Method for fusion expression and purification of antioxidant peptide based on ice tag

Abstract

The invention discloses a method for fusion expression and purification of an antioxidant peptide based on an ice tag, and belongs to the technical field of bioengineering. The invention provides an engineering bacterium for efficiently expressing antioxidant peptide. The engineering bacterium comprises a recombinant plasmid and an escherichia coli expression host, the recombinant plasmid comprises a target gene, a gene for coding a dissolution-promoting tag, a gene for coding an antifreeze peptide and an expression vector. And inoculating the engineering bacteria into a culture medium, culturing to obtain a zymophyte solution, and carrying out induced expression and purification to obtain the fusion antioxidant peptide.

Description

Technical Field

[0001] The invention relates to a method for fusion expression and purification of antioxidant peptides based on "ice tags", belonging to the technical field of bioengineering. Background Art

[0002] Antioxidant peptides are a class of natural bioactive peptides with multiple health benefits such as anti-oxidation, anti-hypertensive and anti-cancer. In recent years, they have received extensive attention in the field of food and healthcare products. Traditional methods of producing antioxidant peptides, such as enzymatic hydrolysis and chemical synthesis, have complex steps, low yields, and high costs. Using recombinant DNA technology, genes for antioxidant peptides can be designed and synthesized, and expressed and purified through host expression bacteria. This method effectively overcomes the shortcomings of traditional methods, improves the yield and purity of antioxidant peptides, and brings opportunities for the development of antioxidant peptides.

[0003] In terms of large-scale separation and purification of proteins, although chromatography is relatively mature, its high cost (about 60% to 70% of the total cost) and low purification efficiency limit its industrial application. Fusion tag technology simplifies the purification process by fusing specific polypeptides (such as histidine tags), but the cost of affinity chromatography is still high and the purification efficiency is low, making it difficult to scale up industrially.

[0004] Antifreeze peptides are a class of small molecule proteins or protein hydrolysates that can protect organisms from damage in freezing or sub-freezing states. They can adsorb on the surface of ice crystals, thereby restricting ice crystal growth, inhibiting ice crystal recrystallization, and changing the morphology of ice crystals. This characteristic makes antifreeze peptides important in protecting organisms from low-temperature damage.

[0005] CN113481230A discloses a method for separating and purifying exogenous recombinant proteins using antifreeze protein-intein sequences as purification tags. However, the method disclosed in CN113481230A also has the problem that the molecular weight of the tag protein is too large (32 kDa). The increase in the molecular weight of the fusion protein may lead to a decrease in expression efficiency, especially in bacterial expression systems, which may lead to the formation of insoluble inclusion bodies. It may also interfere with the natural structure, function or activity of the target protein. Summary of the invention

[0006] [Technical issues]

[0007] By utilizing DNA recombination technology, heterologous expression of antioxidant peptides can be achieved through host bacteria. However, the separation and purification of antioxidant peptides still has problems of high cost and low efficiency.

[0008] [Technical solution]

[0009] In a first aspect of the present invention, an engineered bacterium for efficiently expressing an antioxidant peptide is provided, wherein the engineered bacterium comprises a recombinant plasmid and an Escherichia coli expression host; the recombinant plasmid comprises a target gene, a gene encoding a lytic tag, a gene encoding an antifreeze peptide, and an expression vector; the target gene is a gene encoding a short peptide FFLK, ELIY or YPF obtained by tandemly connecting a certain number of genes encoding FFLK, ELIY or YPF and codon optimization; the gene encoding the lytic tag is a gene encoding SUMO; the gene encoding the antifreeze peptide is a gene encoding the antifreeze peptide ICE.

[0010] In some embodiments of the present invention, the target gene and the gene encoding the antifreeze peptide are connected in series and codon optimized. For example, the sequences of the genes encoding FFLK-ICE, ELIY-ICE, and YPF-ICE after codon optimization are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively.

