Bimodulin gene-specific double-stranded oligonucleotides and compositions comprising same for prevention and treatment of fibrosis-related diseases and respiratory diseases

Abstract

The present invention relates to a bimodulin gene-specific double-stranded oligonucleotide for preventing and treating fibrosis-related diseases and respiratory diseases, and a composition comprising the same, and more specifically, to a double-stranded oligonucleotide capable of highly specifically and effectively inhibiting bimodulin expression, and preferably a double stranded oligonucleotide comprising a sequence in the form of RNA / RNA, DNA / DNA or DNA / RNA heterozygote; a double-stranded oligonucleotide structure comprising the double-stranded oligonucleotide; a nanoparticle comprising the double stranded oligonucleotide structure; and its use for the prevention or treatment of fibrosis or respiratory diseases.

Description

[0001] This invention application is a divisional application based on an invention patent application with an application date of May 22, 2019, application number 201980042921.5 (international application number PCT / KR2019 / 006144), and titled “Amphiregulin gene-specific double-stranded oligonucleotides and compositions containing the same for preventing and treating fibrosis-related diseases and respiratory diseases”. Technical Field

[0002] The present invention relates to a double-stranded oligonucleotide capable of inhibiting the expression of amphiregulin with high efficiency and high specificity, preferably a double-stranded oligonucleotide comprising RNA / RNA, DNA / DNA or DNA / RNA hybrid sequence; a double-stranded oligonucleotide structure comprising the double-stranded oligonucleotide; a nanoparticle comprising the double-stranded oligonucleotide structure; and its use in preventing or treating fibrosis or respiratory diseases. Background Art

[0003] In 1995, Guo and Kemphues reported that not only sense RNA but also antisense RNA effectively inhibited gene expression in C.elegans, and since then, research has been conducted to identify the cause. In 1998, Fire et al. first described a phenomenon in which injection of double-stranded RNA (dsRNA) inhibited gene expression by specifically degrading the mRNA corresponding to it. This phenomenon is called RNA interference (RNAi). RNAi is a process for inhibiting gene expression, which can show a unique effect of inhibiting gene expression in a simple way at low cost, and therefore the application field of this technology has become more diverse.

[0004] Since this technology of inhibiting gene expression can regulate the expression of specific genes, it can remove specific genes related to cancer, genetic diseases, etc. at the mRNA level, and can be used as an important tool for developing therapeutic agents for disease treatment and verifying targets. As conventional techniques for inhibiting target gene expression, techniques for introducing transgenes for target genes have been disclosed. These techniques include methods for introducing transgenes in the antisense direction relative to a promoter and methods for introducing transgenes in the antisense direction relative to a promoter.

[0005] This RNA therapy targeting RNA is a method of using oligonucleotides to remove the function of a gene of interest against a target RNA, and can be considered different from conventional methods in which therapeutic agents (such as antibodies and small molecules) mainly target proteins. Methods for targeting RNA are roughly divided into two types: double-stranded RNA-mediated RNAi and methods using antisense oligonucleotides (ASOs). Currently, clinical trials are being attempted by targeting RNA in various diseases.

[0006] Antisense oligonucleotide (hereinafter referred to as "ASO") is a short synthetic DNA, which is designed to bind to the target gene according to Watson-Crick base pairing, and can specifically inhibit the expression of the specific nucleotide sequence of the gene. Therefore, antisense oligonucleotides have been used to study the role of genes and develop therapeutic agents that can treat diseases (such as cancer) at the molecular level. These ASOs have the advantage of being able to be easily produced by setting various targets for inhibiting gene expression, and in order to inhibit oncogene expression and cancer cell growth, the use of ASO has been studied. The process of inhibiting the expression of specific genes by ASO is completed by binding ASO to complementary mRNA sequences to induce RNase H activity and removing the mRNA, or by interfering with the formation and progress of ribosome complexes for protein translation. In addition, it is reported that ASO binds to genomic DNA to form a triple helix structure, thereby inhibiting gene transcription. ASO has the potential as described above, but in order to use ASO in clinical practice, it is necessary to improve the stability of ASO to nucleases, and ASO is effectively delivered to target tissues or cells, so as to specifically bind to the nucleotide sequence of the target gene. In addition, the secondary and tertiary structures of genetic mRNA are important factors for ASO specific binding, and the region where the formation of mRNA secondary structure is reduced is very beneficial for the entry of ASO. Therefore, before synthesizing ASO, efforts have been made to effectively achieve gene-specific inhibition not only in vitro but also in vivo by systematically analyzing the region where the formation of mRNA secondary structure is reduced. These ASOs are more stable than siRNA (a kind of RNA) and have the advantages of being easily soluble in water and normal saline. So far, the Federal Drug Administration (FDA) has approved three ASOs (Jessica, C., J Postdoc Res., 4: 35-50, 2016).

[0007] Since the discovery of the role of RNA interference (hereinafter referred to as "RNAi"), it has been found that RNAi acts on sequence-specific mRNA in various types of mammalian cells (Barik, S., J Mol. Med. (2005) 83: 764-773). When the long chain of double-stranded RNA is delivered to the cell, the delivered double-stranded RNA is converted by Dicer endonuclease into small interfering RNA (hereinafter referred to as "siRNA") of 21 to 23 base pairs (bp). siRNA binds to the RNA-induced silencing complex (RISC), and inhibits target gene expression in a sequence-specific manner through the process of guiding (antisense) strand recognition and degradation of target mRNA. The technology of using siRNA to inhibit gene expression is used to inhibit target gene expression in target cells and observe the resulting changes, and is effectively used to identify the research of the function of target genes in target cells. In particular, the function of inhibiting target genes in infectious viruses or cancer cells can be effectively used to develop a treatment method for diseases of interest. As a result of in vitro and in vivo studies using experimental animals, it has been reported that it is possible to inhibit target gene expression by siRNA.

[0008] Bertrand et al. report that siRNA is better than antisense oligonucleotides (ASO) for the same target gene in vitro and in vivo in inhibiting mRNA expression, and this effect lasts longer. In addition, regarding the mechanism of action, siRNA regulates target gene expression in a sequence-specific manner by complementary binding with target mRNA. Therefore, siRNA is superior to conventional antibody-based drugs or chemical drugs (small molecule drugs), because the scope of the subject to which siRNA is applicable can be significantly expanded (MA Behlke, MOLECULAR THERAPY.2006 13 (4): 664-670).

[0009] siRNA has excellent effects and can be used in various applications, but in order to develop siRNA as a therapeutic agent, the in vivo stability of siRNA and its cell delivery efficiency should be improved so that siRNA can be effectively delivered to cells (FY Xie, Drug Discov. Today. January 2006; 11 (1-2): 67-73). In order to improve in vivo stability and solve the problems associated with the non-specific innate immune stimulation of siRNA, some nucleotides or their backbones of siRNA have been actively tried to have nuclease resistance by modifying them, or using viral vectors, liposomes or nanoparticles to study them.

[0010] The delivery system comprising viral vectors (such as adenovirus or retrovirus) has high transfection efficacy, but has high immunogenicity and carcinogenicity. On the other hand, the non-viral delivery system containing nanoparticles has a lower cell delivery efficiency than the viral delivery system, but has advantages, including high safety in vivo, target-specific delivery, effective uptake and internalization of RNAi oligonucleotides into cells or tissues, and low cytotoxicity and immunostimulation. Therefore, the non-viral delivery system is currently considered to be a more promising delivery method than the viral delivery system (Akhtar S, J Clin Invest. December 3, 2007; 117 (12): 3623-3632).

[0011] In the non-viral delivery system, the method using nanocarriers is a method in which various polymers (such as liposomes and cationic polymer complexes) are used to form nanoparticles and in which siRNA is loaded into such nanoparticles (i.e., nanocarriers) and delivered to cells. In the method using nanocarriers, commonly used methods include methods using polymer nanoparticles, polymer micelles, lipid complexes (lipoplex), etc. Among them, the lipoplex is composed of cationic lipids, and the function is to interact with the anionic lipids of the cell endosome to induce the instability of the endosome, thereby allowing the extracellular delivery of exosomes.

[0012] In addition, it is known that the efficiency of siRNA in vivo can be improved by conjugating a compound to the terminal region of the follower (sense) strand of siRNA to impart improved pharmacokinetic characteristics (J. Soutschek, Nature 11; 432 (7014): 173-8, 2004). In this case, the stability of siRNA varies depending on the properties of the chemical compound conjugated to the end of the sense (follower) strand or antisense (guide) strand of siRNA. For example, siRNA conjugated to a polymer compound (such as polyethylene glycol (PEG)) interacts with the anionic phosphate group of siRNA in the presence of a cationic compound to form a complex, thereby providing a carrier with improved siRNA stability (SH Kim, J. Control. Release 129 (2): 107-16, 2008). In particular, compared with other drug delivery systems (such as microspheres or nanoparticles), micelles composed of polymer complexes have very small sizes and very uniform size distributions, and are spontaneously formed. These micelles therefore have the advantage that the quality of the micelle formulation can be easily managed and its reproducibility can be easily ensured.

[0013] In order to improve the intracellular delivery efficiency of siRNA, the technology of ensuring the stability of siRNA and increasing the cell membrane permeability of siRNA using siRNA conjugates has been developed, and the siRNA conjugates are obtained by conjugating a hydrophilic compound (e.g., polyethylene glycol (PEG)) as a biocompatible polymer to siRNA via a simple covalent bond or a covalent bond mediated by a linker (Korean Patent No. 883471). However, even when siRNA is chemically modified and conjugated to polyethylene glycol (PEG) (pegylation), it still has low in vivo stability and is not easy to be delivered to the disadvantages in the target organ. In order to overcome these shortcomings, a double-stranded oligo RNA structure has been developed, which includes hydrophilic and hydrophobic compounds combined with oligonucleotides, particularly double-stranded oligo RNA (such as siRNA). This structure is formed by the hydrophobic interaction of hydrophobic compounds and is called SAMiRNA. TM (Self-assembled micelle inhibitory RNA) self-assembled nanoparticles (Korean Patent No. 1224828). SAMiRNA TM The advantage of the technology over conventional delivery technologies is that uniform nanoparticles with very small sizes can be obtained.

[0014] Specifically, in SAMiRNA TM In the technology, PEG (polyethylene glycol) or HEG (hexaethylene glycol) is used as a hydrophilic compound. PEG is a synthetic polymer, which is generally used to increase the solubility of medical drugs (especially proteins) and regulate the pharmacokinetics of drugs. PEG is a polydisperse material, and a single batch of polymers is composed of different numbers of monomers, and therefore shows a molecular weight with a Gaussian curve. In addition, the uniformity of the material is expressed as a polydispersity index (Mw / Mn). In other words, when PEG has a low molecular weight (3 to 5kDa), it shows a polydispersity index of about 1.01, and when PEG has a high molecular weight (20kDa), it shows a high polydispersity index of about 1.2, thereby indicating that the uniformity of PEG decreases with the increase of its molecular weight. Therefore, when PEG is combined with medical drugs, the disadvantage of existence is that the polydispersity characteristics of PEG are reflected in the conjugate, and it is therefore not easy to verify a single material. Due to this disadvantage, the method for synthesizing and purifying PEG has been improved to produce a material with a low polydispersity index. However, when PEG is conjugated to a compound having a low molecular weight, there are problems associated with the polydisperse nature of the compound, including the problem that it is not easy to confirm whether conjugation is easily achieved (Francesco M. VDRUG DISCOVERY TODAY (2005) 10(21): 1451-1458).

