Application of diaphorina citri ubiquitin ligase UFD4 gene and inhibitor thereof in prevention and control of citrus huanglongbing

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a diaphorina citri ubiquitin ligase UFD4 gene and application of an inhibitor of the diaphorina citri ubiquitin ligase UFD4 gene in prevention and control of citrus huanglongbing, and the amino acid sequence of encoding protein of the diaphorina citri ubiquitin ligase UFD4 gene is shown as SEQ ID NO.1. By regulating and controlling the ubiquitin ligase UFD4 gene, the infection of diaphorina citri can be reduced, so that the infection and propagation of the citrus liberobacter asiaticum can be effectively prevented and controlled. According to the invention, the E3-HECT inhibitor is used for silencing the ubiquitin ligase UFD4 gene for the first time, and the ubiquitination function of the ubiquitin ligase UFD4 gene in the infection process of the Huanglongbing is researched.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to application of a citrus psyllid ubiquitin ligase UFD4 gene and an inhibitor thereof in preventing and controlling citrus Huanglongbing disease. Background Art

[0002] Citrus Huanglongbing (HLB) is one of the most devastating diseases in the world's citrus industry. Since there is currently no effective treatment for trees susceptible to Huanglongbing, Huanglongbing is also called the "cancer" of citrus. To date, the Huanglongbing pathogen cannot be artificially cultured, but it can grow and reproduce for a long time in citrus psyllids. Once citrus psyllids are infected with Huanglongbing bacteria, they can carry it for life and spread it rapidly. This has brought great difficulties to the study of Huanglongbing and its prevention and control, and has been the biggest problem plaguing the citrus industry in recent years. At present, the international citrus industry's control of Huanglongbing is mainly limited to controlling the occurrence of citrus psyllids through chemical pesticides. However, the frequent use of chemical pesticides has caused many problems such as pesticide residues, environmental pollution, destruction of biodiversity, and pest resistance. Therefore, it is very necessary to study new methods for rapid and long-term control of Huanglongbing. Summary of the invention

[0003] The purpose of the present invention is to provide an application of the ubiquitin ligase UFD4 gene of citrus psyllid and its inhibitor in the prevention and control of citrus Huanglongbing. By regulating the ubiquitin ligase UFD4 gene, the infection of citrus psyllid can be reduced, thereby effectively preventing and controlling the infection and spread of citrus Huanglongbing.

[0004] The present invention provides application of biological materials related to the ubiquitin ligase UFD4 gene of citrus psyllid in preventing and controlling citrus Huanglongbing disease. The amino acid sequence of the protein encoded by the ubiquitin ligase UFD4 gene of citrus psyllid is shown in SEQ ID NO.1.

[0005] As a preferred embodiment, the biological material includes the citrus psyllid ubiquitin ligase UFD4 gene and / or the encoded protein of the citrus psyllid ubiquitin ligase UFD4 gene.

[0006] As a preferred embodiment, the nucleotide sequence of the citrus psyllid ubiquitin ligase UFD4 gene is shown as SEQ ID NO.2.

[0007] The invention provides a primer pair for amplifying a citrus psyllid ubiquitin ligase UFD4 gene, the primer pair comprising: a nucleotide sequence such as PT-F shown in SEQ ID NO.3 and a PT-R shown in SEQ ID NO.4; the amino acid sequence of the protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene is shown in SEQ ID NO.1.

[0008] The invention provides an inhibitor of a citrus psyllid ubiquitin ligase UFD4 gene, and the inhibitor comprises an E3-HECT type inhibitor.

[0009] The present invention provides application of the above inhibitor in studying the ubiquitination degradation function in the infection process of Huanglongbing.

[0010] The present invention provides application of the above inhibitor in preventing and controlling citrus Huanglongbing disease.

[0011] The present invention provides a method for preventing and controlling citrus Huanglongbing disease, comprising the following steps: silencing a citrus psyllid ubiquitin ligase UFD4 gene.

[0012] As a preferred embodiment, the silencing comprises: silencing using the above-mentioned inhibitor.