[0011] In some embodiments of the present invention, the gene encoding the soluble tag is codon optimized, for example, the sequence of the gene encoding SUMO after codon optimization is shown in SEQ ID NO: 4. FFLK, ELIY or YPF in the black bean protein hydrolyzed peptides have good primary and secondary oxidation product inhibition rates in different oils, but if they are directly expressed in Escherichia coli after codon optimization, protein electrophoresis results show that these peptides are not expressed. The use of soluble tags is helpful to express the aforementioned short peptides.

[0012] In some embodiments of the present invention, the expression vector is selected from at least one of pET-28a, pET-30a, pET-11b, and pET42a. In some preferred embodiments of the present invention, the expression vector is pET-28a.

[0013] In some embodiments of the present invention, the E. coli expression host is selected from any one of BL21 (DE3), BL21Star (DE3), ER2566, Rosseta-gami (DE3) and Rosetta2 (DE3). In some preferred embodiments of the present invention, the E. coli expression host is BL21 (DE3) or Rosetta2 (DE3). In some more preferred embodiments of the present invention, the E. coli expression host is BL21 (DE3).

[0014] The second aspect of the present invention provides the use of the engineered bacteria of the first aspect of the present invention in the preparation of antioxidant peptides FFLK, ELIY, and YPF.

[0015] The fourth aspect of the present invention provides a method for preparing antioxidant peptides, which comprises the following steps: inoculating the engineered bacteria of the first aspect of the present invention into a culture medium, culturing, obtaining a fermentation broth, inducing expression, and purifying to obtain a fusion antioxidant peptide.

[0016] In some embodiments of the present invention, the culture medium is selected from LB, TB, SOB, SOC, and 2XYT. The components of the TB liquid culture medium include 12 g / L peptone, 4 mL / L glycerol, 24 g / L yeast extract, 23.1 g / L potassium dihydrogen phosphate, and 125.4 g / L dipotassium hydrogen phosphate.

[0017] In some embodiments of the present invention, the induced expression comprises: adding IPTG to the fermentation broth and inducing culture at 16-37° C. for 2-12 hours.

[0018] In some embodiments of the present invention, the final concentration of IPTG is 0.2-1 mmol / L.

[0019] In some embodiments of the present invention, the method further comprises a purification step, which comprises: centrifugation and ice shell purification.

[0020] [Beneficial Effects]

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] Antifreeze peptides can be used as a new type of fusion tag, namely "ice tag", which can achieve specific binding with ice even in a large amount of water (ice is in solid form). Taking advantage of its binding property with ice crystals, antioxidant peptides can be purified simply and quickly through the ice-water cycle phase change purification method. Compared with the traditional protein purification method using chromatographic columns, it does not require specific equipment and is easy to scale up, providing new possibilities for the industrial production of antioxidant peptides.

[0023] The ice tag referred to in the present invention is an antifreeze peptide (KCCTKNCDSTAHCT1.51 kDa) consisting of only 14 amino acids, which will not significantly increase the size of the fusion protein, reduce interference with the function of the target protein, and can help improve the expression efficiency and solubility of the protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Different induction culture media. In the figure: M: protein molecular weight standard (10, 15, 25, 35, 45, 55, 70, 100, 130, 170 kDa); 1: BL21 (DE3) / LB whole culture; 2: BL21 (DE3) / TB whole culture; 3: BL21 (DE3) / SOB whole culture; 4: BL21 (DE3) / SOC whole culture; 5: BL21 (DE3) / 2XYT whole culture.

[0025] Figure 2 In the figure: M: protein molecular weight standard (10, 15, 25, 35, 45, 55, 70, 100, 130, 170 kDa); 1: BL21 (DE3) / IPTG = 0.2 mmol whole bacteria solution; 2: BL21 (DE3) / IPTG = 0.4 mmol whole bacteria solution; 3: BL21 (DE3) / IPTG = 0.6 mmol whole bacteria solution; 4: BL21 (DE3) / IPTG = 0.8 mmol whole bacteria solution; 5: BL21 (DE3) / IPTG = 1 mmol whole bacteria solution.