[0015] Therefore, in recent years, SAMiRNA has been improved by TMTechnology (i.e. self-assembled nanoparticles): Hydrophilic compounds with double-stranded RNA structure (constituting SAMiRNA TM ) are formed into basic unit blocks, each block containing 1 to 15 monomers with uniform molecular weight; and (if necessary) a linker so that an appropriate number of blocks can be used as needed. Therefore, conventional SAMiRNA has been developed TM Compared with the new delivery system technology with small size and significantly improved polydispersity characteristics. It is known that when siRNA is injected, it is rapidly degraded by various enzymes present in the blood, and therefore its efficiency of delivery to target cells or tissues is poor. Therefore, the improved SAMiRNA TM The stability and expression inhibition rate also vary depending on the target gene. TM In order to more stably and effectively inhibit the expression of the target gene, the inventors of the present invention have attempted to enhance the inhibitory effect on the expression of the target gene and SAMiRNA by using double-stranded oligonucleotides. TM The double-stranded oligonucleotide comprises a DNA sequence of the ASO as a guide (sense) strand and an RNA sequence as a follower (antisense) sequence.

[0016] Idiopathic pulmonary fibrosis (hereinafter referred to as "IPF") is a type of fibrosis, a disease in which chronic inflammatory cells penetrate the alveolar (alveolar) wall, causing various changes that stiffen the lungs, leading to various severe structural changes in lung tissue and gradually reducing lung function, thereby leading to death. So far, there is no effective treatment for IPF. Once IPF symptoms occur and patients are diagnosed with IPF, the average survival time of the patient is only about 3 to 5 years. Therefore, IPF is a disease with a very poor prognosis. It is reported that the incidence of IPF in foreign countries is about 3 to 5 people per 100,000 people, and it is known that the incidence of IPF is usually higher after the age of 50, and the incidence of men is twice that of women.

[0017] Although the cause of IPF has not been clearly identified, it is reported that the incidence of IPF is high in smokers, and antidepressants, chronic pulmonary aspiration caused by gastroesophageal reflux, chronic pulmonary aspiration caused by gastroesophageal reflux, metal dust, wood powder, solvent inhalation, etc. are risk factors associated with the occurrence of IPF. However, in most patients, no clear etiological factors have been reported. As for the most commonly mentioned factors, it is known that when Th1 / Th2 reactions, coagulation cascades, etc. are activated for whatever reason, fibrogenic cytokines are secreted, and the activated cytokines stimulate fibroblasts and increase ECM (extracellular matrix), thereby causing pulmonary fibrosis. Of course, this process is accompanied by lung inflammation, which may lead to pulmonary fibrosis, but in recent years, the view that this process can directly lead to pulmonary fibrosis without considering lung inflammation is more dominant. The recent hypothesis is that pathological pulmonary fibrosis occurs during wound healing due to an abnormal signal transduction system in epithelial-mesenchymal interactions. When epithelial cells are damaged, the apoptosis of epithelial cells increases, the migration of epithelial cells is restricted, the migration differentiation of epithelial cells is not regulated, the proliferation is inhibited, and soluble factors (TGF, HGF, KGF, angiotensin II, ROS, etc.) are secreted. In addition, in this case, the apoptosis of mesenchymal cells is inhibited together with ECM. The apoptosis of mesenchymal cells is inhibited, thereby causing the differentiation of fibroblasts to increase, and causing pulmonary fibrosis by ECM deposition, or causing the restimulation of epithelial cells. In other words, it can not be considered that pulmonary inflammation directly causes pulmonary fibrosis, but this means that in the process of healing and restoring normal tissue, due to the difference between IPF patients and normal people, pulmonary inflammation occurs first, and then pulmonary fibrosis occurs. In addition, IPF may be caused by the imbalance of Th1 / Th2 cytokines. Th1 cytokine response is relevant to cell-mediated immunity, and the cell-mediated immunity restores the damaged tissue area to normal tissue, and Th2 cytokines cause ECM deposition and fibrosis by the activation and proliferation of fibroblasts. It has been reported that when IFN-γ is administered to a bleomycin-induced pulmonary fibrosis model, it can prevent pulmonary fibrosis by reducing the mRNA of TGF-β and procollagen. However, since the etiology of pulmonary fibrosis is not exactly known, it is necessary to identify the initial pathogenic factors that cause fibrosis and develop substances that can inhibit genes related to IPF and the TGF-β signaling system.

[0018] It is known that when IPF is not treated, IPF continues to worsen, resulting in the death of more than 50% of patients within 3 to 5 years. In addition, once the lungs are completely hardened due to fibrosis as the disease progresses, the patient will not improve no matter what type of treatment is performed. Therefore, it is predicted that when IPF is treated in the early stages, the likelihood of treatment being effective will be high. Methods for treating IPF using a combination of steroids with azathioprine or cyclophosphamide are known, but do not seem to have a particularly special effect. In addition, various fibrosis inhibitors have been tried in animal experiments and small groups of patients, but their effects have not yet been clearly demonstrated. In particular, for patients with advanced IPF, there is no effective treatment except lung transplantation. Therefore, there is an urgent need to develop more effective agents for treating IPF.

[0019] Fibrosis refers to a disease state in which the connective tissue becomes too fibrotic for some reason and the tissue or organ becomes hard. All processes in which fibrosis occurs follow the same path as the scar healing process, no matter in which region. So far, there are few methods to cure the symptoms of fibrosis, and treatment methods have been developed and studied. Effective fibrosis therapeutic agents can be applied to cirrhosis, liver fibrosis, myelofibrosis, myocardial fibrosis, renal fibrosis and pulmonary fibrosis, which are representative types of fibrosis, as well as various diseases associated with fibrosis, and therefore effective fibrosis therapeutic agents are urgently needed.

[0020] Meanwhile, it is known that amphiregulin activates the epidermal growth factor receptor (EGFR) pathway by binding to the epidermal growth factor receptor and is involved in cell proliferation. In addition, it has been disclosed that the expression of amphiregulin can be inhibited by amphiregulin-specific siRNA, which exhibits therapeutic effects on certain types of breast cancer. In addition, it has been disclosed that the use of shRNA against amphiregulin can inhibit cell infiltration in inflammatory breast cancer (Andrea Baillo, J. Cell Physiol. 2011 226 (10): 2691-2701), and when amphiregulin expression is inhibited using amphiregulin-specific shRNA, pulmonary artery remodeling in mice exposed to tobacco smoke is inhibited. It has been disclosed that amphiregulin is associated with airway smooth muscle (ASM) hyperplasia and angiogenesis, and that oversecreted epidermal growth factor (EGF) and amphiregulin are involved in (especially) promoting airway remodeling in asthmatic patients and tissue remodeling after acute asthma.

[0021] As explained above, the possibility of using amphiregulin as a therapeutic target for respiratory diseases and fibrosis (particularly COPD and IPF) has been proposed, but the development of RNAi therapeutics for amphiregulin and their delivery technologies is still insufficient, and the market demand for double-stranded oligonucleotide therapeutics and their delivery technologies that can inhibit amphiregulin expression with high efficiency and specificity is very high.

[0022] Therefore, the inventors of the present invention selected amphiregulin as a gene associated with fibrosis (including IPF), selected double-stranded oligonucleotides targeting amphiregulin, and also identified RNAi therapeutic agents capable of inhibiting the expression of amphiregulin and their delivery vectors, thereby completing the present invention. Summary of the invention

[0023] The object of the present invention is to provide a double-stranded oligonucleotide that can inhibit amphiregulin with high efficiency and high specificity, preferably a double-stranded oligonucleotide comprising RNA / RNA, DNA / DNA or DNA / RNA hybrid sequence; a double-stranded oligonucleotide structure comprising the double-stranded oligonucleotide; and a nanoparticle comprising the double-stranded oligonucleotide structure.

[0024] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases, which comprises a double-stranded oligonucleotide as an active ingredient; a double-stranded oligonucleotide structure comprising the same; and / or a nanoparticle comprising the double-stranded oligonucleotide structure.

[0025] Still another object of the present invention is to provide a method for preventing or treating fibrosis or respiratory diseases, the method comprising the step of administering a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases to a subject in need of prevention or treatment of fibrosis or respiratory diseases.

[0026] Yet another object of the present invention is to provide a double-stranded oligonucleotide, a double-stranded oligonucleotide structure comprising the same, and / or a nanoparticle comprising the double-stranded oligonucleotide structure for use in a method for preventing or treating fibrosis or respiratory diseases.

[0027] Still another object of the present invention is to provide a pharmaceutical composition for use in a method for preventing or treating fibrosis or respiratory diseases.

[0028] Another object of the present invention is to provide use of the double-stranded oligonucleotide, a double-stranded oligonucleotide structure comprising the same, and / or a nanoparticle comprising the double-stranded oligonucleotide structure for manufacturing a drug for preventing fibrosis or respiratory diseases.

[0029] To achieve the above objectives, the present invention provides a double-stranded oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises any sequence selected from SEQ ID NOs: 1 to 14, more preferably SEQ ID NOs: 10, 11 and 12, and the antisense strand comprises a sequence complementary thereto.

[0030] The present invention also provides a double-stranded oligonucleotide structure comprising the double-stranded oligonucleotide, and a nanoparticle comprising the double-stranded oligonucleotide structure.

[0031] The present invention also provides a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases, comprising: a double-stranded oligonucleotide, wherein the double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises any sequence selected from SEQ ID NO: 1 to 14, more preferably SEQ ID NO: 10, 11 and 12, and the antisense strand comprises a sequence complementary thereto; or a double-stranded oligonucleotide structure comprising the double-stranded oligonucleotide; or a nanoparticle comprising the double-stranded oligonucleotide structure.

[0032] The present invention also provides a method for preventing or treating fibrosis or respiratory diseases, comprising the step of administering a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases to a subject in need of preventing or treating fibrosis or respiratory diseases.

[0033] A double-stranded oligonucleotide comprising a sense strand and an antisense strand according to the present invention (the sense strand comprises any one sequence selected from SEQ ID NOs: 1 to 14, more preferably SEQ ID NOs: 10, 11 and 12, and the antisense strand comprises a sequence complementary thereto), or a double-stranded oligonucleotide structure comprising the double-stranded oligonucleotide, or a nanoparticle comprising the double-stranded oligonucleotide structure can very effectively inhibit the expression of amphiregulin, and therefore each of the double-stranded oligonucleotide, the double-stranded oligonucleotide structure comprising the same, and the nanostructure comprising the double-stranded oligonucleotide structure according to the present invention can be effectively used to prevent or treat fibrosis or respiratory diseases.

[0034] The preferred double-stranded oligonucleotides provided to achieve the above purpose include SEQ ID NOs: 10, 11 and 12 as follows:

[0035] 5'-CACCTACTCTGGGAAGCGT-3'(SEQ ID NO:10)

[0036] 5'-ACCTACTCTGGGAAGCGTG-3'(SEQ ID NO:11)

[0037] 5'-CTGGGAAGCGTGAACCATT-3'(SEQ ID NO:12)

[0038] As used herein, the term "double-stranded oligonucleotide" is intended to include all materials having general RNAi (RNA interference) activity, and it will be apparent to those skilled in the art that double-stranded oligonucleotides specific for mRNA encoding amphiregulin also include amphiregulin-specific shRNA, etc. That is, the oligonucleotide may be siRNA, shRNA, or miRNA.

[0039] Furthermore, it will be apparent to those skilled in the art that amphiregulin-specific siRNA or antisense oligonucleotides comprising a sense strand and an antisense strand (each comprising a sequence resulting from substitution, deletion or insertion of one or more nucleotides in the sense strand or the antisense strand complementary thereto, the sense strand comprising any one sequence selected from SEQ ID NOs: 10, 11 and 12) are also included within the scope of the present invention, as long as the specificity for amphiregulin is maintained.

[0040] In the present invention, the sense or antisense strand may be independently DNA or RNA. In addition, the sense and antisense strands may be in the form of a hybrid in which the sense strand is DNA and the antisense strand is RNA, or the sense strand is RNA and the antisense strand is DNA.

