihydrogen phosphate 4g, add 1.8L ultrapure water to dissolve, adjust pH to 7.3±0.1, purify water to 2L, store at room temperature, valid period is 3 months. Blocking solution: 3% BSA PBS buffer. PBST (0.1% Tween 20) washing solution: take 1xPBS solution 1000mL, add 1mL Tween 20, mix well, and prepare immediately. Sample diluent: 0.5% BSA PBS buffer. Stop solution (1M H2SO4): take 850mL purified water and add to a glass cup. Slowly add 50mL 98% concentrated sulfuric acid along the wall, stir and disperse heat while adding, store at room temperature. Carbonate buffer (pH 9.6): take 1.59g sodium carbonate, 2.93g sodium bicarbonate, add to about 800mL ultrapure water, stir to dissolve thoroughly. Adjust pH to 9.6±0.1, dilute to 1L with ultrapure water, scale down as needed, and label the reagent on the bottle. Store at 2-8℃, valid period is 3 months. TMB developing solution: use Thermo 1-StepTMUltra TMB-ELISA.

[0166] Specific experimental steps:

[0167] (1) Plate coating: 100μL of 6F9 anti FEL D1 diluted 1000 times with carbonate buffer (pH 9.6) per well, 4℃ coating overnight.

[0168] (2) Sample preparation: The purified yolk antibody liquid preparation FELD1-IGY was diluted by 2 times, and the yolk antibody with titers of 1:640000, 1:320000, 1:160000, 1:80000 and 1:40000 was prepared. The treated hair samples were diluted by 2 times, and the FEL D1 hair samples with final concentrations of 1.15μg / mL, 0.575g / mL, 0.288μg / mL, 0.144μg / mL, 0.072μg / mL and 0.036μg / mL were prepared. The treated saliva samples were diluted by 2 times, and the FELD1 saliva samples with final concentrations of 4.5μg / mL, 2.25μg / mL, 1.125μg / mL, 0.56μg / mL, 0.28μg / mL and 0.14μg / mL were prepared.

[0169] The treated hair or saliva samples were mixed with different titers of yolk antibody liquid preparation and BSA control in equal volume (60μL+60μL), and incubated at 4℃ overnight.

[0170] (3) Plate washing: wash the plate with 0.1% PBST, 300μL / well, wash the plate 3-5 times.

[0171] (4) Blocking: Blocking solution (PBS + 3% BSA) 200 μL / well was added to the 96-well plate, incubated at 25°C, 100 rpm for 1.5 h.

[0172] (5) Washing plate: Washing plate with 0.1% PBST, 300 μL / well, washing plate 3-5 times.

[0173] (6) Sample loading: The above overnight incubated sample 100 μL / well was loaded, incubated at 25°C, 100 rpm for 1.5 h.

[0174] (7) Washing plate: Washing plate with 0.1% PBST, 300 μL / well, washing plate 3-5 times.

[0175] (8) Biotin 3E4 anti FEL D1 loading: After Biotin 3E4 anti FEL D1 was diluted 10000 times with sample diluent (PBS + 0.5% BSA), 100 μL per well was loaded, incubated at 25°C, 100 rpm for 1.5 h.

[0176] (9) Washing plate: Washing plate with 0.1% PBST, 300 μL / well, washing plate 3-5 times.

[0177] (10) Streptavidin (HRP) loading: After Streptavidin (HRP) was diluted 10000 times with sample diluent (PBS + 0.5% BSA), 100 μL per well was loaded, incubated at 25°C, 100 rpm for 1.5 h.

[0178] (11) Washing plate: Washing plate with 0.1% PBST, 300 μL / well, washing plate 3-5 times.

[0179] (12) TMB color development: 100 μL TMB color developing solution was added per well for color development, incubated at room temperature for 10 min.

[0180] (13) Reaction termination with stop solution: 100 μL 1M H2SO4 solution was added per well to terminate the reaction.

[0181] FEL D1 content range: hair (0.215-1.735 μg / mL) and saliva (0.83-6.86 μg / mL). As shown, the titer is higher than 1:320000, and the yolk antibody has good neutralizing effect on FEL D1 in hair; as shown, the titer is higher than 1:640000, and the yolk antibody has good neutralizing effect on FEL D1 in saliva. Figure 3 Figure 4

[0182] ​​2. Kit for detecting neutralizing activity of yolk antibodies on FEL D4 in hair and saliva

[0183] (1) Sample preparation: The purified yolk antibody liquid preparation FELD4-IGY was diluted by 2 times, and yolk antibodies with titers of 1:1280000, 1:640000, 1:320000, 1:160000 and 1:80000 were prepared; the treated saliva sample was diluted by 3 times, and FEL D4 saliva samples with final concentrations of 8.33 μg / mL, 2.78 μg / mL, 0.93 μg / mL, 0.31 μg / mL, 0.1 μg / mL, 0.03 μg / mL and 0.01 μg / mL were prepared; the treated saliva sample was mixed with the yolk antibody liquid preparation and the BSA control of different titers in equal volume (60 μL+60 μL) respectively, and then incubated at 4°C overnight.