[0026] Figure 3 In the figure: M: protein molecular weight standard (10, 15, 25, 35, 45, 55, 70, 100, 130, 170 kDa); 1: BL21 (DE3) / 2h whole bacterial solution; 2: BL21 (DE3) / 4h whole bacterial solution; 3: BL21 (DE3) / 6h whole bacterial solution; 4: BL21 (DE3) / 8h whole bacterial solution; 5: BL21 (DE3) / 10h whole bacterial solution; 6: BL21 (DE3) / 12h whole bacterial solution.

[0027] Figure 4 In the figure: M: protein molecular weight standard (10, 15, 25, 35, 45, 55, 70, 100, 130, 170 kDa); 1: BL21 (DE3) / 37℃ whole bacteria solution; 2: BL21 (DE3) / 30℃ whole bacteria solution; 3: BL21 (DE3) / 25℃ whole bacteria solution; 4: BL21 (DE3) / 20℃ whole bacteria solution; 5: BL21 (DE3) / 16℃ whole bacteria solution.

[0028] Figure 5 The figure shows the SDS-PAGE analysis of the purified recombinant peptide. In the figure: M: small molecule protein molecular weight standard (10, 15, 25, 35, 45, 55, 70, 100, 130, 170 kDa); 1: SUMO-FFLK-ICE before ice affinity purification; 2: SUMO-FFLK-ICE after ice affinity purification; 3: SUMO-YPF-ICE before ice affinity purification; 4: SUMO-YPF-ICE after ice affinity purification; 5: SUMO-EILY-ICE before ice affinity purification; 6: SUMO-EILY-ICE after ice affinity purification.

[0029] Figure 6 is the DPPH and ABTS scavenging rate of recombinant antioxidant peptides. DETAILED DESCRIPTION

[0030] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention all belong to the scope of the present invention.

[0031] Unless otherwise specified, the experimental materials, reagents, and instruments used in the examples of the present invention are all commercially available. Unless otherwise specified, the technical means used in the examples are all conventional means well known to those skilled in the art.

[0032] Main test materials

[0033] (1) Plasmid

[0034] The construction method of the vector plasmid pET-28a(+)-SUMO is as follows: the codon-optimized SUMO gene (SEQ ID NO: 4) was synthesized by Nanjing GenScript Co., Ltd. and connected to the pre-provided empty vector pET-28a(+), and the recombinant vector was named pET-28a(+)-SUMO.

[0035] The sequences of the genes encoding FFLK-ICE, ELIY-ICE and YPF-ICE after codon optimization are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively. The above gene sequences were fully synthesized and cloned into pET-28a(+). The obtained recombinant vectors were named pET-28a(+)-YPF-ICE, pET-28a(+)-EILY-ICE and pET-28a(+)-FFLK-ICE.

[0036] (2) Bacterial strains

[0037] The competent cells of E.coli DH5α and E.coli BL21 (DE3) were purchased from Sangon Biotechnology (Shanghai) Co., Ltd. The method for constructing recombinant Escherichia coli is as follows: the recombinant vector is transferred into E.coli DH5α and E.coli BL21 (DE3) respectively by chemical transformation. The specific steps are as follows: Take out the competent cells from the -80℃ refrigerator, place them on ice immediately, and place them in an ice bath with the required recombinant vector for 10 minutes. After the competent cells melt, take 0.5μL of the recombinant vector and add it to 100μL of the competent cells. Gently blow and pipette to mix the two evenly, and then place them in an ice bath on ice for 30 minutes. Heat shock the competent cells in a 42℃ metal bath for 90s, then quickly take them out and place them in an ice bath on ice for 5 minutes. Add 700μL of LB liquid culture medium to the centrifuge tube and incubate at 37℃, 200rmin -1Resuscitate in a constant temperature incubator and remove after 60 minutes. Place the sample in a centrifuge and centrifuge at 8,000×g for 5 minutes. Discard most of the supernatant and mix the remaining liquid and precipitate with a pipette. Take 30-50 μL and spread it on a LB solid culture medium plate containing the corresponding resistance. Incubate it upside down in a constant temperature incubator at 37°C overnight. Pick a single colony in a test tube LB liquid culture medium and incubate it at 37°C, 200 r·min -1 Incubate with shaking overnight.