[0041] In the present invention, SEQ ID NOs: 10, 11 and 12 are listed in the form of DNA, but when the form of RNA is used, the sequences of SEQ ID NOs: 10, 11 and 12 may be the corresponding RNA sequences, that is, the sequences in which T is replaced by U.

[0042] Furthermore, the double-stranded oligonucleotide according to the present invention includes not only the case where the sense strand of the sequence is completely complementary (perfect match) to the binding site of the amphiregulin gene, but also the case where the sense strand is partially complementary (mismatch) to the binding site, as long as the specificity for amphiregulin is maintained.

[0043] The double-stranded oligonucleotide according to the invention may comprise an overhang at the 3' end of one or both strands, said overhang comprising one or more unpaired nucleotides.

[0044] In the present invention, the sense strand or the antisense strand may preferably consist of 19 to 31 nucleotides, but is not limited thereto.

[0045] In the present invention, a double-stranded oligonucleotide comprising a sense strand and an antisense strand may be specific to amphiregulin, but is not limited thereto, the sense strand comprising any one sequence selected from SEQ ID NO: 10, 11 and 12, and the antisense strand comprising a sequence complementary thereto.

[0046] In the present invention, the sense strand or antisense strand of the double-stranded oligonucleotide may contain various chemical modifications in order to increase its in vivo stability or impart nuclease resistance and reduce nonspecific immune response. The chemical modification may be one or more chemical modifications selected from, but not limited to, the following: a modification in which the OH group at the 2' carbon position of the sugar structure in one or more nucleotides is replaced by any one selected from -CH3 (methyl), -OCH3 (methoxy), amine (-NH2), fluorine (-F), -O-2-methoxyethyl, -O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido and -O-dimethylamidooxyethyl; a modification in which the oxygen in the sugar structure in the nucleotide is replaced by sulfur; the bond between the nucleotides is modified to any one selected from a thiophosphate bond, a boranophosphophate bond and a methylphosphonate bond; a modification to PNA (peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic acid); and a modification to a DNA-RNA hybrid (Ann. Rev. Med. 55, 61-65 2004; US 5,660,985; US 5,958,691; US ​​6,531,584; US 5,808,023; US 6,326,358; US 6,175,001; Bioorg. Res. 31:589-595, 2003; Nucleic Acids Research, 38(17)5761-773, 2010; Nucleic Acids Research, 39(5):1823-1832, 2011).

[0047] In the present invention, one or more phosphate groups, preferably one to three phosphate groups, may be bound to the 5' end of the antisense strand of the double-stranded oligonucleotide.

[0048] In another aspect, the present invention relates to a double-stranded oligonucleotide structure comprising a structure represented by the following formula (1), wherein A represents a hydrophilic compound, B represents a hydrophobic compound, X and Y each independently represent a simple covalent bond or a linker-mediated covalent bond, and R represents a double-stranded oligonucleotide.

[0049] In a preferred embodiment, the double-stranded oligonucleotide structure comprising the amphiregulin-specific sequence according to the present invention preferably has a structure represented by the following structural formula (1):

[0050] AXRYB structure (1)

[0051] wherein A represents a hydrophilic compound, B represents a hydrophobic compound, X and Y each independently represent a simple covalent bond or a linker-mediated covalent bond, and R represents a double-stranded oligonucleotide.

[0052] The double-stranded oligonucleotide according to the present invention is preferably in the form of a DNA-RNA hybrid, siRNA (short interfering RNA), shRNA (short hairpin RNA) or miRNA (micro RNA), but is not limited thereto, and may also include a single-stranded miRNA inhibitor that can act as a miRNA antagonist.

[0053] Hereinafter, the double-stranded oligonucleotide according to the present invention will be described with a focus on RNA, but it will be apparent to those skilled in the art that the present invention can also be applied to other double-stranded oligonucleotides having the same features as the double-stranded oligonucleotide of the present invention.

[0054] More preferably, the double-stranded oligonucleotide structure comprising the amphiregulin-specific double-stranded oligonucleotide according to the present invention has a structure represented by the following structural formula (2):

[0055]

[0056] wherein A, B, X and Y are as defined in the above structural formula (1), S represents the sense strand of the amphiregulin-specific double-stranded oligonucleotide, and AS represents the antisense strand of the amphiregulin-specific double-stranded oligonucleotide.

[0057] More preferably, the double-stranded oligonucleotide structure comprising the amphiregulin-specific double-stranded oligonucleotide has a structure represented by the following structural formula (3) or (4):

[0058]

[0059] wherein A, B, S, AS, X and Y are as defined in the above structural formula (2), and 5' and 3' respectively represent the 5' end and 3' end of the sense strand of the amphiregulin-specific double-stranded oligonucleotide.

[0060] The hydrophilic compound may be selected from polyethylene glycol (PEG), polyvinyl pyrrolidone, and polyoxazoline, but is not limited thereto.

[0061] It will be apparent to those skilled in the art that one to three phosphate groups can be bound to the 5' end of the antisense strand of the double-stranded oligonucleotide RNA structure comprising the amphiregulin-specific siRNA as shown in Structural Formula (1) to Structural Formula (4), and shRNA can be used instead of RNA.

[0062] The hydrophilic compound in the above structural formula (1) to structural formula (4) is preferably a polymer compound having a molecular weight of 200 to 10,000, and more preferably a polymer compound having a molecular weight of 1,000 to 2,000. For example, as the hydrophilic polymer compound, a nonionic hydrophilic polymer compound such as polyethylene glycol, polyvinyl pyrrolidone or polyoxazoline is preferably used, but the present disclosure is not limited thereto.

[0063] In particular, the hydrophilic compound (A) in the structural formula (1) to the structural formula (4) can be used in the form of a hydrophilic block as shown in the following structural formula (5) or (6), and an appropriate number (n in the structural formula (5) or (6)) of such a hydrophilic block can be used as required, thereby overcoming the problems associated with polydispersity that may occur when using general synthetic polymer compounds:

[0064] (A' m -J) n Structural formula (5)

[0065] (J-A' m ) n Structural formula (6)

[0066] wherein A' represents a hydrophilic monomer, J represents a linker that connects multiple (m) hydrophilic monomers together or connects multiple (m) hydrophilic monomers to a double-stranded oligonucleotide, m is an integer ranging from 1 to 15, n is an integer ranging from 1 to 10, and (A' m -J) or (JA m The repeating unit represented by ') corresponds to the basic unit of the hydrophilic block.

[0067] When a hydrophilic block as shown in the above structural formula (5) or (6) is used, the double-stranded oligonucleotide structure comprising the amphiregulin-specific oligonucleotide according to the present invention may have a structure represented by the following structural formula (7) or (8):

[0068] (A' m -J) n -XRYB structure (7)

[0069] (J-A' m ) n -XRYB structure (8)

[0070] wherein X, R, Y and B are as defined above in formula (1), and A', J, m and n are as defined above in formulas (5) and (6).

[0071] As the hydrophilic monomer (A') in the above structural formulas (5) and (6), one selected from nonionic hydrophilic polymers can be used but is not limited thereto, as long as it is compatible with the purpose of the present invention. Preferably, a monomer selected from compounds (1) to (3) listed in Table 1 below can be used. More preferably, a monomer of compound (1) can be used. In compound (1), G can be preferably selected from O, S and NH.

[0072] In particular, among the hydrophilic monomers, the monomer represented by compound (1) is very suitable for producing the structure according to the present invention, because the monomer has advantages in that various functional groups can be introduced into the monomer, and the monomer induces little immune response by having good in vivo affinity and excellent biocompatibility, and the in vivo stability of the double-stranded oligonucleotide contained in the structure represented by structural formula (7) or (8) can be increased, and the delivery efficiency of the double-stranded oligonucleotide can be increased.

[0073] [Table 1] Structure of hydrophilic monomer used in the present invention

[0074]

[0075] The total molecular weight of the hydrophilic compounds in the structural formula (5) to the structural formula (8) is preferably in the range of 1,000 to 2,000. Therefore, for example, when the compound (1) in the structural formula (7) and the structural formula (8) is hexaethylene glycol, that is, a compound in which G is O and m is 6, the repeating number (n) is preferably 3 to 5 because the molecular weight of the hexaethylene glycol space is 344. In particular, the present invention is characterized in that an appropriate number (expressed as n) of (A′) in the structural formula (5) and the structural formula (6) can be used as needed. m -J) or (JA′ m ) nThe hydrophilic monomer J and the linker J contained in each hydrophilic block can be the same or different between the hydrophilic blocks. In other words, when three hydrophilic blocks (n=3) are used, the hydrophilic monomer of compound (1), the hydrophilic monomer of compound (2) and the hydrophilic monomer of compound (3) can be used in the first block, the second block and the third block, respectively, indicating that different monomers can be used in all hydrophilic blocks. Alternatively, any hydrophilic monomer selected from the hydrophilic monomers of compounds (1) to (3) can also be used in all hydrophilic blocks. Similarly, as a linker mediating the bonding of the hydrophilic monomers, the same linker can be used in the hydrophilic block, or different linkers can also be used in the hydrophilic block. In addition, the number m of hydrophilic monomers can also be the same or different between the hydrophilic blocks. In other words, in the first hydrophilic block, three hydrophilic monomers (m=3) are connected, in the second hydrophilic block, five hydrophilic monomers (m=5) are connected, and in the third hydrophilic block, four hydrophilic monomers (m=4) are connected, indicating that different numbers of hydrophilic monomers can be used in the hydrophilic blocks. Alternatively, the same number of hydrophilic monomers can also be used in all hydrophilic blocks.

[0076] Furthermore, in the present invention, the linker (J) is preferably selected from -PO3 - -, -SO3- and -CO2-, but not limited thereto. It will be apparent to those skilled in the art that any linker selected in consideration of the hydrophilic monomer used may be used as long as it is compatible with the purpose of the present invention.

[0077] The function of the hydrophobic compound (B) in the structural formula (1) to the structural formula (4), the structural formula (7) and the structural formula (8) is to form nanoparticles composed of the oligonucleotide structures represented by the structural formula (1) to the structural formula (4), the structural formula (7) and the structural formula (8) through hydrophobic interactions. The hydrophobic compound preferably has a molecular weight of 250 to 1,000 and may be selected from steroid derivatives, glycerol ester derivatives, glycerol ethers, polypropylene glycol, C 12 -C 50 Any of unsaturated or saturated hydrocarbons, diacylphosphatidylcholines, fatty acids, phospholipids, lipopolyamines, lipids, tocopherols and tocotrienols, but not limited thereto. It will be apparent to those skilled in the art that any hydrophobic compound may be used as long as it is compatible with the purpose of the present invention.

[0078] The steroid derivatives may be selected from cholesterol, cholestanol, bile acid, cholesteryl formate, cholesteryl formate and cholesteryl amine, and the glyceride derivatives may be selected from monoglyceride, diglyceride and triglyceride, etc. Here, the fatty acid of the glyceride is preferably C12 -C 50 Unsaturated or saturated fatty acids.

[0079] In particular, among the hydrophobic compounds, saturated or unsaturated hydrocarbons or cholesterol are preferably used because they can be easily bound in the synthesis step of the double-stranded oligonucleotide structure according to the present invention. Most preferably, C 24 Hydrocarbons, especially hydrophobic hydrocarbons containing disulfide bonds.

[0080] The hydrophobic compound can be bound to the distal end of the hydrophilic compound and can be bound to any position on the sense strand or the antisense strand of the double-stranded oligonucleotide.

