An engineered near-infrared light-responsive exosome and its preparation method and application

Abstract

The present invention discloses an engineered near-infrared light-responsive exosome, a preparation method and application thereof, and relates to the field of biomedicine technology. The preparation method of the engineered near-infrared light-responsive exosome comprises the following steps: transfecting a recombinant plasmid containing a CXCL9 encoding gene into tumor cells to obtain cells expressing CXCL9; after the cells expressing CXCL9 are irradiated with ultraviolet light, they are co-incubated with a photosensitizer to obtain a cell culture supernatant; the cell culture supernatant is separated and treated to obtain the engineered near-infrared light-responsive exosome. Under near-infrared (NIR) light irradiation, the exosome can produce a photothermal effect, directly killing tumor cells, and can selectively release CXCL9 in tumor tissue. This selectively released CXCL9 can effectively attract T cells to the tumor, reshape the immune microenvironment, and enhance immune-mediated cancer cell destruction.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an engineered near-infrared light-responsive exosome and a preparation method and application thereof. Background Art

[0002] Immunotherapy, which activates the body's immune system to recognize and eliminate cancer cells, has shown significant potential in a variety of malignancies. However, the variable response of patients to immunotherapeutic interventions emphasizes the need for continued research to optimize treatment efficacy. A key factor in the success of immunotherapy is the extent of T cell infiltration into the tumor microenvironment, which is generally associated with improved patient outcomes. The migration of T cells to tumor sites is primarily guided by gradients of CXC chemokine receptor 3 (CXCR3) and its ligands, CXC chemokines (CXCL9, CXCL10, and CXCL11).

[0003] Recent studies have highlighted the critical role of CXCL9 in T cell recruitment, particularly in enhancing the effectiveness of immunotherapy. Studies have shown that elevated CXCL9 levels are associated with increased T cell infiltration and better clinical outcomes in melanoma patients. Similarly, one study has demonstrated that CXCL9 not only attracts T cells but also modulates their function, further promoting anti-tumor immunity. Although CXCL10 and CXCL11 also play a role in this process, CXCL9's dominant role in promoting T cell migration makes it a key target for enhancing the efficacy of T cell-based immunotherapies. However, many tumors employ various mechanisms to downregulate CXCL9 expression, thereby hindering T cell recruitment and compromising the overall effectiveness of these therapies. To address this limitation, several approaches have been explored, including direct intratumoral injection of recombinant CXCL proteins or viral vectors encoding CXCL9. While these strategies attempt to establish a chemokine gradient between the tumor and peripheral tissues, their effectiveness has been limited. The short lifespan of recombinant proteins often leads to insufficient T cell recruitment, while viral vectors can result in nonspecific chemokine expression, raising concerns about off-target effects and overall safety. Therefore, there is an urgent need to develop new strategies that can robustly and specifically enhance chemokine expression in the tumor microenvironment to promote more effective T cell recruitment and activation. Summary of the Invention

[0004] The present invention aims to provide engineered near-infrared light-responsive exosomes, their preparation method, and applications, to address the aforementioned problems in the prior art. Under near-infrared (NIR) light irradiation, the exosomes can produce a photothermal effect, directly killing tumor cells while selectively releasing CXCL9 into tumor tissue. This selectively released CXCL9 can effectively attract T cells to the tumor, reshape the immune microenvironment, and enhance immune-mediated cancer cell destruction.

[0005] In recent years, significant progress has been made in the development of cell membrane-based nanocarriers, such as exosomes and microparticles. Furthermore, these nanocarriers have the unique ability to inherit the functional properties of their parent cells, making them highly effective tools for targeted drug delivery in chemotherapy and immunotherapy applications. Simultaneously, gene delivery systems, such as plasmids and viral vectors, have been widely used to engineer cells to express therapeutic proteins, demonstrating their utility in gene therapy. By integrating these advances, engineered cell exosomes represent a promising platform for the targeted delivery of therapeutic agents, particularly in the context of cancer immunotherapy.