[0184] (2) Plate washing: plate washing was performed with WASH BUFFER, 150 μL / well, and the plate was washed once.

[0185] (3) Sample addition: 100 μL / well of the above overnight incubated sample was added, and incubated at room temperature for 1 h.

[0186] (4) Plate washing: plate washing was performed with WASH BUFFER, 150 μL / well, and the plate was washed 3 times.

[0187] (5) Anti FEL D4 addition: the antibody was mixed according to the instruction 1:1000.

[0188] (6) Plate washing: plate washing was performed with WASH BUFFER, 150 μL / well, and the plate was washed 3 times.

[0189] (7) TMB addition: 100 μL per well was added, and incubated until STD was 0.08-1.2 at 450 nm.

[0190] (8) Plate washing: plate washing was performed with WASH BUFFER, 150 μL / well, and the plate was washed 3 times.

[0191] (9) Color development: 100 μL of TMB was added to each well, and color developed for 5 min.

[0192] (10) Reaction termination by stop solution: 100 μL of 1M H2SO4 solution was added to each well to terminate the reaction.

[0193] FEL D4 content range: hair (0.001-0.0105 μg / mL) and saliva (1.32-19.71 μg / mL). As Figure 5As shown, the titer is higher than 1:1280000, the yolk antibody has certain neutralizing effect on FEL D4 in saliva; the FEL D4 content in the hair sample is extremely low and cannot be quantitatively detected, and the titer is higher than 1:80000 according to the detection result of the saliva sample, and the yolk antibody has good neutralizing effect on FEL D4 in hair.

[0194] In summary, the release titer of the yolk antibody composition disclosed in the application is shown in Table 6.

[0195] Table 6: Release titer of yolk antibody composition

[0196]

[0197] The yolk antibody and the composition thereof provided by the application are simultaneously directed against FEL D1 and FEL D4, wherein four gene expression sequences of FEL D1 are independently designed and optimized, and the optimal sequence is selected for antigen expression. The high-titer yolk antibody against FEL D1 and FEL D4 is purified, a protective agent is added, and a liquid preparation is prepared, which can neutralize allergens together, can more effectively reduce the occurrence of allergic reactions, and is more convenient to store and use. The liquid preparation can be used for preparing products such as sprays, mouthwashes, pet petting gloves, and wet wipes. In addition, the high-titer yolk antibody against FEL D1 and FEL D4 can also be freeze-dried to prepare a food-grade powder, which can be used for preparing products such as full-value cat food, pet main food companions, cat snacks, and pet nutritional supplements. The immunogenic composition and the yolk antibody and the composition generated by the application have better neutralizing titer and stability in application.

[0198] Example 8: Yolk antibody titer stability

[0199] Reagent FEL D1 antigen (2.378 mg / mL), FEL D4 antigen (2.013 mg / mL), Goat anti-Chicken IgY (H+L) secondary antibody, HRP (Cat: A16054; Size: 1 mg, thermofisher), blocking solution (PBS+3% BSA), PBST (0.1% Tween 20) wash, PBS buffer (pH 7.4), sample diluent (PBS+0.5% BSA), TMB color developing solution, 1M H2SO4 stop solution. Among them, 10x PBS: weigh sodium chloride 160 g, add disodium hydrogen phosphate dihydrate 58 g, potassium dihydrogen phosphate 4 g, add 1.8 L ultrapure water to dissolve, adjust pH to 7.3±0.1, purify water to constant volume to 2 L, store at room temperature, valid for 3 months. Blocking solution: 3% BSA in PBS buffer. PBST (0.1% Tween 20) wash: measure 1x PBS solution 1000 mL, add 1 mL Tween 20, mix well, prepare immediately. Sample diluent: 0.5% BSA in PBS buffer. Stop solution (1M H2SO4): measure 850 mL purified water into a glass cup. Slowly add 50 mL 98% concentrated sulfuric acid along the wall, stir and disperse heat while adding, store at room temperature. Carbonate buffer (pH 9.6): weigh 1.59 g sodium carbonate, 2.93 g sodium bicarbonate, add to about 800 mL ultrapure water, stir to dissolve thoroughly. Adjust pH to 9.6±0.1, dilute to 1 L with ultrapure water, can be scaled down as needed, fill in the reagent label on the bottle. Store at 2-8°C, valid for 3 months. TMB color developing solution: use Thermo 1-StepTM Ultra TMB-ELISA.