[0081] The hydrophilic compound or hydrophobic compound in the structural formulas (1) to (4), (7) and (8) according to the present invention is bound to the amphiregulin-specific oligonucleotide via a single covalent bond or a linker-mediated covalent bond (X or Y). The linker mediating the covalent bond is covalently bonded to the hydrophilic or hydrophobic compound at the end of the amphiregulin-specific oligonucleotide, and is not particularly limited as long as it provides a degradable bond in a specific environment if necessary. Therefore, the linker used in the present invention can be any compound that is bound in order to activate the amphiregulin oligonucleotide and / or the hydrophilic (or hydrophobic) compound during the production process of the double-stranded oligonucleotide structure according to the present invention. The covalent bond can be any of a non-degradable bond and a degradable bond. Here, examples of non-degradable bonds include, but are not limited to, amide bonds and phosphate bonds, and examples of degradable bonds include, but are not limited to, disulfide bonds, acid degradable bonds, ester bonds, anhydride bonds, biodegradable bonds, and enzyme degradable bonds.

[0082] In addition, as the amphiregulin-specific double-stranded oligonucleotide represented by R (or S and AS) in structural formulas (1) to (4), (7) and (8), any double-stranded oligonucleotide having a property of specifically binding to amphiregulin mRNA can be used but is not limited thereto. Preferably, the amphiregulin-specific double-stranded oligonucleotide according to the present invention comprises a sense strand and an antisense strand, the sense strand comprising any one sequence selected from SEQ ID NO: 10, 11 and 12, and the antisense strand comprising a sequence complementary to the sequence of the sense strand.

[0083] Furthermore, in the double-stranded oligonucleotide structure comprising the amphiregulin-specific double-stranded oligonucleotide according to the present invention, an amine or polyhistidine group may be additionally introduced to the distal end of the hydrophilic compound bound to the oligonucleotide in the structure.

[0084] This promotes the intracellular uptake and endosomal escape of a vector comprising a double-stranded oligonucleotide structure comprising a double-stranded oligonucleotide specific for amphiregulin according to the present invention, and it has been reported that the introduction of amine groups and polyhistidine groups can be used to promote the intracellular uptake and endosomal escape of vectors such as quantum dots, dendrimers or liposomes.

[0085] Specifically, it is known that the primary amine group introduced to the end or outside of the vector is protonated at biological pH and simultaneously forms a conjugate by interacting with the negatively charged gene, and due to the internal tertiary amine having a buffering effect at low pH after intracellular uptake, endosomal escape is promoted, thereby protecting the vector from lysosomal degradation (Gene Delivery and Expression Inhibition Using Polymer-Based Hybrid Material, Polymer Sci. Technol., Vol. 23, No. 3, pp. 254-259).

[0086] In addition, it is known that histidine (a non-essential amino acid) has an imidazole ring (pKa=6.04) at its residue (-R), and thus has the effect of increasing the buffering capacity in endosomes and lysosomes, and thus histidine modification can be used in non-viral gene vectors (including liposomes) to increase the endosomal escape efficiency (Novel histidine-conjugatedgalactosylated cationic liposomes for efficient hepatocyte selective gene transfer in human hepatoma HepG2 cells. J. Controlled Release 118, pp. 262-270).

[0087] The amine group or polyhistidine group can be linked to the hydrophilic compound or hydrophilic block via one or more linkers.

[0088] When an amine group or a polyhistidine group is introduced into the hydrophilic compound of the double-stranded oligonucleotide structure represented by the structural formula (1) according to the present invention, the RNA structure may have a structure represented by the following structural formula (9):

[0089] P-J1-J2-AXRYB Structure (9)

[0090] wherein A, B, R, X and Y are as defined in the above structural formula (1),

[0091] P represents an amine group or a polyhistidine group, and J1 and J2 are linkers, each of which can be independently selected from a simple covalent bond, PO3- 、SO3、CO2、C 2-12 Alkyl, alkenyl and alkynyl, but not limited thereto. It will be apparent to those skilled in the art that any linker selected in consideration of the hydrophilic compounds used herein can be used as J1 and J2, as long as they are compatible with the purpose of the present invention.

[0092] Preferably, when an amine group is introduced, J2 is a simple covalent bond or PO3 - , and J1 is a C6 alkyl group, but the present invention is not limited thereto.

[0093] Furthermore, when a polyhistidine group is introduced, it is preferred that J2 in the structural formula (9) is a simple covalent bond or PO3 - , and J1 is compound (4), but the present invention is not limited thereto.

[0094]

[0095] Furthermore, when the hydrophilic compound of the double-stranded oligonucleotide structure represented by the structural formula (9) is a hydrophilic block represented by the structural formula (5) or (6) and an amine group or a polyhistidine group is introduced thereto, the double-stranded oligonucleotide structure may have a structure represented by the following structural formula (10) or (11):

[0096] P-J1-J2-(A' m -J) n -XRYB structure (10)

[0097] P-J1-J2-(J-A' m ) n -XRYB structure (11)

[0098] wherein X, R, Y, B, A', J, m and n are as defined above in formula (5) or (6), and P, J1 and J2 are as defined in formula (9).

[0099] In particular, the hydrophilic compounds in the structural formula (10) and the structural formula (11) are preferably bound to the 3' end of the sense strand of the double-stranded oligonucleotide specific for amphiregulin. In this case, the structural formulas (9) to (11) may correspond to the following structural formulas (12) to (14):

[0100]

[0101] wherein X, R, Y, B, A, A′, J, m, n, P, J1 and J2 are as defined above in formula (9) to formula (11), and 5′ and 3′ represent the 5′ end and 3′ end of the sense strand of the amphiregulin-specific double-stranded oligonucleotide.

[0102] The amine groups that can be introduced in the present invention can be primary, secondary or tertiary amine groups. In particular, primary amine groups are preferably used. The introduced amine groups can exist in the form of amine salts. For example, the salts of primary amine groups can exist as NH3 + exists in the form of.

[0103] Furthermore, the polyhistidine group that can be introduced in the present invention preferably contains 3 to 10 histidines, more preferably 5 to 8 histidines, and most preferably 6 histidines. In addition to histidine, one or more cysteines may also be included.

[0104] At the same time, when a targeting moiety is provided in a double-stranded oligonucleotide structure comprising amphiregulin-specific oligonucleotide according to the present invention and a nanoparticle formed therefrom, it can promote the efficient delivery of the RNA structure to the target cells, so that the RNA structure can be delivered to the target cells even at a relatively low concentration, thereby exhibiting a strong effect of regulating the expression of the target gene. In addition, the targeting moiety can prevent the non-specific delivery of the amphiregulin-specific double-stranded oligonucleotide to other organs and cells.

[0105] Therefore, the present invention provides a double-stranded oligo RNA structure, wherein a ligand (L), in particular a ligand having the property of specifically binding to a receptor that enhances target cell internalization through receptor-mediated endocytosis (RME), is further bound to a structure represented by any one of structural formulae (1) to (4), (7) and (8). For example, the structure in which the ligand is bound to the double-stranded oligo RNA structure represented by structural formula (1) has a structure represented by the following structural formula (15):

[0106] (L i -Z)-AXRYB structure (15)

[0107] wherein A, B, X and Y are as defined in the above structural formula (1), L is a ligand having the property of specifically binding to a receptor that enhances target cell internalization through receptor-mediated endocytosis (RME), and "i" is an integer ranging from 1 to 5, preferably from 1 to 3.

[0108] The ligand in structural formula (15) can be preferably selected from: target receptor-specific antibodies, aptamers and peptides having RME properties that enhance target cell internalization; folate (the term "folate" is often used interchangeably with folic acid, and the term "folate" as used herein means folic acid in its natural form or activated in the human body); and chemical compounds including hexosamines such as N-acetylgalactosamine (NAG), and sugars or carbohydrates such as glucose and mannose, but are not limited thereto.

[0109] Furthermore, the hydrophilic compound (A) in the above structural formula (15) may be used in the form of a hydrophilic block represented by the structural formula (5) or (6).

[0110] In another aspect, the present invention provides a method for producing a double-stranded oligonucleotide structure comprising an amphiregulin-specific double-stranded oligonucleotide.

[0111] For example, the method for producing a double-stranded oligonucleotide structure comprising an amphiregulin-specific double-stranded oligonucleotide according to the present invention may comprise the following steps:

[0112] (1) binding a hydrophilic compound to a solid support;

[0113] (2) synthesizing a single-stranded oligonucleotide on a solid support bound to a hydrophilic compound;

[0114] (3) covalently binding a hydrophobic compound to the 5′ end of the single-stranded oligonucleotide;

[0115] (4) synthesizing a single-stranded oligonucleotide having a sequence complementary to the sequence of the single-stranded oligonucleotide of step (2);

[0116] (5) after the synthesis is complete, separating and purifying the oligonucleotide-polymer structure and the oligonucleotide single strand from the solid support; and

[0117] (6) An oligonucleotide-polymer structure generated by annealing single-stranded oligonucleotides having complementary sequences to produce a double-stranded oligonucleotide structure.

[0118] The solid support used in the present invention is preferably controlled pore glass (CPG), but is not limited thereto, and polystyrene (PS), polymethyl methacrylate (PMMA), silica gel, cellulose paper, etc. may also be used. When CPG is used, it preferably has a diameter of 40 to 180 μm and a width of 500 to 180 μm. After step (5), the molecular weight of the RNA-polymer structure and the oligonucleotide single strand produced and purified can be measured using a MALDI-TOF mass spectrometer to confirm that the desired oligonucleotide-polymer structure and oligonucleotide single strand are obtained. In the above production method, the step (4) of synthesizing an oligonucleotide single strand having a sequence complementary to the sequence of the oligonucleotide single strand synthesized in step (2) can be performed before step (1) or during any one of steps (1) to (5).

[0119] Furthermore, the single-stranded oligonucleotide having a sequence complementary to the sequence of the single-stranded oligonucleotide synthesized in step (2) can be used in a state where a phosphate group is bonded to the 5′ end of the single-stranded oligonucleotide.

[0120] Meanwhile, the present invention provides a method for producing a double-stranded oligonucleotide structure, wherein a ligand is further bound to the double-stranded oligonucleotide structure comprising the amphiregulin-specific double-stranded oligonucleotide.

[0121] For example, the method for producing a ligand-bound double-stranded oligonucleotide structure comprising an amphiregulin-specific double-stranded oligonucleotide may comprise the following steps:

[0122] (1) binding a hydrophilic compound to a solid support having a functional group that binds thereto;

[0123] (2) synthesizing a single-stranded oligonucleotide on a solid support having a functional group and a hydrophilic compound bound thereto;

[0124] (3) covalently binding a hydrophobic compound to the 5′ end of the single-stranded oligonucleotide;

[0125] (4) synthesizing a single-stranded oligonucleotide having a sequence complementary to the sequence of the single-stranded oligonucleotide synthesized in step (2);

[0126] (5) after the synthesis is completed, separating the functional group-oligonucleotide-polymer structure and the single-stranded oligonucleotide having a complementary sequence from the solid support;

[0127] (6) binding the ligand to the end of the hydrophilic compound via the functional group to produce a single strand of the ligand-oligonucleotide-polymer structure; and

[0128] (7) A ligand-oligonucleotide-polymer structure is generated by annealing a single-stranded oligonucleotide with a complementary sequence to generate a ligand / double-stranded oligonucleotide structure.

[0129] After step (6), the ligand-oligonucleotide-polymer structure and the oligonucleotide strand with complementary sequence produced can be separated and purified, and then the molecular weight can be measured using a MALDI-TOF mass spectrometer to confirm that a desired ligand-RNA-polymer structure and a desired RNA strand with complementary sequence have been produced. By annealing the ligand / RNA-oligonucleotide structure produced with the oligonucleotide strand with complementary sequence, a ligand / double-stranded-oligonucleotide structure can be produced. In the above production method, the step (4) of synthesizing an oligonucleotide strand with a sequence complementary to the sequence of the oligonucleotide strand synthesized in step (3) can be performed before step (1) or during any one of steps (1) to (6).