[0006] Based on these technological advances, the present invention proposes an innovative therapeutic strategy involving genetically engineering tumor cells to overexpress CXCL9. This approach enables the creation of immunomodulatory tumor-derived exosomes loaded with the chemokine CXCL9 and the photosensitizer cypate. These exosomes are designed to home to tumor tissue, and under near-infrared (NIR) light irradiation, cypate induces a localized photothermal effect that not only directly ablates tumor cells but also triggers the controlled release of CXCL9 in the tumor microenvironment. The selectively released CXCL9 can effectively establish a chemokine gradient, enhance the recruitment of T cells to the tumor site, and thus benefit the anti-tumor immune response.

[0007] Based on this, the present invention provides the following solutions:

[0008] The present invention provides a method for preparing engineered near-infrared light-responsive exosomes, comprising the following steps:

[0009] The recombinant plasmid containing the CXCL9 encoding gene was transfected into tumor cells to obtain cells expressing CXCL9;

[0010] The CXCL9-expressing cells are irradiated with ultraviolet light and then incubated with a photosensitizer to obtain a cell culture supernatant;

[0011] The cell culture supernatant is separated and treated to obtain the engineered near-infrared light-responsive exosomes.

[0012] Furthermore, the nucleotide sequence of the CXCL9 encoding gene is shown in SEQ ID NO.1.

[0013] Furthermore, the tumor cells are liver cancer cells.

[0014] Furthermore, the ultraviolet irradiation time is 1 hour.

[0015] Furthermore, the photosensitizer is cypate.

[0016] Furthermore, the separation process adopts differential centrifugation.

[0017] The present invention also provides an engineered near-infrared light-responsive exosome prepared according to the above preparation method.

[0018] The present invention also provides the use of the above-mentioned engineered near-infrared light-responsive exosomes in the preparation of drugs for treating liver cancer.

[0019] The present invention also provides a drug for treating liver cancer, the active ingredient of which includes the above-mentioned engineered near-infrared light-responsive exosomes.

[0020] Furthermore, the medicine also includes pharmaceutically acceptable excipients.

[0021] The present invention discloses the following technical effects:

[0022] The present invention develops an innovative exosome (cypate@EXO-CXCL9) by engineering the expression of the chemokine CXCL9 and combining it with the photosensitizer cypate, which is specifically used to target tumor tissue. Under near-infrared (NIR) light irradiation, cypate produces a photothermal effect, directly killing tumor cells while selectively releasing CXCL9 in tumor tissue. This selectively released CXCL9 can effectively attract T cells to tumors, reshape the immune microenvironment, and enhance immune-mediated cancer cell destruction. By promoting more T cells to infiltrate into tumors, the accuracy of immune regulation is improved. This method not only enhances the activity of T cells, but also significantly improves their efficiency and accuracy in penetrating tumors, thereby more effectively clearing tumors and solving the key obstacle of insufficient T cell recruitment in cancer treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 Figure 1 is a diagram showing the results of preparing exosomes; A is a schematic diagram showing the construction of a recombinant plasmid containing the CXCL9 sequence; B is a diagram showing the detection of CXCL9 expression levels in tumor cell exosomes; C is a statistical diagram showing the expression levels of CXCL9 in tumor cell exosomes; D is a schematic diagram showing the preparation of tumor cell exosomes (cypate@EXO-CXCL9); E is a transmission electron microscopy image of tumor cell exosome lysis under photothermal conditions; FG are detection images showing changes in tumor cell exosome particles before and after photothermal irradiation; and H is a schematic diagram showing changes in tumor cell exosome particles before and after photothermal irradiation.

[0025] Figure 2 Figures 1 and 2 are the results of in vitro T cell recruitment and immune activation experiments; A is a schematic diagram of transwell migration induced by cypate@EXO-CXCL9; B is a confocal laser scanning microscopy (CLSM) image of different material groups; C is a quantitative analysis of recruited T cells; D is a statistical graph of IFN-γ secretion by T cells in different material groups; E is a statistical graph of cell activity after different treatments; F is a detection graph of IFN-γ levels in tumor supernatants after treatment with different material groups; G is a detection result graph of DC cell proportions after treatment with different material groups; H is a detection result graph of M1 macrophage proportions after treatment with different material groups; I is a detection result graph of M2 macrophage proportions after treatment with different material groups; in FI, I represents PBS, II represents EXO, III represents EXO-CXCL9, IV represents cypate@EXO, and V represents cypate@EXO-CXCL9;