[0200] Specific experimental steps:

[0201] (1) Plate coating: dilute the CHO-expressed FEL D1 antigen and FEL D4 antigen with carbonate buffer (pH 9.6) to 1 μg / mL, 100 μL / well, and incubate overnight at 4°C.

[0202] (2) Wash the plate: wash the plate with 0.1% PBST, 300 μL / well, wash the plate 3-5 times.

[0203] (3) Blocking: add 200 μL / well of blocking solution (PBS+3% BSA) to the 96-well plate, incubate at 25°C, 100 rpm for 1.5 h.

[0204] (4) Wash the plate: wash the plate with 0.1% PBST, 300 μL / well, wash the plate 3-5 times.

[0205] (5) Add sample: Dilute the yolk antibody samples taken at different time points and the negative sample 10,000 times, then dilute them 2 times in gradient, dilute the remaining 7 points, 100 μL / well, 25°C, 100 rpm, incubate for 1.5 h (Note: use 0.5% BSA instead of sample for blank control).

[0206] (6) Wash the plate: wash the plate with 0.1% PBST, 300 μL / well, wash the plate 3-5 times.

[0207] (7) Add secondary antibody: dilute Goat anti-Chicken IgY (H+L) secondary antibody HRP (Cat No: A16054; Specification: 1 mg, thermofisher) 4000 times with sample diluent (PBS+0.5% BSA), then add 100 μL per well, 25°C, 100 rpm, incubate for 1.5 h.

[0208] (8) Wash the plate: wash the plate with 0.1% PBST, 300 μL / well, wash the plate 3-5 times.

[0209] (9) TMB color development: add 100 μL TMB color developing solution per well for color development, incubate at room temperature for 17 min.

[0210] (10) Stop the reaction with stop solution: add 100 μL 1M H2SO4 solution per well to stop the reaction.

[0211] Calculation: yolk antibody titer (p / n) = OD value of the sample to be tested / OD value of the negative sample corresponding to the dilution. The maximum dilution when p / n is greater than 2.1 is taken as the yolk antibody titer.

[0212] The results of the stability experiment of yolk antibody at different temperatures are shown in Tables 7 and 8, wherein the FEL D1 antibody and the FEL D4 antibody exhibit good titer at normal temperature and other temperatures, and are not affected by storage time.

[0213] Table 7: Stability of FEL D1 antibody and FEL D4 antibody at 4°C and 25°C

[0214]

[0215] Table 8: Stability of FEL D1 antibody and FEL D4 antibody at 40°C and 50°C

[0216]

[0217] Example 9: Verification of allergen reduction effect after feeding cats with freeze-dried powder containing anti-Fel d1 and Fel d4 specific yolk antibodies

[0218] The freeze-dried powder of egg yolk (containing anti-Fel d1 and Fel d4 specific egg yolk antibodies) obtained in Example 3 was added to ordinary cat food at a mass ratio of 1% and fed to 9 experimental cats. The control period before feeding the freeze-dried powder of egg yolk was 1 week, and the experimental period was continuously fed for 6 weeks. The saliva and hair clinical samples of the 9 cats for a total of 7 weeks during the control period and the experimental period were detected for the content of Fel d1 and Fel d4, respectively, and the results were counted. The average value of the content of Fel d1 or Fel d4 in the saliva and hair clinical samples of the 9 cats at a single time point was summarized (the content of Fel d4 in the hair was too low to be detected, so it was not detected). The results of 7 weeks were summarized in Table 9, and the change trend was shown in the following Figure 6-Figure 8 :

[0219] Table 9: Results of detection of Fel d1 and Fel d4 antigen content in saliva and hair of experimental cats (ug / ml)

[0220]

Claims

1. An egg yolk antibody composition, characterized in that, The egg yolk antibody composition consists of an egg yolk antibody that specifically recognizes and neutralizes the feline allergen FEL D1 and an egg yolk antibody that specifically recognizes and neutralizes the feline allergen FEL D4. The FEL D1 has the amino acid sequence shown in SEQ ID NO: 2; The FEL D4 is an amino acid sequence as shown in SEQ ID NO:

10.

2. The method for preparing the egg yolk antibody composition according to claim 1, characterized in that, include: S1: Preparation of FEL D1 antigen protein and FEL D4 antigen protein; S2: Immunize laying hens with the antigen proteins of FEL D1 and FEL D4 to obtain immunized eggs from the immunized hens; S3: Purify the immune eggs to obtain yolk antibodies.