[0130] On the other hand, the present invention relates to a nanoparticle comprising a double-stranded oligonucleotide structure according to the present invention. Double-stranded oligonucleotide according to the present invention forms a self-assembled nanoparticle (Korean Patent No. 1224828) through the hydrophobic interaction of a hydrophobic compound. These nanoparticles have excellent in vivo delivery efficiency and in vivo stability. In addition, the high particle size uniformity of nanoparticles makes quality control (QC) easy, and therefore the method for preparing these nanoparticles as medicines is easy.

[0131] In the present invention, the nanoparticles may also be composed of a mixture of double-stranded oligonucleotide structures containing double-stranded structures containing different sequences. For example, the nanoparticles may contain a double-stranded oligonucleotide specific for amphiregulin, which contains a sense strand and an antisense strand, wherein the sense strand contains any sequence selected from SEQ ID NO: 10 to 12, and the antisense strand contains a sequence complementary thereto; however, in another embodiment, the nanoparticles may contain different kinds of double-stranded oligonucleotides specific for amphiregulin, each of which contains a sense strand and an antisense strand, wherein the sense strand contains any sequence selected from SEQ ID NO: 10 to 12, and the antisense strand contains a sequence complementary thereto, and may also contain double-stranded oligonucleotides specific for amphiregulin that are not disclosed in the present invention.

[0132] In still another aspect, the present invention relates to a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases, which contains as an active ingredient a double-stranded oligonucleotide, a double-stranded oligonucleotide structure, or a nanoparticle comprising a double-stranded oligonucleotide structure according to the present invention.

[0133] The pharmaceutical composition for preventing or treating fibrosis or respiratory diseases according to the present invention exhibits the effect of preventing or treating fibrosis or respiratory diseases by inhibiting connective tissue remodeling, particularly pulmonary artery remodeling and airway remodeling.

[0134] In the present invention, the respiratory disease can be chronic obstructive pulmonary disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, cough, sputum, bronchitis, bronchiolitis, sore throat, tonsillitis or laryngitis, and fibrosis can be selected from idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary fibrosis, cardiac fibrosis and radiation-induced fibrosis, but the present invention is not limited thereto. In the present invention, radiation-induced fibrosis is a side effect often caused by radiotherapy commonly used to treat cancer, tumors, etc., and the term "radiation-induced fibrosis" can be used interchangeably with the term "radiation fibrosis syndrome (RFS)".

[0135] For administration, in addition to the above-mentioned active ingredients, the composition of the present invention can further contain one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers should be compatible with the active ingredient, and can be selected from physiological saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and a mixture of two or more thereof. If necessary, the composition can contain other conventional additives, such as antioxidants, buffers or antibacterial agents. In addition, diluents, dispersants, surfactants, adhesives and lubricants can be added to the composition to prepare injectable formulations (such as aqueous solutions, suspensions and emulsions). In particular, the composition is preferably provided as a lyophilized formulation. In order to prepare a lyophilized formulation, conventional methods known in the art of the present invention can be used, and a stabilizer for lyophilization can also be added. In addition, the composition can preferably be prepared according to various diseases or components by suitable methods known in the art or by methods disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.

[0136] The dosage of the composition of the present invention can be determined by those skilled in the art based on the patient's condition and the severity of the disease. In addition, the composition can be formulated into various dosage forms, including powders, tablets, capsules, liquids, injection solutions, ointments and syrup formulations, and can be provided in unit dose or multi-dose containers (e.g., sealed ampoules or vials).

[0137] Compositions of the present invention can be administered orally or parenterally. Compositions according to the present invention can be administered, for example, orally, via inhalation, intravenously, intramuscularly, intraarterially, intramedullary, intradurally, intracardially, transdermally, subcutaneously, intraperitoneally, intrarectally, sublingually or topically, but are not limited thereto. In particular, compositions can also be administered in the lungs to treat respiratory diseases by intrabronchial instillation. The dosage of compositions according to the present invention can vary according to patient's weight, age, sex, health status and diet, duration of administration, mode of administration, excretion rate, severity of disease, etc., and can be easily determined by those skilled in the art. In addition, for clinical administration, compositions of the present invention can be prepared into suitable formulations using known technology.

[0138] In another aspect, the present invention relates to a lyophilized formulation comprising the pharmaceutical composition according to the present invention.

[0139] In still another aspect, the present invention relates to a method for preventing or treating fibrosis or respiratory diseases, comprising the step of administering a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases according to the present invention to a subject in need of prevention or treatment of fibrosis or respiratory diseases.

[0140] In the present invention, the respiratory disease may be chronic obstructive pulmonary disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, cough, sputum, bronchitis, bronchiolitis, sore throat, tonsillitis or laryngitis, and the fibrosis may be selected from idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary fibrosis, cardiac fibrosis and radiation-induced fibrosis, but the present invention is not limited thereto.

[0141] In yet another aspect, the present invention relates to providing a double-stranded oligonucleotide, a double-stranded oligonucleotide structure comprising the same, and a nanoparticle comprising the double-stranded oligonucleotide structure for use in a method for preventing or treating fibrosis or respiratory diseases.

[0142] In still yet another aspect, the present invention relates to a pharmaceutical composition for use in a method for preventing or treating fibrosis or respiratory diseases.

[0143] In another aspect, the present invention relates to use of the double-stranded oligonucleotide, the double-stranded oligonucleotide structure comprising the same, and the nanoparticle comprising the double-stranded oligonucleotide structure for manufacturing a drug for preventing or treating fibrosis or respiratory diseases.

[0144] Specifically, the present invention includes but is not limited to the following:

[0145] 1. A double-stranded oligonucleotide specific for amphiregulin, comprising a sense strand and an antisense strand, wherein the sense strand comprises any one sequence selected from SEQ ID NO: 10, 11 and 12, and the antisense strand comprises a sequence complementary thereto.

[0146] 2. The amphiregulin-specific double-stranded oligonucleotide according to item 1, wherein the sense strand or the antisense strand consists of 19 to 31 nucleotides.

[0147] 3. The amphiregulin-specific double-stranded oligonucleotide according to item 1, wherein the oligonucleotide is siRNA, shRNA or miRNA.

[0148] 4. The double-stranded oligonucleotide specific for amphiregulin according to item 1, wherein the sense or antisense strand is independently DNA or RNA.

[0149] 5. The amphiregulin-specific double-stranded oligonucleotide according to item 1, wherein the sense strand or the antisense strand of the double-stranded oligonucleotide comprises a chemical modification.

[0150] 6. The amphiregulin-specific double-stranded oligonucleotide according to item 5, wherein the chemical modification is selected from any one or more of the following:

[0151] wherein the hydroxyl (OH) group at the 2' carbon position of the sugar structure in the nucleotide is substituted by any one selected from -CH3 (methyl), -OCH3 (methoxy), amine (-NH2), fluorine (-F), -O-2-methoxyethyl, -O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido and -O-dimethylamidooxyethyl;

[0152] A modification in which the oxygen in the sugar structure of the nucleotide is replaced by sulfur;

[0153] Modifying the bond between nucleotides to any one selected from the group consisting of a phosphorothioate bond, a boranephosphonate bond, and a methylphosphonate bond; and

[0154] Modifications are PNA (peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic acid).

[0155] 7. The amphiregulin-specific double-stranded oligonucleotide according to item 1, wherein one or more phosphate groups are bound to the 5′ end of the antisense strand of the double-stranded oligonucleotide.

[0156] 8. A double-stranded oligonucleotide structure specific for amphiregulin, comprising a structure represented by the following structural formula 1:

[0157] [Structural formula (1)]

[0158] AXRYB

[0159] wherein A represents a hydrophilic compound, B represents a hydrophobic compound, X and Y each independently represent a simple covalent bond or a linker-mediated covalent bond, and R represents a double-stranded oligonucleotide according to any one of items 1 to 7.

[0160] 9. The amphiregulin-specific double-stranded oligonucleotide structure according to item 8, wherein the oligonucleotide structure comprises a structure represented by the following structural formula (2):

[0161] [Structural formula (2)]

[0162]

[0163] wherein S and AS represent the sense strand and antisense strand of the double-stranded oligonucleotide according to item 8, respectively.

[0164] 10. The amphiregulin-specific double-stranded oligonucleotide structure according to item 9, wherein the oligonucleotide structure comprises a structure represented by the following structural formula (3) or (4):

[0165] [Structural formula (3)]

[0166]

[0167] [Structural formula (4)]

[0168]

[0169] wherein A, B, X, Y, S and AS are as defined in item 9, and 5' and 3' respectively represent the 5' end and 3' end of the sense strand of the double-stranded oligonucleotide.

[0170] 11. The amphiregulin-specific double-stranded oligonucleotide structure according to item 8, wherein the hydrophilic compound is selected from polyethylene glycol (PEG), polyvinyl pyrrolidone and polyoxazoline.

[0171] 12. The amphiregulin-specific double-stranded oligonucleotide structure according to item 8, wherein the hydrophilic compound has a structure represented by the following structural formula (5) or (6):

[0172] [Structural formula (5)]

[0173] (A' m -J) n

[0174] [Structural formula (6)]

[0175] (J-A' m ) n

[0176] wherein A' represents a hydrophilic monomer, J represents a linker that connects multiple (m) hydrophilic monomers together or connects multiple (m) hydrophilic monomers to the double-stranded oligonucleotide, m is an integer ranging from 1 to 15, n is an integer ranging from 1 to 10, the hydrophilic monomer (A') is any one compound selected from the following compounds (1) to (3), and the linker (J) is selected from -PO3 - -, -SO3- and -CO2-:

[0177] Compound (1)

[0178]

[0179] wherein G is selected from O, S and NH;

[0180] Compound (2)

[0181]

[0182] Compound (3)

[0183]

[0184] 13. The amphiregulin-specific double-stranded oligonucleotide structure according to item 12, wherein the oligonucleotide structure has a structure represented by the following structural formula (7) or (8):

[0185] [Structural formula (7)]

[0186] (A' m -J) n -XRYB

[0187] [Structural formula (8)]

[0188] (J-A' m ) n -XRYB

[0189] 14. The amphiregulin-specific double-stranded oligonucleotide structure according to item 8, wherein the molecular weight of the hydrophilic compound is 200 to 10,000.

[0190] 15. The amphiregulin-specific double-stranded oligonucleotide structure according to item 8, wherein the molecular weight of the hydrophobic compound is 250 to 1,000.

[0191] 16. The double-stranded oligonucleotide structure specific for amphiregulin according to item 15, wherein the hydrophobic compound is selected from steroid derivatives, glycerol ester derivatives, glycerol ethers, polypropylene glycol, C 12 -C 50 Any of unsaturated or saturated hydrocarbons, diacylphosphatidylcholines, fatty acids, phospholipids, lipopolyamines, lipids, tocopherols and tocotrienols.

[0192] 17. The amphiregulin-specific double-stranded oligonucleotide structure according to item 16, wherein the steroid derivative is any one selected from cholesterol, cholestanol, cholic acid, cholesteryl formate, cholesteryl formate and cholesteryl amine.

[0193] 18. The amphiregulin-specific double-stranded oligonucleotide structure according to item 16, wherein the glyceride derivative is any one selected from monoglyceride, diglyceride and triglyceride.

[0194] 19. The amphiregulin-specific double-stranded oligonucleotide structure according to item 8, wherein the covalent bond represented by X and Y is a non-degradable bond or a degradable bond.

[0195] 20. The amphiregulin-specific double-stranded oligonucleotide structure according to item 19, wherein the non-degradable bond is an amide bond or a phosphate bond.