[0038] (3) Main reagents

[0039] Protein molecular weight standards were purchased from Thermo Fisher Scientific, USA; DNALadder was purchased from Fermentas, USA; peptone was purchased from OXOID, UK; yeast extract was purchased from OXOID, UK; Tris base was purchased from Amresco, USA; glycine was purchased from Amresco, USA; agarose was purchased from Biowest, France; and sodium dodecyl sulfate (SDS) was purchased from Amresco, USA.

[0040] (4) Culture medium configuration

[0041] LB liquid medium: 5 g / L yeast extract, 10 g / L NaCl, 10 g / L tryptone.

[0042] LB solid medium: Add 1.5% agar powder to LB liquid medium.

[0043] TB liquid medium: 16.4 g / L KH2PO4, 2.3 g / L K2HPO4, 4 g / L glycerol, 24 g / L yeast extract, 12 g / L tryptone, pH 7.0.

[0044] SOB liquid medium: 2.5mmol / L KCl, 10mmol / L MgCl2, 5g / L yeast extract, 0.5g / LNaCl, 20g / L tryptone, pH 7.0.

[0045] SOC liquid medium: 2.5mmol / L KCl, 10mmol / L MgCl2, 20mmol / L glucose, 5g / L yeast extract, 0.5g / L NaCl, 20g / L tryptone, pH 7.0.

[0046] 2×YT medium: 10 g / L yeast extract, 16 g / L tryptone, 5 g / L NaCl.

[0047] The culture media prepared above were sterilized (15 min, 121° C.), dried in a 50° C. oven, and set aside for use.

[0048] Example 1 Construction of recombinant strains

[0049] Construction of recombinant strain A

[0050] Total gene synthesis: FFLK-ICE (SEQ ID NO: 1), ELIY-ICE (SEQ ID NO: 2), YPF-ICE (SEQ ID NO: 3), SUMO (SEQ ID NO: 4): FFLK is tandem 30 times, EILY is tandem 20 times, and YPF is tandem 10 times.

[0051] SEQ ID NO: 1:

[0052] ttttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttc

[0053] tgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaa

[0054] ttttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttctgaaattttttc

[0055] tgaaattttttctgaaaGGTGGTGGTAAATGCTGTACCAAAAATTGTGATAGCACCGCACATTGCAC

[0056] CTAA

[0057] SEQ ID NO:2:

[0058] gaaattctgtatagaaattctgtatagaaattctgtatagaaattctgtatagaaattctgtatagaaattctgtatagaaattctgtatagaaattctgtatagaaattctgtatagaaattctgtatagaaattct

[0059] gtgaaattctgtatgaaattctgtatgaaattctgtatgaaattctgtatgaaattctgtatgaaattctgtatgaaattctgtatgaaattctgtatgaaattctgtatgaa

[0060] attctgtatgaaattctgtatgaaattctgtatGGTGGTGGTAAATGCTGTACCAAAAATTGTGATAGCACCGC

[0061] ACATTGCACCTAA

[0062] SEQ ID NO:3:

[0063] aaacggatagaacggatagaacgggtaaaacgggtaaaacggatagaacgggtagaatggataaaaaggatagaagggataaaatgggta

[0064] GGTGGTGGTAAATGCTGTACCAAAAATTGTGATAGCACCGCACATTGCACCTAA

[0065] SEQ ID NO:4:

[0066] ATGTCAGATAGTGAAGTAAATCAAGAGGCTAAGCCGGAGGTTAAGCCGGAGGTCAAGCCGGAAACCCATATTAACTTGAAGGTGAGCGACGGCTCCTCTGAAATTTTCTTCAAAATCAAAAGACCACGCCATTGCGCCGTCTGATG GAAGCGTTTGCGAAACGTCAGGGTAAAGAAATGGATAGCCTGCGTTTTCTGTACGACGGTATTCGTATTCAGGCAGATCAAACCCCGGAGGACCTGGATATGGAGGATAATGACATCATCGAGGCTCACCGCGAACAAATCGGCGGT