[0026] Figure 3 Figure 1 shows the results of anti-tumor efficacy testing; A is a schematic diagram of the treatment timeline in a Hep 1-6 tumor-bearing mouse model; B is a tumor image extracted after different treatments; C is a graph showing the changes in tumor volume during treatment; D is a statistical graph showing the average weight of mice after different treatments; E is a statistical graph showing the average weight of tumors after different treatments; F is a statistical graph showing the survival rate of mice after different treatments; G is a histological analysis of tumors after different treatments; H is a TUNEL staining image of tumor tissue samples after different treatments; I is a histological analysis of major organs after different treatments;

[0027] Figure 4 Results of in vivo immune activation experiments; A is the immunofluorescence analysis of T cells, M1 macrophages, and M2 macrophages infiltrating in Hep 1-6 tumor-bearing mice after different treatments; B is the T cell activation status (CD4 + / CD8 + ) flow cytometry analysis diagram; C is the DC cells (CD80 + / CD86 + ) is a flow cytometric analysis diagram; D is a flow cytometric analysis diagram of IFN-γ secretion in tumor tissue after different treatments; E is a flow cytometric analysis diagram of M1 cells (F4 / 80 + / CD86 + ) flow cytometry analysis diagram; F is the M2 cells (F4 / 80 + / CD206 +) is a flow cytometry analysis graph; G is a statistical graph of the relative levels of TNF-α in the supernatant of tumor tissue after different treatments; H is a statistical graph of the relative levels of IFN-γ in the supernatant of tumor tissue after different treatments. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] Example 1

[0034] 1. Materials and Methods

[0035] 1.1 Materials

[0036] Interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) enzyme-linked immunosorbent assay (ELISA) kits were purchased from Lianke Biotechnology.

[0037] PE-labeled anti-mouse CD11b (Biolegend, product number 101208, dilution ratio 1:1000); FITC-labeled anti-mouse F4 / 80 (Biolegend, product number 123108, dilution ratio 1:1000); APC-labeled anti-mouse CD206 (Biolegend, product number 141708, dilution ratio 1:1000); APC-labeled anti-mouse CD45 (Biolegend, product number 147710, dilution ratio 1:1000); P E-labeled anti-mouse CD3 (Biolegend, product number 100206, dilution ratio 1:1000); FITC-labeled anti-mouse CD8 (Biolegend, product number 100706, dilution ratio 1:1000); APC-labeled anti-mouse CD11c (Biolegend, product number 117310, dilution ratio 1:1000); PE-labeled anti-mouse CD80 (Biolegend, product number 104708, dilution ratio 1:1000); Pacific Blue-labeled anti-mouse CD86 (Biolegend, product number 105022, dilution ratio 1:1000).

[0038] 1.2 Animals and Ethics Statement

[0039] Animal and Ethics Statement: Balb / c mice (female, 18 ± 2 g, 6–8 weeks old) were purchased from Shanghai Slake Animal Technology Co., Ltd. (Shanghai, China). Mice were housed in an animal facility under constant environmental conditions (room temperature 21 ± 1°C; relative humidity 40–70%; 12-h light / dark cycle). All mice had access to food and water. All animal experiments were performed according to protocols approved by Guizhou Medical University (Approval No. 2400625).

[0040] 1.3 Plasmid construction

[0041] Specific primers were designed to amplify the transmembrane sequence (TM) and cDNA sequence of the chemokine CXCL9. Using the CCDS database, a 381-bp sequence of CXCL9 was obtained (reference number CCDS39152.1). These two key nucleic acid sequences were amplified separately by polymerase chain reaction (PCR) and inserted into the pcDNA3.1-FLAG-EGFP vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) using the Nco I and Sal I restriction sites to construct a recombinant plasmid containing the CXCL9 sequence.