[0013] The present invention provides a method for detecting the expression amount of a citrus psyllid ubiquitin ligase UFD4 gene, comprising the following steps: performing RNAi analysis using dsRNA synthesized according to the citrus psyllid ubiquitin ligase UFD4 gene, wherein the amino acid sequence of the protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene is shown in SEQ ID NO.1;

[0014] The primer pair for dsRNA synthesis includes: RNAi-F with nucleotide sequences as shown in SEQ ID NO.5 and RNAi-R with nucleotide sequences as shown in SEQ ID NO.6;

[0015] The primer pair for RNAi analysis includes: qPCR-F with nucleotide sequence as shown in SEQ ID NO.7 and qPCR-R with nucleotide sequence as shown in SEQ ID NO.8.

[0016] Beneficial effects: The present invention provides the use of biological materials related to the ubiquitin ligase UFD4 gene of citrus psyllid in the prevention and control of citrus Huanglongbing, and the amino acid sequence of the protein encoded by the ubiquitin ligase UFD4 gene of citrus psyllid is shown in SEQID NO.1. The present invention identified the ubiquitin ligase UFD4 gene from the citrus psyllid transcriptome for the first time and successfully cloned it. The present invention found that the expression level of UFD4 was significantly upregulated after CLas pathogen infection, and it was speculated that the ubiquitin ligase UFD4 gene of citrus psyllid is likely to be involved in the response to CLas pathogen infection. The ubiquitin ligase UFD4 gene of the present invention contains a typical HECT domain. During the ubiquitination modification process, the UFD4 gene provides a recognition site for the ubiquitin conjugating enzyme E2 and binds to it; on the other hand, the UFD4 gene can specifically recognize the target protein to form an E2-HECT-target protein complex, thereby promoting the transfer of ubiquitin molecules from E2 to the target protein, and then completing the ubiquitination modification process, thereby effectively preventing and controlling citrus Huanglongbing.

[0017] The present invention provides an inhibitor of the ubiquitin ligase UFD4 gene of citrus psyllid, and the inhibitor includes: an E3-HECT type inhibitor. The present invention uses the E3-HECT type inhibitor to silence the ubiquitin ligase UFD4 gene for the first time, and studies its ubiquitination function during the infection of Huanglongbing. Through research, it is known that the E3-HECT type inhibitor successfully inhibits the ubiquitin ligase UFD4 gene. In the ubiquitination degradation pathway, the ubiquitin ligase E3 binds to the substrate protein in two ways. This is because there are two different protein structures (HECT type and RING type) in E3. In the HECT type, the ubiquitin molecule Ub successively binds to E2, E3 and the substrate protein to complete the degradation. In the RING type, the ubiquitin molecule does not bind to E3, and is directly transferred from E2 to bind to the substrate protein. Therefore, the E3-HECT type inhibitor can effectively silence the ubiquitin ligase UFD4 gene and has the function of ubiquitination degradation during the infection of Huanglongbing. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the result of RNAi of the ubiquitin ligase UFD4 gene of the citrus psyllid;

[0019] Figure 2 This is the result of the fungus acquisition of citrus psyllid after RNA interference;

[0020] Figure 3 This is the standard curve of the copy number of Huanglongbing bacteria;

[0021] Figure 4 This is the result diagram of the expression of DcUFD4 gene in citrus psyllid after being treated with E3-HECT type inhibitor;

[0022] Figure 5 This is the result of the fungus acquisition of citrus psyllid after being treated with E3-HECT type inhibitors;

[0023] Figure 6 This is the result of gene expression of DcUFD4 in citrus psyllid after treatment with E3-RING inhibitor. DETAILED DESCRIPTION

[0024] The present invention provides application of biological materials related to a ubiquitin ligase UFD4 gene of citrus psyllid (Diaphorina citri) in preventing and controlling citrus Huanglongbing disease. The amino acid sequence of the protein encoded by the ubiquitin ligase UFD4 gene of citrus psyllid is shown in SEQ ID NO.1: MSLSNSSDSEQMSFEGFLESCR*.