[0067] The synthesized pET-28a(+)-YPF-ICE, pET-28a(+)-EILY-ICE, and pET-28a(+)-FFLK-ICE gene sequences were used as templates, and the AOP-F\R primers (primer sequences are shown in Table 1) were used to amplify (amplification system is shown in Table 2) the gene fragments YPF-ICE, EILY-ICE, and YPF-ICE, respectively. At the same time, the pET-28a plasmid preserved in the laboratory was used as a template, and the amplified gene fragments YPF-ICE, EILY-ICE, and YPF-ICE and the expression vector pET-28a(+)-SUMO were double-digested with restriction endonucleases, and the fragments recovered from the two were connected by T4 DNA ligase to complete the construction of the recombinant vector. The successfully recombined pET-28a(+)-S-FFLK-ICE, pET-28a(+)-S-EILY-ICE, and pET-28a(+)-S-YPF-ICE recombinant vectors were entrusted to Shanghai Sangon Biotechnology for sequencing.

[0068] Table 1 Primer sequences

[0069]

[0070] Table 2 Target gene PCR amplification system

[0071]

[0072] The successfully sequenced pET-28a(+)-S-FFLK-ICE, pET-28a(+)-S-EILY-ICE, and pET-28a(+)-S-YPF-ICE recombinant vectors were respectively transformed into BL21(DE3) competent cells, and the positive clones were screened by kanamycin to obtain the recombinant strains BL21(DE3) / pET-28a(+)-S-FFLK-ICE, BL21(DE3) / pET-28a(+)-S-EILY-ICE, and BL21(DE3) / pET-28a(+)-S-YPF-ICE.

[0073] B. Fermentation method and conditions:

[0074] (1) Cultivation and obtaining fermentation broth: Pick a single colony of the above recombinant strain and culture it in LB liquid medium overnight, then transfer it to 50 mL LB liquid medium at a 1% inoculum and continue culturing at 37° C. and 200 rpm;

[0075] (2) Inducing expression: When the OD600 value of the bacteria was about 0.6, 0.4 mM IPTG was added, and then the cells were induced at 30°C and 180 rpm for 6 h.

[0076] (3) Analysis: The bacterial precipitate was then collected by centrifugation at 8000 rpm for 5 min, and the bacterial cells were washed twice with PBS buffer (pH = 7.4). Then, 10 mL of PBS buffer was added to the whole bacterial solution, and SDS-PAGE was performed to analyze the expression of the antioxidant peptide fusion protein.

[0077] The results are as follows Figure 2 As shown, lane 2 of SUMO-FFLK\YPF\EILY-ICE all showed bands with the same size as the target protein (33.01 kDa\20.81 kDa\27.31 kDa), indicating that all three fusion proteins achieved heterologous expression.

[0078] Example 2 Optimization of the recombinant strain for highly efficient expression of antioxidant peptide fusion protein at the shake flask fermentation level

[0079] For the recombinant strains BL21(DE3) / pET-28a(+)-S-FFLK-ICE, BL21(DE3) / pET-28a(+)-S-EILY-ICE, and BL21(DE3) / pET-28a(+)-S-YPF-ICE obtained in Example 1, the fermentation parameters were optimized at the shake flask level. Based on step (1) of Example 1, the following optimization was performed:

[0080] Optimization of A medium

[0081] While keeping other conditions unchanged, the fermentation medium (LB liquid medium) in step (1) of the fermentation method and conditions of Example 1B was replaced with TB, SOB, SOC, and 2XY liquid medium, respectively.

[0082] Optimization of B inducer concentration

[0083] While keeping other conditions unchanged, the IPTG concentration in step (2) of the fermentation method and conditions of Example 1B was changed to 0.2, 0.4 mM, 0.6 mM, 0.8 mM, and 1 mM, respectively.

[0084] Optimization of C induction time

[0085] While keeping other conditions unchanged, the induction culture time of step (2) in the fermentation method and conditions of Example 1B was changed to 2, 4, 6, 8, 10, and 12 h, respectively.

[0086] Optimization of D induction temperature

[0087] While keeping other conditions unchanged, the induction culture temperature in step (2) of the fermentation method and conditions of Example 1B was changed to 37°C, 30°C, 25°C, 20°C, and 16°C, respectively.