[0042] 1.4 Preparation of exosomes

[0043] A recombinant plasmid containing the CXCL9 sequence was transfected into tumor cells (Hep 1-6) using Lipofectamine 2000 (or other designated transfection reagents). Twenty-four hours after transfection, the transfected cells were exposed to ultraviolet (UV) light for one hour and then incubated with the photosensitizer cypate (CAS No. 95837-47-1) for 12 hours in high-glucose DMEM (10% FBS) containing cypate at a concentration of 10 mg / mL. The cell culture supernatant was collected and centrifuged at low speed (400 g for 10 minutes) to remove cells and debris. Subsequently, the supernatant was centrifuged at higher speeds (2000 g for 15 minutes, followed by 10,000 g for 30 minutes) to remove cellular debris. The cypate-containing exosomes (cypate@EXO-CXCL9) were isolated from the cell culture supernatant by ultracentrifugation (100,000 g for 2 hours).

[0044] A similar method was used to prepare other types of exosomes, including blank exosomes (EXO), exosomes containing only CXCL9 (EXO-CXCL9), and exosomes containing only cypate (cypate@EXO).

[0045] 1.5 T cell isolation and recruitment

[0046] C57BL / 6 mice were euthanized by cervical dislocation and then disinfected in alcohol for 15 minutes. The spleen was then removed, minced, and homogenized to obtain a single-cell suspension. After filtering through a 70 μm cell strainer, the cells were centrifuged at 1500 rpm for 3 minutes to obtain a spleen cell pellet. Red blood cell lysis buffer was added to lyse the red blood cells, and the lysis process was then terminated with culture medium. T cells were purified from the spleen cell population using magnetic bead separation to obtain CD3 +T cells. T cells were cultured in RPMI 1640 medium containing 10 wt% fetal bovine serum (FBS), 1 mM sodium pyruvate, 10 mM HEPES buffer, 55 μM β-mercaptoethanol, and 10 ng / mL mouse recombinant interleukin-2 (IL-2). IL-2 was obtained from Peprotech. Before the experiment, cells were stimulated with soluble anti-mouse CD3 (monoclonal antibody clone 145-2C11) and anti-mouse CD28 (monoclonal antibody clone 37.51) antibodies, both purchased from BioLegend, according to the manufacturer's protocol. Preactivated T cells were placed in the upper chamber of a transwell plate, while the lower chamber contained different material groups, including PBS, EXO, EXO-CXCL9, and cypate@EXO-CXCL9. After incubation, cells on the underside of the transwell membrane were fixed with 4% paraformaldehyde (PFA) and stained. T cells migrating across the underside of the membrane were observed and quantified using fluorescence microscopy.

[0047] 1.6 MTT assay

[0048] Preactivated T cells were placed in the upper chamber of a transwell plate, while the lower chamber was pre-seeded with bone marrow-derived tumor cells and macrophages. The cells were then treated with different material groups, including PBS, EXO, cypate@EXO, EXO-CXCL9, cypate@EXO-CXCL9, PBS+NIR, EXO+NIR, cypate@EXO+NIR, EXO-CXCL9+NIR, and cypate@EXO-CXCL9+NIR. After a 24-hour incubation, cell viability was assessed using an MTT assay.

[0049] 1.7 Immunofluorescence analysis

[0050] Tumor specimens obtained from mice were sectioned and fixed with 4% formaldehyde for 15 minutes. After permeabilization with 0.5% Triton X-100 in PBS for 10 minutes, nonspecific binding sites were blocked with 5% bovine serum albumin in PBS. The sections were then incubated with the primary antibody (CST, dilution 1:500) overnight at 4°C, followed by incubation with a fluorescent secondary antibody (1:300) for 2 hours at room temperature. Cell nuclei were stained with Hoechst for 15 minutes, and samples were visualized using a laser confocal microscope (AIR HD25).