[0196] 21. The amphiregulin-specific double-stranded oligonucleotide structure according to item 19, wherein the degradable bond is any one selected from a disulfide bond, an acid-degradable bond, an ester bond, an anhydride bond, a biodegradable bond or an enzyme-degradable bond.

[0197] 22. A nanoparticle comprising a double-stranded oligonucleotide according to any one of items 8 to 21.

[0198] 23. A nanoparticle according to item 22, wherein the nanoparticle is composed of a mixture of double-stranded oligonucleotide structures comprising double-stranded oligonucleotides having different sequences.

[0199] 24. A pharmaceutical composition for preventing or treating fibrosis or respiratory diseases, comprising as an active ingredient a double-stranded oligonucleotide according to any one of items 1 to 7 or a double-stranded oligonucleotide structure according to any one of items 8 to 21.

[0200] 25. A pharmaceutical composition for preventing or treating fibrosis or respiratory diseases, comprising the nanoparticles according to item 22 as an active ingredient.

[0201] 26. A pharmaceutical composition according to item 24, wherein the respiratory disease is any one selected from chronic obstructive pulmonary disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, cough, sputum, bronchitis, bronchiolitis, sore throat, tonsillitis and laryngitis.

[0202] 27. A pharmaceutical composition according to item 24, wherein the fibrosis is any one selected from idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.

[0203] 28. A pharmaceutical composition according to item 25, wherein the respiratory disease is any one selected from chronic obstructive pulmonary disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, cough, sputum, bronchitis, bronchiolitis, sore throat, tonsillitis and laryngitis.

[0204] 29. A pharmaceutical composition according to claim 25, wherein the fibrosis is any one selected from idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.

[0205] 30. A lyophilized formulation comprising the pharmaceutical composition for preventing or treating fibrosis or respiratory diseases according to item 24.

[0206] 31. A lyophilized formulation comprising the pharmaceutical composition for preventing or treating fibrosis or respiratory diseases according to item 25. BRIEF DESCRIPTION OF THE DRAWINGS

[0207] Figure 1 Shown are the results of screening 1,257 SAMiRNAs targeting human amphiregulin.

[0208] Figure 2 Nanoparticle size distribution of double-stranded DNA / RNA hybrids containing selected amphiregulin-specific double-stranded oligonucleotides is shown: (a): SAMi-AREG#10, (b): SAMi-AREG#11, and (c): SAMi-AREG#12.

[0209] Figure 3 The results of quantitative analysis of the mRNA expression level of amphiregulin in Example 4 are shown, and a graph showing the relative mRNA expression level (%) of amphiregulin in the lung cancer cell line A549 having different concentrations (200 and 600 nM) of SAMiRNA having each sequence of SEQ ID NO: 1 to 14 of the present invention as a sense chain is depicted.

[0210] Figure 4 The results of quantitative analysis of the expression level of amphiregulin mRNA in Example 5 are shown, and graphs showing the relative mRNA expression level (%) of amphiregulin in the lung cancer cell line A549 ( Figure 4 (a)) and determining the IC of SAMiRNA in the lung cancer cell lines 50 value( Figure 4 (b) ) The lung cancer cell lines were treated with different concentrations (12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, 600 nM and 1,200 nM) of the SAMiRNA having the sequence of SEQ ID NO: 10 of the present invention as the sense strand.

[0211] Figure 5 The results of quantitative analysis of the expression level of amphiregulin mRNA in Example 5 are shown, and graphs showing the relative expression level (%) of amphiregulin mRNA in lung cancer cell line A549 ( Figure 5 (a)) and determining the IC of SAMiRNA in the lung cancer cell lines 50 value( Figure 5(b)) is a graph showing the results of treating lung cancer cell lines with SAMiRNA having the sequence of SEQ ID NO: 11 of the present invention as a sense strand at different concentrations (12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, 600 nM and 1,200 nM).

[0212] Figure 6 The results of quantitative analysis of the expression level of amphiregulin mRNA in Example 5 are shown, and graphs showing the relative expression level (%) of amphiregulin mRNA in lung cancer cell line A549 ( Figure 6 (a)) and determining the IC of SAMiRNA in the lung cancer cell lines 50 value( Figure 6 (b)) is a graph showing the results of treating lung cancer cell lines with SAMiRNA having the sequence of SEQ ID NO: 12 of the present invention as a sense strand at different concentrations (12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, 600 nM and 1,200 nM).

[0213] Figure 7 The results of the innate immune response test for the amphiregulin candidate sequence in Example 6 are shown, and the results obtained by treating human peripheral blood mononuclear cells (PBMCs) with 2.5 μM amphiregulin-specific SAMiRNAs having each of the sequences of SEQ ID NO: 10 (AR-1), 11 (AR-2), and 12 (AR-3) of the present invention as sense strands, analyzing the relative increase in the mRNA expression level of innate immunity-related cytokines by amphiregulin-specific SAMiRNAs, and evaluating in vitro cytotoxicity using human peripheral blood mononuclear cells are described. (a): DNA / RNA hybrid SAMiRNA, and (b): RNA / RNA hybrid SAMiRNA.

[0214] Figure 8 The results of quantitative analysis of the mRNA expression level of amphiregulin in Example 7 are shown, and are graphs comparing the relative mRNA expression levels (%) of amphiregulin caused by double-stranded oligo DNA / RNA hybrids and RNA / RNA hybrids each containing a selected amphiregulin-specific SAMiRNA. That is, Figure 8 is a graph comparing the mRNA expression levels of amphiregulin in the lung cancer cell line A549, which was treated with different concentrations (200 nM, 600 nM and 1,200 nM) of SAMiRNA having each of the sequences of SEQ ID NO: 10 (AR-1), 11 (AR-2) and 12 (AR-3) of the present invention as a sense chain.

[0215] Fig. 9 The results of screening 237 SAMiRNAs targeting mouse amphiregulin are shown ( Fig. 9 (a)), and the 9 candidate sequences selected from them ( Fig. 9 (b)).

[0216] Fig.10 A shows the results of quantitative analysis of the mRNA expression level of mouse amphiregulin in Example 8, and is a graph showing the relative mRNA expression level (%) of amphiregulin in the mouse lung fibroblast cell line MLg, which was treated with different concentrations (200 and 500 nM) of SAMiRNA having each sequence in SEQ ID NO: 19, 20 and 21 of the present invention as the sense chain.

[0217] Fig.10 B shows the results of quantitative analysis of the mRNA expression level of mouse amphiregulin in Example 8, and is a graph showing the relative mRNA expression level (%) of amphiregulin in the mouse lung epithelial cell line LA-4, which was treated with different concentrations (200, 500 and 1000 nM) of SAMiRNA having each sequence in SEQ ID NO: 19, 20 and 21 of the present invention as the sense chain.

[0218] Fig.11 Depicted are graphs showing the results of lung tissue staining and the relative mRNA expression levels (%) of target genes and fibrosis marker genes after intravenous administration of 1 mg / kg and 5 mg / kg of SAMiRNA-AREG#20 to mice with silica-induced pulmonary fibrosis in Example 9.

[0219] Fig.12 Depicted are graphs showing the results of lung tissue staining and the relative mRNA expression levels (%) of target genes and fibrosis marker genes after intravenous administration of 5 mg / kg of SAMiRNA-AREG#20 to mice with bleomycin-induced pulmonary fibrosis in Example 10.

[0220] Fig.13 Depicted are graphs showing the relative mRNA expression levels (%) of target genes, fibrosis marker genes, and inflammatory marker genes in renal tissues after intravenous administration of 1 mg / kg and 5 mg / kg of SAMiRNA-AREG#20 to UUO model mice subjected to UUO surgery in Example 11. DETAILED DESCRIPTION

[0221] Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are only used to explain the present invention in more detail, and the scope of the present invention is not limited by these embodiments. Therefore, the essential scope of the present invention will be limited by the appended claims and their equivalents.

[0222] In the present invention, three specific sequences capable of inhibiting the expression of amphiregulin were identified, and it was confirmed that these sequences can complementarily bind to mRNA encoding amphiregulin and effectively inhibit the expression of amphiregulin, thereby effectively treating fibrosis and respiratory diseases.

[0223] Example 1. Algorithm for screening SAMiRNA targeting amphiregulin and selection of candidate sequences

[0224] SAMiRNA-based drug high-throughput screening is a method in which all possible candidate sequences are generated by applying a 1-base or 2-base sliding window algorithm to the entire mRNA, unnecessary candidate sequences are removed by performing homology filtering, and the extent to which the expression of the gene of interest is inhibited by all the finally selected SAMiRNAs is determined.

[0225] First, a design process of SAMiRNA candidate sequences for amphiregulin was performed. Specifically, by applying a 1-base sliding window algorithm to human amphiregulin mRNA NM_001657.3 (1,290 bp), 1,257 SAMiRNA candidate sequences each consisting of 19 nucleotides were selected, and experiments on the degree of inhibition of amphiregulin were performed.

[0226] Example 2. Synthesis of double-stranded oligo RNA structures

[0227] The double-stranded oligo RNA structure (SAMiRNA) produced in the present invention is represented by the following structural formula:

[0228] C 24 -5'S3'-(hexaethylene glycol-PO4 - )3-Hexaethylene glycol

[0229] AS 5'-PO4

[0230] In order to synthesize the sense strain of the monoSAMiRNA (n = 4) double-stranded oligonucleotide structure, 3,4,6-triacetyl-1-hexa(ethylene glycol)-N-acetylgalactosamine-CPG was used as a support, and three demethoxytrityl (DMT) hexaethylene glycol phosphoramidates as hydrophilic monomers were continuously bound to the support by reaction. Next, RNA or DNA was synthesized, and then the hydrophobic C containing disulfide bonds was added. 24 (C6-SSC 18) was bound to the 5' terminal region to synthesize the sense strand of monoSAMiRNA (n=4), in which NAG-hexaethylene glycol-(-PO3 - Hexaethylene glycol) 3 is bound to the 3' end, and C 24 (C6-SSC 18 ) bound to the 5' end.

[0231] After the synthesis is completed, the RNA single strand and oligo (DNA or RNA)-polymer structure synthesized are separated from CPG by 28% (v / v) ammonia treatment in a 60°C water bath, and then the protective residue is removed by deprotection reaction. After the protective residue is removed, the RNA single strand and oligo (DNA or RNA)-polymer structure are treated with N-methylpyrrolidone, trimethylamine and triethylamine trihydrofluoride in a volume ratio of 10:3:4 in a 70°C baking oven to remove 2′-TBDMS (tert-butyldimethylsilyl). RNA single strand, oligo (DNA or RNA)-polymer structure and ligand-bound oligo (DNA or RNA)-polymer structure are separated from the reaction product by high performance liquid chromatography (HPLC), and its molecular weight is measured by MALDI-TOF mass spectrophotometer (MALDI TOF-MS, SHIMADZU, Japan) to confirm whether they match the nucleotide sequence and polymer structure desired to be synthesized. Thereafter, to produce each double-stranded oligonucleotide structure, the sense strand and the antisense strand were mixed together, added to 1X annealing buffer (30 mM HEPES, 100 mM potassium acetate, 2 mM magnesium acetate, pH 7.0 to 7.5), allowed to react in a 90°C water bath for 3 minutes, and then allowed to react at 37°C, thereby producing the desired SAMiRNA. Annealing of the produced double-stranded oligo RNA structure was confirmed by electrophoresis.

[0232] Example 3. High-throughput screening (HTS) of SAMiRNA nanoparticles targeting human amphiregulin and inducing RNAi

[0233] 3-1 Production of SAMiRNA Nanoparticles

[0234] The 1,257 SAMiRNAs targeting the amphiregulin sequence synthesized in Example 2 were dissolved in 1X Dulbecco's phosphate buffered saline (DPBS) (WELGENE, KR) and freeze-dried in a freeze dryer (LGJ-100F, CN) for 5 days. The freeze-dried nanoparticle powder was dissolved in 1.429 ml of deionized distilled water (Bioneer, KR) and homogenized and used in the experiments of the present invention.