[0088] The results are as follows Figure 1-4As shown, the band (5) of 2XY liquid medium is thicker, indicating that the protein expression level is higher. Since 2XY liquid medium is more nutritious, 2XY liquid medium is preferred.

[0089] The inducer concentration had little effect on protein expression, and the band in lane 1 of SUMO-FFLK\EILY-ICE was relatively thick, so 0.2 mM was the preferred concentration overall.

[0090] The expression level of the protein increased first and then stabilized with the increase of culture time. SUMO-FFLK\YPF-ICE reached the plateau at 6 hours, and SUMO-EILY-ICE reached the plateau at 8 hours.

[0091] Under the same culture conditions, the protein expression level showed a trend of first increasing and then decreasing as the temperature decreased. 30°C was preferred because 37°C promoted bacterial growth but was not conducive to protein accumulation, while too low a temperature would lead to a decrease in overall activity.

[0092] Example 3 Ice Shell Purification and Characterization of Recombinant Peptides

[0093] (1) Ice shell preparation:

[0094] Preparation of -40℃ freezing solution: Mix 100g CaCl2·6H2O, 20ml deionized water, and 50g ice.

[0095] Refrigeration liquid (-1.0~-1.5℃): Mix 20g CaCl2·6H2O, 30ml deionized water and 68g ice.

[0096] Pour -40℃ freezing liquid into the foam box and monitor the temperature in real time with a precision digital thermometer. Measure 100ml of pre-cooled deionized water and pour it into a 500ml round-bottom flask, immerse the round-bottom flask in the -40℃ freezing liquid, and rotate it quickly for 1min to form an ice shell on part of the deionized water in the round-bottom flask. Continue to rotate it in the -40℃ freezing liquid for 2min until evenly distributed cracks appear on the ice shell.

[0097] (2) Ice affinity purification:

[0098] ① Preparation of cell disruption supernatant: After induction culture in 500 ml 2xYT liquid at 30°C and 0.2 mM IPTG for 6 hours, collect bacterial precipitate under centrifugation at 8000 rpm for 5 minutes, add PBS buffer (pH = 7.4) to wash the bacteria twice, and then add 5 mL PBS buffer. Under ice bath conditions, ultrasonically disrupt the bacteria at 500W for 10 minutes (ultrasonication for 3 seconds, stop for 3 seconds). Then, collect the supernatant of the disrupted bacterial solution under centrifugation at 10000 rpm for 10 minutes, which is the cell disruption supernatant.

[0099] ② Dilute the cell disruption supernatant to 1 mg / ml and pre-cool it with an ice-water mixture. Then slowly drip the cell disruption supernatant onto the surface of the ice shell in the round-bottom flask, during which the round-bottom flask is immersed in the refrigerant. Connect the round-bottom flask with a rotary evaporator and control it to rotate slowly. After adsorption for 30 minutes, pour out the unadsorbed sample solution, wash the ice surface with PBS, melt the ice shell and absorb the purified supernatant sample for SDS-PEGE detection.

[0100] The results are as follows Figure 5 As shown, the impurity protein bands in lanes (2, 4, and 6) after purification were significantly reduced, and the proportion of target protein increased significantly, indicating that the target fusion protein was successfully purified using the ice tag.

[0101] (3) Antioxidant characterization of recombinant peptides

[0102] ① Enzymatic hydrolysis of recombinant antioxidant peptides

[0103] Enzymes: Trypsin can cleave the carboxyl end of K in the FFLKFFLK~ fusion protein; chymotrypsin can cleave the carboxyl end of F in the YPFYPFYPF~ fusion protein; and the carboxyl end of Y in the EILYEILYEILYEILY~ fusion protein. The chymotrypsin cleavage site is the carboxyl end of Y and F, but it will not cleave the position where the carboxyl end is P, so in YPFYPFYPF, only the carboxyl end of F will be cleaved, and the carboxyl end of Y will not be cleaved.