[0025] As a preferred embodiment, the biological material includes the citrus psyllid ubiquitin ligase UFD4 gene and / or the protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene, such as selecting the edible parts of the citrus psyllid on the citrus plant as the biological material, such as branches, tender shoots, young leaves and tender shoot juice. As a specific embodiment, citrus psyllids are fed with citrus branches including the citrus psyllid ubiquitin ligase UFD4 gene and / or the protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene to explore the effect of the ubiquitin ligase UFD4 gene on the infection of Huanglongbing fungus (CLas).

[0026] As a preferred embodiment, the nucleotide sequence of the citrus psyllid ubiquitin ligase UFD4 gene is shown in SEQ ID NO.2:

[0027]

[0028] Note: The horizontal line indicates the open reading frame, the bold font indicates the dsRNA interference sequence, and the experiment did not amplify the full length of the gene; during the amplification of the gene open reading frame, Takara brand rTaq enzyme and pMD19-t vector were used, and no additional sites were required, which could be quickly connected.

[0029] The present invention provides a primer pair for amplifying a citrus psyllid ubiquitin ligase UFD4 gene, the primer pair comprising: a nucleotide sequence of PT-F as shown in SEQ ID NO.3 and a PT-R as shown in SEQ ID NO.4; the amino acid sequence of the protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene is shown in SEQ ID NO.1. Among them, PT-F (SEQ ID NO.3): 5'-ACCTTGGTTTGCGGGTAT-3'; PT-R (SEQ ID NO.4): 5'-CGTCCACTGTGGGTTTTG-3'.

[0030] The present invention provides a method for detecting the expression amount of a citrus psyllid ubiquitin ligase UFD4 gene, comprising the following steps: performing RNAi analysis using dsRNA synthesized according to the citrus psyllid ubiquitin ligase UFD4 gene, wherein the amino acid sequence of the protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene is shown in SEQ ID NO.1;

[0031] The primer pair for dsRNA synthesis includes: RNAiF with nucleotide sequences as shown in SEQ ID NO.5 and RNAi-R with nucleotide sequences as shown in SEQ ID NO.6; wherein RNAi-F (SEQ ID NO.5): 5'- TAA TACGACTCACTATAGGACCTTGGTTTGCGGGTAT-3'; RNAi-R (SEQ ID NO.6): 5'- TAATACGACTCACTATAGG CGTCCACTGTGGGTTTTG-3′ (the underlined part represents the T7 promoter);

[0032] The primer pair for RNAi analysis includes: qPCR-F with nucleotide sequences as shown in SEQ ID NO.7 and qPCR-R with nucleotide sequences as shown in SEQ ID NO.8; wherein, qPCR-F (SEQ ID NO.7): 5'-AAC TGTACTTCGTTCGGTGCC-3'; qPCR-R (SEQ ID NO.8): 5'-AGCGTAAAAC TCCAGGGTCG-3'.

[0033] As a specific implementation method, the total RNA of citrus psyllid adults is extracted and then reverse transcribed into cDNA, and the cDNA is used as a template, and PT-F / R is used as an amplification primer through PCR technology. The open reading frame of the DcUFD4 gene is obtained; the amplified product is recovered using an Omega gel recovery kit; the amplified product is connected to the pMD19-T plasmid, transformed into the competent cell Trans5α of Escherichia coli, and plated, and a single colony is picked the next day to be propagated in LB liquid culture medium containing ampicillin, and the bacterial solution is sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing; the bacterial solution with a low mutation rate is selected for propagation and plasmid extraction (Sigma fast small amount plasmid extraction kit); the plasmid is used as a template, and amplification is performed using a primer containing a T7 promoter, and the amplified product is recovered by gel; the concentration of the recovered product is measured, and the PromegaT7 RiboMAX Express RNAi System and RNAi-F / R are used as primers for synthesizing dsRNA to synthesize dsRNA.