3. The preparation method according to claim 2, characterized in that, S2 further includes: a. Mix the FEL D1 antigen protein and the FEL D4 antigen protein with a primary immunizing adjuvant to obtain a mixture; b. Inject the mixture into laying hens for immunization.

4. The preparation method according to claim 3, characterized in that, The primary adjuvant is Freund's complete adjuvant.

5. The preparation method according to claim 4, characterized in that, The FEL D1 antigen protein and the FEL D4 antigen protein were mixed with Freund's complete adjuvant at a volume ratio of 1:1, and the concentration after mixing was 2 mg / mL.

6. The preparation method according to any one of claims 2-5, characterized in that, The preparation method further includes: c. Boost immunizations are then performed every two weeks. During booster immunizations, the FEL D1 antigen protein and the FEL D4 antigen protein are mixed with the booster adjuvant at a volume ratio of 1:

1.

7. The preparation method according to claim 6, characterized in that, The above-mentioned c-method involves two booster immunizations.

8. The preparation method according to claim 7, characterized in that, The enhanced immune adjuvant is Freund's incomplete adjuvant.

9. The preparation method according to claim 2, characterized in that, The antigenic proteins of FEL D1 and FEL D4 were prepared using molecular cloning or genetic engineering recombinant expression methods.

10. The preparation method according to claim 9, characterized in that, The FEL D1 gene fragment with nucleotide sequence as shown in SEQ ID NO: 1 and the FEL D4 gene fragment with nucleotide sequence as shown in SEQ ID NO: 9 were inserted into the vector, respectively.

11. The preparation method according to claim 10, characterized in that, During preparation, amplification primers selected from those shown in nucleotide sequences SEQ ID NO: 11, 12, 19 or 20 are used.

12. An immunogenic composition, characterized in that, It consists of isolated feline allergen FEL D1 and isolated feline allergen FEL D4; The isolated feline allergen FEL D1 is shown in the amino acid sequence SEQ ID NO: 2; The isolated feline allergen FEL D4 is shown in the amino acid sequence SEQ ID NO:

10.

13. A liquid formulation, characterized in that, The liquid formulation comprises the egg yolk antibody composition as described in claim 1 or the egg yolk antibody composition obtained by any one of the preparation methods described in claims 2-11.

14. The liquid formulation according to claim 13, characterized in that, The liquid preparation is in the form of a spray, wet gloves / wipes, or mouthwash.

15. The liquid formulation according to claim 14, characterized in that, The liquid formulation also contains a protective agent.

16. The liquid formulation according to claim 15, characterized in that, The protective agent is selected from one or more of sorbitol and Tween 80.

17. A food-grade powder, characterized in that, The food-grade powder comprises the egg yolk antibody composition as described in claim 1 or the egg yolk antibody composition obtained by any one of the preparation methods described in claims 2-11.

18. The food-grade powder according to claim 17, characterized in that, The food-grade powder is used to prepare cat food, cat food supplements, or pet snacks.

19. Use of the egg yolk antibody composition of claim 1, the egg yolk antibody composition obtained by the preparation method of any one of claims 2-11, the liquid formulation of any one of claims 13-16, or the food-grade powder of claim 17 or 18 in the preparation of products for the prevention and / or relief of human allergic symptoms to cats; The uses include administering an effective amount of the egg yolk antibody composition or the liquid formulation to a cat externally, or administering the egg yolk antibody composition or the food-grade powder in an effective amount as part of a pet food. The effective amount produces a neutralizing potency of at least 1:640,000 against FEL D1 and at least 1:1,280,000 against FEL D4 in cat saliva; and / or produces a neutralizing potency of at least 1:320,000 against FEL D1 and at least 1:80,000 against FEL D4 in cat hair.

20. The use according to claim 19, characterized in that, The products mentioned include sprays, pet grooming gloves and wipes, mouthwash, pet grooming products, cat food, cat food supplements, pet treats, or pet nutritional supplements.

21. Nucleic acid encoding the feline allergen in the immunogenic composition of claim 12.

22. The nucleic acid according to claim 21, characterized in that, The nucleic acids encoding the feline allergen in the immunogenic composition are shown in the nucleotide sequences SEQ ID NO: 1 and 9.

23. An expression system, characterized in that, The expression system is constructed by introducing expression vectors of the FEL D1 gene fragment (as shown in SEQ ID NO: 1) and the FEL D4 gene fragment (as shown in SEQ ID NO: 9) into host cells, respectively.

24. The expression system according to claim 23, characterized in that, The host cell is a CHO cell.

Images