[0051] 1.8 Flow cytometry analysis

[0052] Preactivated T cells were added to the upper chamber of a transwell plate, and the lower chamber was seeded with mouse hepatoma cells (Hep 1-6). Different material groups were added for treatment, followed by a 24-hour incubation. Flow cytometry was used to measure the concentration of IFN-γ secreted by the T cells. The procedure involved resuspending the supernatant in FACS buffer, filtering through a membrane, and adding 100 μL to a 2 mL Eppendorf tube. After incubation with the antibody for 1 hour and vortexing, the sample was centrifuged at 2200 rpm for 3 minutes, the supernatant was removed, and 500 μL of FACS buffer was added for analysis.

[0053] 1.9 Anti-tumor and safety evaluation of exosomes

[0054] The anti-tumor effect of exosomes was further verified in the Hep 1-6 loaded Balb / c mouse model. Hep 1-6 cells were injected into the right hind leg of the mice. When the tumor volume reached about 100 mm 3 The mice were divided into four groups and treated with different nanomedicines injected through the tail vein. 12 hours after injection, the mice received laser and non-laser treatment. The treatment cycle lasted for 21 days, with injections every three days at a dose of 1 mg / kg each time, for a total of five injections. At the end of the 20-day treatment, the mice were euthanized, and the tumor tissues were collected, fixed with 4% formaldehyde and embedded in paraffin. 4 mm thick sections were mounted on glass slides and stained with hematoxylin and eosin (H&E), and immunofluorescence staining was used to assess the expression levels of T cells, macrophages and other immune cells infiltrating the tumor. TUNEL experiments were performed according to the manufacturer's instructions, using the One Step TUNEL apoptosis detection kit (Roche), and cell nuclei were contrast stained with DAPI. Tumor tissue and mouse spleen cells were homogenized or digested in staining buffer to prepare single cell suspensions, and various antibodies were used to detect immune cells, including dendritic cells (DC cells), macrophages, and T cells. Staining was performed using FITC-conjugated DC antibody (anti-mouse CD11c, BioLegend, 117306, dilution ratio 1:200), PE-conjugated CD80 antibody (Bio-Legend, 104708, dilution ratio 1:200), and APC-conjugated CD86 antibody (BioLegend, 105012, dilution ratio 1:200).

[0055] 2. Results

[0056] 2.1 Preparation of exosomes

[0057] Hepatocellular carcinoma remains one of the most common malignancies worldwide, posing a significant therapeutic challenge due to its high metastatic potential and frequent resistance to conventional therapies. Although conventional treatment strategies have made limited progress, immunotherapy has emerged as a promising alternative. A key factor in regulating tumor growth and metastasis is the infiltration of T cells into the tumor microenvironment. To enhance T cell recruitment and improve the efficacy of immunotherapy, the present invention has developed a novel method using engineered tumor cell-derived exosomes for near-infrared (NIR) light-triggered local release of CXCL9. This innovative strategy aims to effectively recruit and activate T cells, thereby enhancing anti-tumor immune responses.

[0058] To generate exosomes specifically loaded with CXCL9, the present invention employed molecular cloning techniques. The CXCL9 coding gene sequence (SEQ ID NO. 1) was obtained from the consensus CDS (CCDS) database (www.ncbi.nlm.nih.gov / CCDS / ), which is 381 bp in length (reference CCDS39152.1). The CXCL9 coding gene sequence was cloned into the Nco I and Sal I restriction sites of the pcDNA3.1-FLAG-EGFP vector to generate a recombinant plasmid expressing CXCL9 ( Figure 1 (A) The recombinant plasmid also contains an enhanced green fluorescent protein (EGFP) gene for tracking protein expression. After transfection of the plasmid into tumor cells, significant green fluorescence was observed under a fluorescence microscope, confirming the successful construction of the recombinant plasmid and expression of the CXCL9 protein.

[0059] SEQ ID NO.1:

[0060] ATGAAGTCCGCTGTTCTTTTCCTCTTGGGCATCTTCCTGGAGCAGTGTGGAGTTCGAGGAACCCTAGTGATAAGGAATGCACGATGCTCCTGCATCAGCACCAGCCGAGGCACGATCCACTACAAATCCCTCAAAGACCTCAAACAGTTTGCCCCAAGCCCCAATTGCAACAAAACTGAAATCATTGC TACACTGAAGAACGGAGATCAAACCTGCCTAGATCCGGACTCGGCAAATGTGAAGAAGCTGATGAAAGAATGGGAAAAGAAGATCAGCCAAAAGAAAAAGCAAAAGAGGGGGAAAAAACATCAAAAGAACATGAAAAACAGAAAACCCAAAACACCCCAAAGTCGTCGTCGTTCAAGGAAGACTACATAA.