[0104] Take a certain amount of purified supernatant and prepare a 5 mg / mL protein solution with ultrapurified water, wherein one volume of 10× chymotrypsin digestion buffer was added to the EILY and YPF protein solutions; one volume of 10× trypsin digestion buffer was added to the FFLK protein solution, and after mixing evenly, chymotrypsin was added to the EILY and YPF protein solutions, and trypsin powder was added to the FFLK protein solution to make the enzyme concentration 1 mg / mL, and the solution was incubated at 37°C for 4 hours. After the reaction, the enzyme was inactivated. After cooling to room temperature, ultrafiltration was performed using an ultrafiltration tube (molecular weight cutoff 3kDa), and the enzymatic hydrolyzate with a molecular weight less than 3kDa was collected, which was the antioxidant peptide solution for antioxidant experiments.

[0105] ②DDPH scavenging experiment of recombinant peptide

[0106] 50 μL of each antioxidant peptide solution (1 mg / ml in 95% ethanol) was dispensed into the wells of a 96-well plate. Then, 50 μL of DPPH ethanol solution (0.1 mM) was added to each well and incubated in the dark for 30 minutes. The absorbance at 517 nm was measured using a SpectraMax190 microplate reader. Ethanol was used as a blank control. The scavenging activity was determined by the following formula:

[0107]

[0108] ③ABTS clearance experiment of recombinant peptide

[0109] The ABTS standard solution was diluted to an absorbance of about 0.8 at 734 nm to prepare a working solution. 20 μL of a 1 mg / mL concentration of an antioxidant peptide solution (in 95% ethanol) was mixed with 180 μL of the ABTS working solution, then incubated at 25°C for 6 minutes and the absorbance was measured at 734 nm, with deionized water as a blank control. The scavenging activity was determined by the following formula:

[0110]

[0111] The results are as follows Figure 6 As shown, the DPPH clearance rates of FFLK, YPF and EILY were 21.02±2.31%, 23±2.42% and 12±1.62% respectively; the ABTS clearance rates were 94±0.13%, 93±0.08% and 91±0.11% respectively, all showing strong antioxidant activity.

[0112] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An engineered bacterium expressing an antioxidant peptide, characterized in that: The engineered bacteria comprises a recombinant plasmid and an Escherichia coli expression host; the recombinant plasmid comprises a target gene, a gene encoding a lytic tag, a gene encoding an antifreeze peptide, and an expression vector; the target gene is obtained by tandemly connecting a certain number of genes encoding FFLK, ELIY or YPF and then optimizing the codons; the gene encoding the lytic tag is a gene encoding SUMO; and the gene encoding the antifreeze peptide is a gene encoding the antifreeze peptide ICE.

2. The engineered bacteria expressing antioxidant peptides according to claim 1, characterized in that: The target gene and the gene encoding the antifreeze peptide are connected in series.

3. The engineered bacteria expressing antioxidant peptides according to claim 2, characterized in that: The target gene and the gene encoding the antifreeze peptide are connected in series, and the sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively.

4. The engineered bacteria expressing antioxidant peptides according to claim 1, characterized in that: The expression vector is selected from at least one of pET-28a, pET-30a, pET-11b, and pET42a.

5. The engineered bacteria expressing antioxidant peptides according to claim 1, characterized in that: The E. coli expression host is selected from any one of BL21 (DE3), BL21Star (DE3), ER2566, Rosseta-gami (DE3) and Rosetta2 (DE3).

6. Use of the engineered bacteria expressing the antioxidant peptide according to any one of claims 1 to 5 in the preparation of the antioxidant peptides FFLK, ELIY or YPF.

7. A method for preparing an antioxidant peptide using the engineered bacteria expressing an antioxidant peptide according to any one of claims 1 to 5, characterized in that: The method comprises the following steps: inoculating the engineered bacteria into a culture medium, culturing, inducing expression, and purifying to obtain the fusion antioxidant peptide.

8. The method according to claim 7, characterized in that The culture medium is selected from LB, TB, SOB, SOC, and 2XYT.

9. The method according to claim 7, characterized in that: The inducing expression comprises: adding IPTG to the fermentation liquid, and inducing culture at 16-37° C. for 2-12 hours.

10. The method according to claim 7, characterized in that It also includes purification steps: centrifugation and ice shell purification.

Images