[0034] As a specific embodiment, the above-mentioned synthesized dsRNA is diluted with enzyme-free water to a concentration of 2000ng / μL, and microinjection technology is used to inject 4-5 instar citrus psyllid nymphs. In one embodiment, the volume of dsRNA injected into a single psyllid nymph is 20nL, and the injection rate is 15nL / s. As a specific embodiment, the psyllid nymphs are collected 24h and 48h after the injection treatment to extract total RNA (TRizol method), reverse transcribed into cDNA, and real-time fluorescence quantitative PCR detection is performed using qPCR-F / R primers to detect changes in the expression level of the citrus psyllid ubiquitin ligase UFD4 gene.

[0035] The expression detection method of the present invention may include real-time fluorescence quantitative PCR detection. As a preferred embodiment, when real-time fluorescence quantitative PCR detection is adopted, the reaction system of the detection is: ddH 2O8μL; SYBR 10μL; F / R 0.5μL; cDNA template 1μL; total system 20μL; the reaction procedure of the detection: 95℃ pre-denaturation 10min; 95℃ 10s, 60℃ 10s, 72℃ 10s, 40 cycles. The experiment was repeated 6 times with 6 independent samples; the reaction of the detection was performed using Roche LightCycler 480Ⅱ real-time fluorescence quantitative PCR instrument.

[0036] The present invention can pick up citrus psyllid nymphs treated with RNA interference and feed them on citrus tender branches infected with Huanglongbing bacteria to detect their susceptibility rate. As a preferred embodiment, the present invention screens and obtains the citrus psyllid ubiquitin ligase UFD4 gene (DcUFD4) from a transcriptome database, designs specific primers to synthesize dsRNA, silences the DcUFD4 gene by RNA interference, injects it into the abdomen of the psyllid in the form of microinjection, feeds the psyllid on citrus branches infected with Huanglongbing bacteria, and explores the effect of this gene on the infection of Huanglongbing bacteria (CLas).

[0037] The invention provides an inhibitor of the ubiquitin ligase UFD4 gene of citrus psyllid, and the inhibitor comprises: an E3-HECT type inhibitor. The invention inhibits the ubiquitin ligase by injecting the E3-HECT type inhibitor, and then detects the expression level of the ubiquitin ligase UFD4 gene by fluorescence quantitative detection.

[0038] The present invention provides a method for preventing and controlling citrus Huanglongbing, comprising the following steps: silencing the citrus psyllid ubiquitin ligase UFD4 gene. As a preferred embodiment, the silencing comprises: silencing using the above-mentioned inhibitor. The E3-HECT type inhibitor of the present invention has a ubiquitination degradation function, can promote the degradation of ubiquitin ligase, and provide a theoretical basis for the prevention and control of the target citrus Huanglongbing.

[0039] To further illustrate the present invention, the application of the citrus psyllid ubiquitin ligase UFD4 gene and its inhibitor provided by the present invention in the prevention and control of citrus Huanglongbing is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Example 1 Synthesis of dsRNA and RNAi Experiment

[0041] (1) dsRNA synthesis

[0042] Total RNA of citrus psyllid adults was extracted in the laboratory and reverse transcribed into cDNA. Using the cDNA of citrus psyllid adults as a template, PCR technology was used to amplify the open reading frame of the DcUFD4 gene using PT-F (SEQ ID NO.3) and PT-R (SEQ ID NO.4) as amplification primers; the amplified product was recovered using an Omega gel recovery kit; the amplified product was connected to the pMD19-t plasmid, transformed into the competent Escherichia coli Trans5α cell, plated, and a single colony was picked and propagated in LB liquid culture medium containing ampicillin the next day, and the bacterial solution was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing; bacterial solution with a low mutation rate was selected for propagation and plasmid extraction (Sigma fast small-scale plasmid extraction kit); using the plasmid as a template, amplification was performed using primers containing a T7 promoter, and the amplified product was recovered by gel; the concentration of the recovered product was measured, and dsRNA was synthesized using Promega T7 RiboMAX Express RNAiSystem (according to the method steps in the instruction manual), RNAi-F (SEQ ID NO.5) and RNAi-R (SEQ ID NO.6). IDNO.6) as a primer for synthesizing dsRNA.