[0061] Exosomes were isolated from transfected cells by ultraviolet (UV) stimulation and high-speed centrifugation. Enzyme-linked immunosorbent assay (ELISA) analysis showed that the CXCL9 level in exosomes from the EXO-CXCL9 and cypate@EXO-CXCL9 groups was significantly increased (0.4 ng / mL) compared with the PBS and control groups, indicating that the present invention successfully integrated CXCL9 into exosomes ( Figure 1 Middle C).

[0062] To further evaluate the effects of photothermal conditions on cypate@EXO-CXCL9 exosomes, we used transmission electron microscopy (TEM) to examine morphological changes. Under NIR light irradiation, cypate@EXO-CXCL9 exosomes showed fragmentation into smaller cell fragments ( Figure 1 Dynamic light scattering (DLS) analysis confirmed these findings, showing a significant reduction in particle size after NIR exposure ( Figure 1 F, G, and H). Overall, these results demonstrate the successful development of NIR-responsive tumor cell-derived exosomes capable of targeted release of CXCL9, providing a novel and promising approach to enhance the effectiveness of immunotherapy for hepatocellular carcinoma.

[0063] 2.2 In vitro T cell recruitment and cytotoxic effects

[0064] The present invention uses a transwell migration assay to study the recruitment of CD8 by different materials. + In this experimental setting, CD8 + T cells were placed in the upper chamber, while mouse liver cancer cells (Hep 1-6) were cultured in the lower chamber. Various treatment groups, including PBS, EXO, EXO-CXCL9, cypate@EXO, and cypate@EXO-CXCL9, were introduced into the lower chamber. Near-infrared (NIR) irradiation and non-NIR conditions were applied to each group for comparative analysis. + T cells were fluorescently labeled with DiI (green) to track their chemotactic migration. In the PBS group, the green fluorescence signal of the labeled T cells was observed to change little within 120 minutes, indicating poor T cell recruitment. In contrast, in the cypate@EXO-CXCL9+NIR group, the number of T cells in the lower chamber increased significantly and over time, indicating efficient recruitment ( Figure 2 At 120 min, T cell counts reached a peak of approximately 350,000 cells per well, which was significantly higher than that in the PBS group ( Figure 2Middle C). However, the cypate@EXO-CXCL9 group did not show a significant increase in T cell recruitment compared with the control group, which may be attributed to insufficient CXCL9 release.

[0065] The present invention evaluated the cytotoxic effects of these exosomes on tumor cells in the lower chamber. In the PBS, EXO, EXO-CXCL9, cypate@EXO and cypate@EXO-CXCL9 treatment groups, there was no change in tumor cell activity, confirming the biocompatibility of exosomes. Similarly, in the PBS+NIR, EXO+NIR and EXO-CXCL9+NIR groups, due to the lack of the photosensitizer cypate, the photothermal effect could not be induced, and therefore there was no significant effect on tumor cell activity. However, in the cypate@EXO+NIR group, a significant decrease in tumor cell activity was observed, which was driven by the photothermal effect of cypate under NIR laser irradiation. The most obvious cytotoxicity was observed in the cypate@EXO-CXCL9+NIR group, where NIR-triggered photothermal therapy not only directly killed tumor cells, but also promoted the enhanced release of CXCL9, further promoting T cell recruitment and destruction of tumor cells ( Figure 2 Middle D).

[0066] The present invention measured interferon-γ (IFN-γ) levels as an indicator of T cell activation. Compared with the PBS control group, the cypate@EXO-CXCL9+NIR group showed a significant increase in IFN-γ production, demonstrating that these immunomodulatory exosomes effectively stimulated T cell-mediated immune responses against tumor cells ( Figure 2 E and F).