[0235] 3-2 Treatment of cells with SAMiRNA nanoparticles

[0236] To identify SAMiRNAs that inhibit amphiregulin expression, the human lung cancer cell line A549 was used. A549 cells were cultured in Gibco TM Ham's F-12K (Kaighn) medium (Thermo, US) was cultured at 37°C under 5% CO2. A549 cells were cultured at 2×10 4 The density of cells / well was distributed into 96-well plates (Costar, US). The next day, the SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1X DPBS, and the cells were treated with the diluent to a SAMiRNA concentration of 500nM or 1,000nM. A total of four treatments (once every 12 hours) with SAMiRNA were performed, and the cells were cultured at 37°C under 5% CO2.

[0237] 3-3 Screening of SAMiRNA by Inhibition Analysis of Human Amphiregulin mRNA Expression

[0238] Total RNA was extracted from the cell line treated with SAMiRNA in Example 3-2 and synthesized into cDNA, and then the relative mRNA expression level of the amphiregulin gene was quantified by real-time PCR.

[0239] To analyze the mRNA expression level of amphiregulin gene, 300 nM AREG forward primer, 300 nM AREG reverse primer, 300 nM AREG probe, 300 nM RPL13A forward primer, 300 nM RPL13A reverse primer, 300 nM RPL13A probe, 400 nM TBP forward primer, 400 nM TBP reverse primer, and 300 nM TBP probe were added to the culture medium. Dual-HotStart RT-qPCR kit (Bioneer, South Korea) was added to each well and dried (Table 2, sequences of primers and hydrolysis probes used in high throughput screening (HTS) experiments). In order to evaluate the performance of the prepared kit, a calibration curve was created using total RNA from A549 cells, and the PCR amplification efficiency was determined (Table 3). RT-qPCR was performed under the following conditions: 95°C for 5 minutes, and then 45 cycles, each cycle consisting of 95°C for 5 seconds and 58°C for 15 seconds. A protocol for detecting fluorescence values ​​in each cycle was used.

[0240] Based on the use of the automation system Korean ExiStation HT TM An automated procedure and individually prepared kit containing primers and probes for the analysis of amphiregulin SAMiRNA-treated 96-well plates (Costar, US) were subjected to total RNA extraction and one-step RT-qPCR using Dual-HotStart RT-qPCR Kit (Bioneer, Korea).

[0241] Based on the Ct values ​​of the two genes obtained after qPCR array, the relative mRNA expression levels of amphiregulin in the test group compared with amphiregulin in the control group were analyzed by the 2(-ΔΔC(T)) method [Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. December; 25(4): 4 02-8].

[0242] [Table 2] Sequences of primers and hydrolysis probes used in high throughput screening (HTS) experiments

[0243]

[0244] [Table 3] 3-plex RT-qPCR amplification efficiency

[0245] Slope <![CDATA[R 2 ]]> efficiency AREG Y=-0.2778X+12.3894 0.9998 90％ RPL13A Y=-0.2863X+10.5964 0.9999 93％ TBP Y=-0.2892X+13.0351 0.9946 95％

[0246] In order to select highly efficient SAMiRNA, 14 SAMiRNAs were selected having each of the sequences in SEQ ID NOs: 1 to 14 as sense strands. Here, the selected SAMiRNAs showed the highest efficiency, wherein the mRNA expression level of amphiregulin was reduced at a final concentration of 500 nM or 1,000 nM compared to the control.

[0247] like Figure 1 As shown, 14 SAMiRNAs that most effectively inhibited the expression of the amphiregulin gene were finally selected from 1,257 SAMiRNAs targeting amphiregulin. Information on the sequences of the selected SAMiRNAs is shown in Table 4 below.

[0248] [Table 4] Amphiregulin-specific SAMiRNA candidate sequences selected by 1-base sliding window screening and high-throughput screening (HTS)

[0249]

[0250]

[0251] Example 4. Screening of SAMiRNA Nanoparticles Targeting Human Amphiregulin and Inducing RNAi

[0252] The lung cancer cell line A549 was treated with SAMiRNA having each sequence of SEQ ID NOs: 1 to 14 as a sense strand (selected in Example 3), and the expression pattern of amphiregulin mRNA in the cell line was analyzed.

[0253] 4-1 Treatment of cells with SAMiRNA nanoparticles

[0254] To identify SAMiRNAs that inhibit amphiregulin expression, the human lung cancer cell line A549 was used. A549 cells were cultured in Gibco TM Ham's F-12K (Kaighn) medium (Thermo, US) was cultured at 37°C under 5% CO2. A549 cells were cultured at 8×10 4 The density of cells / well was distributed into 12-well plates (Costar, US). The next day, the SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1X DPBS, and the cells were treated with the diluent to a SAMiRNA concentration of 200nM or 600nM. A total of four treatments (once every 12 hours) with SAMiRNA were performed, and the cells were cultured at 37°C under 5% CO2.

[0255] 4-2 Screening of SAMiRNA by Inhibition Analysis of Human Amphiregulin mRNA Expression

[0256] Total RNA was extracted from the cell line treated with SAMiRNA in Example 4-1 and synthesized into cDNA, and then the relative mRNA expression level of the amphiregulin gene was quantified by real-time PCR.

[0257] 4-2-1 Isolation of RNA from SAMiRNA-treated cells and cDNA synthesis

[0258] Total RNA was extracted from the cell line treated with SAMiRNA in Example 4-1 using an RNA extraction kit (AccuPrep Total RNA Extraction Kit, BIONEER, Korea). RNA reverse transcriptase (with oligo(dT)20 (Bioneer, Korea)) was used. RocketScript TMThe extracted RNA was synthesized into cDNA using Cycle RT Premix as follows. Specifically, 1 μg of the extracted RNA was added to a 0.25 ml Eppendorf tube containing oligo(dT)20 (Bioneer, Korea). RocketScript TM Cycle RT Premix, and distilled water treated with DEPC (diethylpyrocarbonate) was added thereto to a total volume of 20 μl. TM 96 Gradient Thermal Block, BIONEER, Korea), the process of hybridizing RNA with primers at 37°C for 30 seconds and synthesizing cDNA at 48°C for 4 minutes was repeated 12 times. Then, the amplification reaction was terminated by inactivating the enzyme at 95°C for 5 minutes.

[0259] Quantitative analysis of relative mRNA expression levels of 4-2-2 human amphiregulin mRNA

[0260] Using the cDNA synthesized in Example 4-2-1 as a template, SYBR Green real-time qPCR was performed, and the relative mRNA expression level of amphiregulin compared to the SAMiRNA control sample was analyzed in the following manner. The cDNA synthesized in Example 4-2-1 above was diluted 5 times with distilled water, and in order to analyze the mRNA expression level of amphiregulin, 3 μl of the diluted cDNA, 25 μl 2XGreenStar TM qPCR MasterMix (BIONEER, Korea), 19 μl of distilled water and 3 μl of amphiregulin qPCR primers (SEQ ID NOs: 17 and 18 (Table 5); 10 pmol / μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to prepare a mixture. At the same time, GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (a housekeeping gene (hereinafter referred to as HK gene)) was used as a standard gene for normalizing the mRNA expression level of amphiregulin. Exicycler TM Real-time quantitative thermal module (BIONEER, South Korea), the 96-well plate containing the mixture is subjected to the following reaction. Specifically, the mixture is allowed to react at 95°C for 15 minutes to activate the enzyme and remove the secondary structure of the cDNA, and then the mixture is subjected to 42 cycles, each cycle consisting of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, and SYBR green scanning, and finally extension at 72°C for 3 minutes. Next, the mixture is kept at a temperature of 55°C for 1 minute, and the melting curve from 55°C to 95°C is analyzed.

[0261] After PCR was completed, the Ct (threshold cycle) value of the target gene was corrected by the GAPDH gene, and then the ΔCt value was calculated using a control treated with a control sequence SAMiRNA (SAMiCONT) that does not induce gene expression inhibition. The relative expression level of the target gene in cells treated with amphiregulin-specific SAMiRNA was quantified using the ΔCt value and the equation 2 (-ΔCt) × 100.

[0262] In order to select highly efficient SAMiRNA, 14 SAMiRNAs were selected having each of the sequences in SEQ ID NOs: 10, 11, and 12 as sense strands. Here, the selected SAMiRNAs showed the highest efficiency, wherein the mRNA expression level of amphiregulin was reduced at a final concentration of 200 nM or 600 nM compared to the control.

[0263] like Figure 3 As shown, finally, three SAMiRNAs that most effectively inhibited the expression of the amphiregulin gene were selected from 14 SAMiRNAs targeting amphiregulin. Information on the sequences of the selected SAMiRNAs is shown in Table 6 below.

[0264] [Table 5] Information on primer sequences for qPCR

[0265] Primers sequence SEQ ID NO hGAPDH-F GGTGAAGGTCGGAGTCAACG 15 hGAPDH-R ACCATGTAGTTGAGGTCAATGAAGG 16 hAREG-F ACACCTACTCTGGGAAGCGT 17 hAREG-R GCCAGGTATTTGTGGTTCGT 18

[0266] (F represents forward primer, and R represents reverse primer)

[0267] [Table 6] SAMiRNA sequences that effectively inhibit amphiregulin expression

[0268] SEQ ID NO Code Name Location Sense strand sequence 10 SAMi-AREG#10 341-359 CACCTACTCTGGGAAGCGT 11 SAMi-AREG#11 342-360 ACCTACTCTGGGAAGCGTG 12 SAMi-AREG#12 349-367 CTGGGAAGCGTGAACCATT

[0269] Example 5. Inhibition of human amphiregulin expression in lung cancer cell line (A549) by selected SAMiRNA

[0270] The lung cancer cell line A549 was treated with SAMiRNA having each of the sequences in SEQ ID NO: 10, 11 and 12 as the sense strand (selected in Example 4), and the expression pattern of amphiregulin mRNA in the cell line was analyzed to determine the IC of SAMiRNA. 50 value.

[0271] 5-1 Production and Particle Size Analysis of SAMiRNA Nanoparticles

[0272] Each of the three SAMiRNAs targeting the double-modulated protein sequence synthesized in Example 2 was dissolved in 1X Dulbecco's phosphate buffered saline (DPBS) (WELGENE, KR) and freeze-dried in a freeze dryer (LGJ-100F, CN) for 5 days. The freeze-dried nanoparticle powder was dissolved in 2ml of deionized distilled water (Bioneer, KR) and homogenized and used in the experiments of the present invention. In order to analyze the particle size of the produced SAMiRNA nanoparticles, the size and polydispersity index of SAMiRNA were measured using Zetasizer Nano ZS (Malvern, UK). The measurement results of the size and polydispersity index of SAMiRNA nanoparticles are shown in Table 7 below and are graphically shown in Figure 2 Shown in.

[0273] [Table 7] Size and polydispersity index of amphiregulin-specific SAMiRNA nanoparticles

[0274] Code Name size PDI SAMi-AREG#10 103.9±3.8 0.406±0.065 SAMi-AREG#11 99.9±4.0 0.501±0.005 SAMi-AREG#12 170.1±7.5 0.457±0.084

[0275] 5-2 Treatment of cells with SAMiRNA nanoparticles

[0276] To evaluate the effects of the selected SAMiRNAs on the inhibition of amphiregulin expression, the human lung cancer cell line A549 was used. A549 cells were cultured in Gibco TM Ham's F-12K (Kaighn) medium (Thermo, US) was cultured at 37°C under 5% CO2. A549 cells were cultured at 8×10 4 The density of cells / well was distributed into 12-well plates (Costar, US). The next day, the SAMiRNA homogenized with deionized distilled water in Example 5.1 above was diluted with 1X DPBS, and the cells were treated with the diluent to a SAMiRNA concentration of 12.5nM, 25nM, 50nM, 100nM, 200nM, 600nM or 1200nM. Cells were treated with SAMiRNA for a total of four times (once every 12 hours), and the cells were cultured at 37°C in 5% CO2.