[0043] (2) RNAi analysis

[0044] The synthesized dsRNA was diluted to a concentration of 2000ng / μL with enzyme-free water, and the 4-5-year-old citrus psyllid nymphs were treated with microinjection, that is, the dsRNA was injected into the abdomen of the psyllid in the form of microinjection. The volume of double-stranded injection for a single psyllid nymph was 20nL, and the injection rate was 15nL / s. At the same time, dsGFP was used as the experimental control group, that is, the same amount of dsGFP was injected, and the gene sequence of green fluorescent protein was used only as a control experiment. Its protein was not expressed, so no green fluorescence was emitted. After 24h and 48h of treatment, 8 citrus psyllid nymphs were collected to extract total RNA (TRizol method), which was reverse transcribed into cDNA, and the changes in its expression level were detected by real-time fluorescence quantitative PCR. The results are shown in the figure. Figure 1 .

[0045] Real-time fluorescence quantitative primers: qPCR-F (SEQ ID NO.7) and qPCR-R (SEQ ID NO.8).

[0046] Reaction system: ddH 2 O 8μL; SYBR 10μL; F / R 0.5μL; cDNA template 1μL; total system 20μL.

[0047] The reaction procedure was as follows: pre-denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 10 s. The experiment was repeated 6 times with 6 independent samples, and the reactions were all completed on a Roche LightCycler 480Ⅱ real-time fluorescence quantitative PCR instrument.

[0048] Figure 1 Shows: Relative expression of DcUFD4 gene after RNAi, where blue represents dsGFP treatment group; red represents dsUFD4 treatment group. 24h: P = 0.00446 < 0.01, extremely significant difference; 48h: P = 0.00003 < 0.01, extremely significant difference, "**" represents extremely significant difference. The results show that when the dsRNA concentration is 2000ng / μL, there is a good inhibitory effect, and the expression of UFD4 gene can be significantly inhibited at 24h and 48h.

[0049] Example 2

[0050] The citrus psyllid nymphs 48 hours after RNAi interference treatment were selected and raised on citrus branches infected with Huanglongbing bacteria. Fifteen surviving citrus psyllids were selected every 24 hours to detect the number of CLas pathogen copies. The results are shown in Figure 2 .

[0051] Detection method: The double-labeled probes and detection primers stored in the laboratory (see Table 1) were used to detect the presence of CLas pathogens in citrus psyllids at different time points after interference treatment.

[0052] Table 1 Absolute quantification probes and primers

[0053] Primer name Primer sequence (5'--3') Primer number CLas-F TCGAGCGCGTATGCAATACG SEQ ID NO.9 CLas-R GCGTTATCCCGTAGAAAAAGGTAG SEQ ID NO.10 Probe (FAM)AGACGGGTGAGTAACGCG(TAMRA) SEQ ID NO.11

[0054] Note: FAM and TAMRA are labeling molecules

[0055] The pMD19-t plasmid was connected to CLas, and the specific method can be found in the literature Zhang JB, ZouX J, ZhangQ, et al. Quantitative ubiquitylome crosstalk with proteome analysis revealed cytoskeleton proteins influence CLas pathogen infection in Diaphorina citri[J]. International Journal of Biological Macromolecules, 2023, 232: 123411. The recombinant plasmid pMD19-t-CLas (laboratory storage) was constructed and used for the preparation of the standard curve. Concentration gradient dilution 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 , using the diluted plasmid as template, prepare the reaction system, and the component ratio is shown in Table 2.