[0067] In addition, the present invention also investigated the activation effect of exosomes on immune cells. + T cells were placed in the upper chamber, while Hep 1-6 cells were cultured in the lower chamber. Various treatment groups, including PBS, EXO, EXO-CXCL9, cypate@EXO, and cypate@EXO-CXCL9, were introduced into the lower chamber. Near-infrared (NIR) irradiation and non-NIR conditions were applied to each group for comparative analysis. Subsequently, the supernatant from the lower chamber was co-cultured with dendritic cells (DCs) and macrophages, and the maturation of DCs and the activation level of macrophages were evaluated. The results showed that the activation of DCs in the cypate@EXO+NIR group increased by 28% (compared to the control group). Figure 2 This enhancement was attributed to the photothermal effect of cypate under NIR irradiation, which induced cell killing and the release of immunogenic molecules, thereby promoting cell activation. The highest level of DC activation (25.6%) was observed in the cypate@EXO-CXCL9+NIR group ( Figure 2This is attributed to the ability of cypate to kill tumor cells, combined with the photothermal cleavage of EXO to release CXCL9 to recruit T cells and secrete IFN-γ, which together enhances immune cell activation. Regarding macrophage activation, the cypate@EXO-CXCL9+NIR group demonstrated the greatest polarization from M2 to M1 phenotype, an increase of 32% ( Figure 2 This shift indicates a pro-inflammatory activation state, which is crucial for an effective anti-tumor immune response. We also investigated the potential of tumor-targeting immunomodulatory exosomes to significantly enhance T cell-mediated anti-tumor activity.

[0068] 2.3 Anti-tumor effect in vivo

[0069] To evaluate the in vivo anti-tumor effect of NIR-responsive exosomes, a Hep 1-6 tumor-bearing mouse model was established. Mice were intravenously injected with cypate@EXO-CXCL9 exosomes once every five days for a total of four injections ( Figure 3 (A). After treatment, mice in the PBS and EXO-CXCL9+NIR groups showed rapid tumor progression. In contrast, mice treated with cypate@EXO+NIR showed moderate inhibition of tumor growth ( Figure 3 Importantly, the cypate@EXO-CXCL9+NIR treated group showed a more significant reduction in tumor growth than the control group ( Figure 3 At dissection, tumor weights were significantly smaller in the cypate@EXO-CXCL9+NIR group, consistent with the observed reduction in tumor volume during the study ( Figure 3 Body weight monitoring showed no significant changes among all treatment groups throughout the experimental period, indicating that the exosomes have good biocompatibility ( Figure 3 Survival analysis further highlighted the therapeutic potential of NIR-responsive exosomes. The median survival of mice treated with cypate@EXO+NIR was significantly prolonged, from 43 days in the PBS group to 58 days. Notably, mice in the cypate@EXO-CXCL9+NIR group showed the longest survival, exceeding 60 days ( Figure 3 Middle F). These findings indicate that laser-triggered release of CXCL9 from exosomes effectively recruits CD8 + T cells to the tumor site, enhancing immune-mediated tumor destruction. Hematoxylin and eosin (H&E) staining and TUNEL staining revealed extensive cell death in the tumor tissues of the cypate@EXO-CXCL9+NIR group ( Figure 3Furthermore, analysis of tissue sections from key organs, including the heart, liver, spleen, lung, and kidney, confirmed the excellent biocompatibility of the exosomes, with no evidence of damage or toxicity ( Figure 3 In summary, these results indicate that NIR-responsive cypate@EXO-CXCL9 exosomes effectively recruit CD8 + T cells to the tumor microenvironment, leading to enhanced tumor regression and prolonged survival in vivo, while maintaining a favorable safety profile.