[0056] Table 2 Components of the reaction system

[0057] Components volume iTaqUniversalProbesSupermix(2×) 5μL CLas-F 0.3μL CLas-R 0.3μL probe 0.2μL DNA 1μL <![CDATA[H 2 The]]> 3.2μL Total volume 10μL

[0058] Absolute quantitative PCR was performed according to the reaction program. The program was: 95°C for 30 s; 95°C for 15 s, 60°C for 60 s, for a total of 40 cycles; with lg10 (copy number) as the X-axis and Ct value as the Y-axis, a standard curve was prepared, see Figure 3 The standard curve absolute quantitative standard system was established, and the standard curve was y = -1.3916x + 33.674, R 2 is 0.9929, and the abscissa is the number of copies of the CLas pathogen with a base of 10. The number of copies of the CLas pathogen in citrus psyllids was calculated according to the following formula.

[0059] Copy number = [nucleic acid concentration (ng / μL) × 10 -9 ×6.02×1023] / (number of bases×660).

[0060] Figure 2Shows: the situation of citrus psyllids after RNA interference; the vertical axis is the Clas pathogen copy number with a base of 10, 24h: P = 0.032 < 0.05, which is a significant difference; 48h: p = 0.005 < 0.01, which is an extremely significant difference. "*" represents a significant difference, and "**" represents an extremely significant difference. The results show that at the time of 24h and 48h, the copy number of dsUFD4 pathogens in the experimental group showed a lower level than that in the control group dsGFP.

[0061] Example 3

[0062] The protein structure of UFD4 gene was predicted, and the presence of HECT structure was found. To verify the effect of this structure on ubiquitination degradation function, commercial reagent E3-HECT inhibitor was purchased to specifically inhibit HECT structure (trade name: Heclin, purchased by: Taoshu Biotechnology Company).

[0063] Use H 2 O was used as solvent to dilute the HECT inhibitor by 10 2 times, microinjection volume was 20 nL, and control experiments used H 2 O was used as a reagent and microinjection was used to treat 4-5 instar citrus psyllid nymphs. Eight nymphs were collected 24 and 48 hours after treatment to extract total RNA (TRizol method), which was reverse transcribed into cDNA. Real-time fluorescence quantitative PCR was used to detect the changes in the expression level of DcUFD4. The results are shown in Figure 4 .

[0064] Figure 4 Shown: Relative expression of DcUFD4 gene after RNAi, where blue represents H 2 O treatment group; red represents E3-HECT inhibitor treatment group. 24h: P = 0.5023 > 0.05, no significant difference; 48h: P = 0.0032 < 0.01, extremely significant difference. Among them, "ns" represents no significant difference, and "**" represents extremely significant difference. The results show that the HECT inhibitor diluted 10 2 After 24h, it failed to inhibit the expression of UFD4 gene, but after 48h, it could significantly inhibit the expression of UFD4 gene.

[0065] The fifth-instar nymphs of citrus psyllids that were successfully inhibited by the E3-UFD4 inhibitor were picked up and placed on the infected citrus branches to feed 48 hours later. Fifteen citrus psyllid adults were picked up every 24 hours to extract total RNA (TRizol method), which was reverse transcribed into cDNA and the number of Clas pathogen copies was detected. The results are shown in Figure 5 .

[0066] Figure 5Shows: the number of Clas pathogens obtained by citrus psyllids after treatment with E3-HECT inhibitors; the vertical axis is the number of Clas pathogen copies with a base of 10, 24: P = 0.0071 < 0.01, which is a very significant difference; 48h: P = 0.0024 < 0.01, which is a very significant difference. "**" represents a very significant difference. The results show that at the time of obtaining the bacteria at 24h and 48h, compared with the control group H 2 O, The bacterial copy numbers in the experimental group showed lower levels after injection of HECT inhibitor.

[0067] Comparative Example 1

[0068] The E3-RING inhibitor (trade name: Disulfiram, purchased from Taoshu Biotechnology Co., Ltd.) was treated in the same manner as in Example 3, and the expression level of DcUFD4 was detected by real-time fluorescence quantitative PCR. Figure 6 .

[0069] Figure 6 Shown: Expression of DcUFD4 in D. citri after treatment with E3-RING inhibitors; blue represents the expression level of DcUFD4 in D. citri after treatment with H2O. Red represents the expression level of DcUFD4 in D. citri after treatment with E3-RING inhibitors. 24h: P = 0.9114 > 0.05, no significant difference; 48h: P = 0.9892 > 0.05, no significant difference, "ns" represents no significant difference. The results show that after injection of E3-RING inhibitors, there is no significant change in the UFD4 gene at 24h and 48h, so the RING configuration cannot inhibit the expression level of the UFD4 gene.

[0070] It can be seen that the present invention first screened the citrus psyllid ubiquitin ligase UFD4 gene (DcUFD4) from the transcriptome database, designed specific primers to synthesize dsRNA, silenced the DcUFD4 gene with the help of RNA interference, detected its gene silencing efficiency, and then placed it on citrus branches infected with Huanglongbing bacteria to feed, and explored the effect of this gene on the infection of Huanglongbing bacteria (CLas). Based on the above results, we concluded that the ubiquitin ligase UFD4 gene is positively correlated with the Huanglongbing bacteria Clas, and the presence of substrate proteins in its ubiquitin pathway can mediate and affect the immune defense mode of Clas, providing more ways and means for subsequent exploration of the prevention and control of Huanglongbing.

[0071] At the same time, the inhibition efficiency was tested by injecting E3-HECT inhibitors to inhibit ubiquitin ligase, and then placed on branches infected with Huanglongbing bacteria to feed, to explore the effect of ubiquitin ligase on the infection of Huanglongbing bacteria (CLas). According to the experimental results, among the several configurations of ubiquitin ligase, the UFD4 gene belongs to the HECT type. After inhibiting the entire HECT configuration, the efficiency of Clas was successfully inhibited, indicating that this configuration is a key factor in the prevention and control of Clas.

[0072] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of biological materials related to the ubiquitin ligase UFD4 gene of citrus psyllid in the prevention and control of citrus Huanglongbing, characterized in that: The amino acid sequence of the protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The biological material comprises a citrus psyllid ubiquitin ligase UFD4 gene and / or a protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene.

3. The use according to claim 1, characterized in that: The nucleotide sequence of the citrus psyllid ubiquitin ligase UFD4 gene is shown in SEQ ID NO.

2.

4. A primer pair for amplifying the citrus psyllid ubiquitin ligase UFD4 gene, characterized in that: The primer pair includes: PT-F as shown in SEQ ID NO.3 and PT-R as shown in SEQ ID NO.4; the amino acid sequence of the protein encoded by the citrus psyllid ubiquitin ligase UFD4 gene is shown in SEQ ID NO.

1.

5. An inhibitor of the citrus psyllid ubiquitin ligase UFD4 gene, characterized in that The inhibitors include: E3-HECT type inhibitors.

6. Use of the inhibitor according to claim 5 in studying the ubiquitination degradation function during Huanglongbing infection.

7. Use of the inhibitor according to claim 5 in preventing and controlling citrus Huanglongbing disease.

8. A method for preventing and controlling citrus Huanglongbing disease, characterized in that: The following steps are involved: Silencing of the ubiquitin ligase UFD4 gene in citrus psyllid.

9. The control method according to claim 8, characterized in that: The silencing comprises: using the inhibitor according to claim 5 for silencing.

10. A method for detecting the expression level of the citrus psyllid ubiquitin ligase UFD4 gene, characterized in that: The following steps are involved: RNAi analysis was performed using dsRNA synthesized according to the ubiquitin ligase UFD4 gene of citrus psyllid, wherein the amino acid sequence of the protein encoded by the ubiquitin ligase UFD4 gene of citrus psyllid is shown in SEQ ID NO.1; The primer pair for dsRNA synthesis includes: RNAi-F with nucleotide sequences as shown in SEQ ID NO.5 and RNAi-R with nucleotide sequences as shown in SEQ ID NO.6; The primer pair for RNAi analysis includes: qPCR-F with nucleotide sequence as shown in SEQ ID NO.7 and qPCR-R with nucleotide sequence as shown in SEQ ID NO.8.

Images