[0070] 2.4 In vitro immune activation

[0071] In order to comprehensively evaluate the immunological effects of NIR-responsive exosomes in vivo, the present invention analyzed the infiltration of immune cells in tumor tissues of different treatment groups. CLSM was used to visualize the M1 macrophages (labeled with CD80-FITC), CD8 + The presence of T cells (labeled with CD8-FITC) and M2 macrophages (labeled with CD206-FITC) was observed in the PBS control group. + T cell infiltration is minimal, while M2 macrophages dominate the tumor microenvironment ( Figure 4 Middle A). The EXO-CXCL9+NIR treated group showed no significant change in immune cell infiltration compared to the control group, likely due to the lack of cypate, which prevented the generation of sufficient photothermal effect to destroy the particles and release CXCL9, thereby limiting CD8 + In contrast, in the cypate@EXO+NIR group, the photothermal effect of cypate induced a certain degree of immunogenic cell death by increasing CD8 + T cell infiltration and promotion of macrophage polarization from M2 to M1 changed the tumor microenvironment. The most obvious effect was observed in the cypate@EXO-CXCL9+NIR group ( Figure 4 Middle A), where the combination of photothermal ablation and NIR-induced CXCL9 release leads to CD8 + A significant increase in T cell recruitment and a significant change in the immune composition of the tumor microenvironment were observed. Flow cytometry analysis confirmed these findings, showing that CD8 + T cells (and CD4 + The proportion of CD4 lymphocytes in the cypate@EXO-CXCL9+NIR group increased significantly, by 10% and 21% respectively. + and CD8 +The most significant enhancement was seen in the T cell population, which increased by 20% compared to the control group ( Figure 4 In addition, a significant increase in dendritic cell maturation was observed in both the cypate@EXO+NIR and cypate@EXO-CXCL9+NIR treatment groups, which increased by 6% and 17%, respectively, compared with the control group, suggesting systemic anti-tumor immune activation ( Figure 4 The levels of IFN-γ produced by CD8+ T cells in tumor tissues further showed that the cypate@EXO-CXCL9+NIR group exhibited the highest level of cellular IFN-γ, which increased by 20% compared with the control group ( Figure 4 Further examination of tumor-associated macrophages revealed a significant decrease in M2 macrophages in both treatment groups (14% and 26%, respectively) ( Figure 4 E), and the M1 macrophages increased accordingly (8% and 25%, respectively) ( Figure 4 Serum cytokine analysis showed that the levels of TNF-α and IFN-γ in the EXO-CXCL9+NIR group did not change significantly compared with the PBS group ( Figure 4 (G and H). However, significant increases in both cytokines were observed in the cypate@EXO+NIR and cypate@EXO-CXCL9+NIR groups. Specifically, TNF-α levels increased approximately 3- and 5-fold, while IFN-γ levels increased approximately 4- and 6-fold. These findings highlight the robust immune response triggered by these therapeutic interventions.

[0072] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.

Claims

1. Use of engineered near-infrared light-responsive exosomes in the preparation of a drug for treating liver cancer, characterized in that: The method for preparing the engineered near-infrared light-responsive exosomes comprises the following steps: The recombinant plasmid containing the CXCL9 encoding gene was transfected into tumor cells to obtain cells expressing CXCL9; The CXCL9-expressing cells are irradiated with ultraviolet light and then incubated with a photosensitizer to obtain a cell culture supernatant; Separating the cell culture supernatant to obtain the engineered near-infrared light-responsive exosomes; The nucleotide sequence of the CXCL9 encoding gene is shown in SEQ ID NO.1; The tumor cells are liver cancer cells; The photosensitizer is cypate.

2. The use according to claim 1, characterized in that The ultraviolet irradiation time is 1 hour.

3. The use according to claim 1, characterized in that The separation process adopts differential centrifugation.

4. A drug for treating liver cancer, characterized in that: The active ingredients include engineered near-infrared light-responsive exosomes; The method for preparing the engineered near-infrared light-responsive exosomes comprises the following steps: The recombinant plasmid containing the CXCL9 encoding gene was transfected into tumor cells to obtain cells expressing CXCL9; The CXCL9-expressing cells are irradiated with ultraviolet light and then incubated with a photosensitizer to obtain a cell culture supernatant; Separating the cell culture supernatant to obtain the engineered near-infrared light-responsive exosomes; The nucleotide sequence of the CXCL9 encoding gene is shown in SEQ ID NO.1; The tumor cells are liver cancer cells; The photosensitizer is cypate.

5. The drug according to claim 4, characterized in that The drug also includes pharmaceutically acceptable excipients.

Images