[0277] 5-3 Determination of the IC of SAMiRNA by Inhibition Analysis of Human Amphiregulin mRNA Expression 50

[0278] Total RNA was extracted from the cell line treated with SAMiRNA in Example 5-2 and synthesized into cDNA, and then the relative mRNA expression level of the amphiregulin gene was quantified by real-time PCR.

[0279] 5-3-1 Isolation of RNA from SAMiRNA-treated cells and cDNA synthesis

[0280] Total RNA was extracted from the cell line treated with SAMiRNA in Example 5-2 using an RNA extraction kit (AccuPrep Total RNA Extraction Kit, BIONEER, Korea). RNA reverse transcriptase (with oligo(dT)20 (Bioneer, Korea)) was used. RocketScript TM The extracted RNA was synthesized into cDNA using Cycle RT Premix as follows. Specifically, 1 μg of the extracted RNA was added to a 0.25 ml Eppendorf tube containing oligo(dT)20 (Bioneer, Korea). RocketScript TM Cycle RT Premix, and distilled water treated with DEPC (diethylpyrocarbonate) was added thereto to a total volume of 20 μl. TM 96 Gradient Thermal Block, BIONEER, Korea), the process of hybridizing RNA with primers at 37°C for 30 seconds and synthesizing cDNA at 48°C for 4 minutes was repeated 12 times. Then, the amplification reaction was terminated by inactivating the enzyme at 95°C for 5 minutes.

[0281] Quantitative analysis of relative mRNA expression levels of 5-3-2 human amphiregulin

[0282] Using the cDNA synthesized in Example 5-3-1 as a template, SYBR Green real-time qPCR was performed, and the relative mRNA expression level of amphiregulin compared to the SAMiRNA control sample was analyzed in the following manner. The cDNA synthesized in Example 5-3-1 above was diluted 5 times with distilled water, and in order to analyze the mRNA expression level of amphiregulin, 3 μl of the diluted cDNA, 25 μl 2XGreenStar TMqPCR MasterMix (BIONEER, Korea), 19 μl of distilled water and 3 μl of amphiregulin qPCR primers (SEQ ID NOs: 17 and 18 (Table 5); 10 pmol / μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to prepare a mixture. At the same time, GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (a housekeeping gene (hereinafter referred to as HK gene)) was used as a standard gene for normalizing the mRNA expression level of amphiregulin. Exicycler TM Real-time quantitative thermal module (BIONEER, South Korea), the 96-well plate containing the mixture is subjected to the following reaction. Specifically, the mixture is allowed to react at 95°C for 15 minutes to activate the enzyme and remove the secondary structure of the cDNA, and then the mixture is subjected to 42 cycles, each cycle consisting of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, and SYBR green scanning, and finally extension at 72°C for 3 minutes. Next, the mixture is kept at a temperature of 55°C for 1 minute, and the melting curve from 55°C to 95°C is analyzed.

[0283] After PCR was completed, the Ct (threshold cycle) value of the target gene corrected by the GAPDH gene was determined, and then the ΔCt value was calculated using a control treated with a control sequence SAMiRNA (SAMiCONT) that does not induce gene expression inhibition. The relative expression level of the target gene in cells treated with amphiregulin-specific SAMiRNA was quantified using the ΔCt value and the equation 2 (-ΔCt) × 100.

[0284] As a result, it was confirmed that all amphiregulin-specific SAMiRNAs having each of the sequences in SEQ ID NO: 10, 11, and 12 as sense strands showed a 50% or greater decrease in the mRNA expression level of amphiregulin even at a concentration of 100 nM, indicating that amphiregulin-specific SAMiRNAs exhibited an effect of inhibiting amphiregulin expression with high efficiency. IC 200 for amphiregulin-specific SAMiRNAs having the sequence of SEQ ID NO: 10 as a sense strand was confirmed. 50 Value Figure 4 As shown, it is 28.75 nM for the amphiregulin-specific SAMiRNA having the sequence of SEQ ID NO: 11 as the sense strand. Figure 5 As shown, it was 26.04 nM, and for the amphiregulin-specific SAMiRNA having the sequence of SEQ ID NO: 12 as the sense strand as shown Figure 6 In particular, it was confirmed that Figure 6As shown, even at a low concentration of 25 nM, the amphiregulin-specific SAMiRNA having the sequence of SEQ ID NO: 12 as the sense strand showed a 50% or more reduction in the mRNA expression level of amphiregulin, indicating that it exhibited the most effective effect of inhibiting amphiregulin gene expression among the three selected sequences.

[0285] Example 6. Evaluation of in vitro cytotoxicity using human peripheral blood mononuclear cells (PBMCs)

[0286] To examine whether the mRNA expression levels of innate immunity-related cytokines were increased by SAMi-hAREG, Cryopreserved human PBMC (human peripheral blood mononuclear cells, Cellular Technology Limited, USA) were cultured at 5 x 10 5 The cells were distributed into 12-well plates at a density of The plates contained 10% FBS (fetal bovine serum; Hyclone TM RPMI1640 (Hyclone TM ) medium. The cells were cultured in a 5% CO2 incubator at 37°C for 1 hour to stabilize them, and then the allocated PBMCs were treated with 2.5 μM of each of SAMi-CON (DNA / RNA), SAMi-hAREG#10 (DNA / RNA), SAMi-hAREG#11 (DNA / RNA), SAMi-hAREG#12 (DNA / RNA), SAMi-CON (RNA / RNA), SAMi-hAREG#10 (RNA / RNA), SAMi-hAREG#11 (RNA / RNA) and SAMi-hAREG#12 (RNA / RNA), and cultured in a 5% CO2 incubator at 37°C for 6 hours. As a positive control, 20 μg / ml concanavalin A (Sigma Aldrich, USA) was used.

[0287] Thereafter, all cells were harvested, and total RNA was extracted therefrom using RNeasy Mini Kit (Qiagen, Germany) and RNase-Free DNase Set (Qiagen, Germany) according to the manufacturer's protocol.

[0288] 200 ng of extracted RNA was mixed with deionized sterile DW (Bioneer, Korea) and RNA reverse transcriptase (with oligo(dT)20 (Bioneer, Korea)). RocketScript TMCycle RT Premix) and allows the use of gene amplification systems (MyGenie TM 96 Gradient Thermal Block, BIONEER, Korea) was reacted under the conditions of 12 cycles, each cycle consisting of 37°C for 30 seconds, 48°C for 4 min, and 55°C for 30 seconds and then 95°C for 5 min, thereby synthesizing a total of 20 μl of cDNA.

[0289] The synthesized cDNA was mixed with qPCR primers for each of the RPL13A, IL1B, IL6, IFNG, TNF, and IL12B genes, and then PCR was performed using an Exicycler TM Amplification was performed using a 96 real-time quantitative calorimeter module (Bioneer, Korea) under the following conditions: 95°C for 5 min, and then 45 cycles, each cycle consisting of 95°C for 5 sec and 58°C for 15 sec.

[0290] Based on the Ct values ​​of the two genes obtained after qPCR array, the relative mRNA expression levels in the test group compared with the control group were analyzed by the 2(-ΔΔC(T)) method [Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. December; 25(4): 4 02-8].

[0291] The result is that Figure 7 As shown, it was confirmed that the expression of innate immunity-related cytokines in human peripheral blood mononuclear cells (human PBMCs) caused by each of amphiregulin-specific SAMiRNA #10, SAMiRNA #11, and SAMiRNA #12 was not observed.

[0292] Example 7. Comparative analysis of the inhibition of human amphiregulin expression by DNA / RNA hybrid and RNA / RNA hybrid SAMiRNAs containing each selected sequence in SEQ ID NO: 10, 11 and 12 as the sense strand

[0293] The lung cancer cell line A549 was treated with each double-stranded DNA / RNA hybrid and RNA / RNA hybrid containing amphiregulin-specific SAMiRNA having each sequence of SEQ ID NO: 10, 11 and 12 as a sense strand (selected in Example 4), and the relative mRNA expression level (%) of amphiregulin in the cell line was analyzed.

[0294] 7-1 Treatment of cells with SAMiRNA nanoparticles

[0295] To identify SAMiRNAs that inhibit amphiregulin expression, the human lung cancer cell line A549 was used. A549 cells were cultured in Gibco TM Ham's F-12K (Kaighn) medium (Thermo, US) was cultured at 37°C under 5% CO2. A549 cells were cultured at 8×10 4 The density of cells / well was distributed into 12-well plates (Costar, US). The next day, the SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1X DPBS, and the cells were treated with the diluent to a SAMiRNA concentration of 200nM, 600nM or 1200nM. Cells were treated with SAMiRNA for a total of four times (once every 12 hours), and the cells were cultured at 37°C in 5% CO2.

[0296] 7-2 Screening of SAMiRNA by Inhibition Analysis of Human Amphiregulin mRNA Expression

[0297] Total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 and synthesized into cDNA, and then the relative mRNA expression level of the amphiregulin gene was quantified by real-time PCR.

[0298] 7-2-1 Isolation of RNA from SAMiRNA-treated cells and cDNA synthesis

[0299] Total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 using an RNA extraction kit (AccuPrep Total RNA Extraction Kit, BIONEER, Korea). RNA reverse transcriptase (with oligo(dT)20 (Bioneer, Korea)) was used. RocketScript TM The extracted RNA was synthesized into cDNA using Cycle RT Premix as follows. Specifically, 1 μg of the extracted RNA was added to a 0.25 ml Eppendorf tube containing oligo(dT)20 (Bioneer, Korea). RocketScript TMCycle RT Premix, and distilled water treated with DEPC (diethylpyrocarbonate) was added thereto to a total volume of 20 μl. TM 96 Gradient Thermal Block, BIONEER, Korea), the process of hybridizing RNA with primers at 37°C for 30 seconds and synthesizing cDNA at 48°C for 4 minutes was repeated 12 times. Then, the amplification reaction was terminated by inactivating the enzyme at 95°C for 5 minutes.

[0300] Quantitative analysis of relative mRNA expression levels of human amphiregulin 7-2-2

[0301] Using the cDNA synthesized in Example 7-2-1 as a template, SYBR green real-time qPCR was performed, and the relative mRNA expression level of amphiregulin compared to the SAMiRNA control sample was analyzed in the following manner. The cDNA synthesized in Example 7-2-1 above was diluted 5 times with distilled water, and in order to analyze the mRNA expression level of amphiregulin, 3 μl of the diluted cDNA, 25 μl 2XGreenStar TM qPCR MasterMix (BIONEER, Korea), 19 μl of distilled water and 3 μl of amphiregulin qPCR primers (SEQ ID NOs: 17 and 18 (Table 5); 10 pmol / μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to prepare a mixture. At the same time, GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (a housekeeping gene (hereinafter referred to as HK gene)) was used as a standard gene for normalizing the mRNA expression level of amphiregulin. Exicycler TM Real-time quantitative thermal module (BIONEER, South Korea), the 96-well plate containing the mixture is subjected to the following reaction. Specifically, the mixture is allowed to react at 95°C for 15 minutes to activate the enzyme and remove the secondary structure of the cDNA, and then the mixture is subjected to 42 cycles, each cycle consisting of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, and SYBR green scanning, and finally extension at 72°C for 3 minutes. Next, the mixture is kept at a temperature of 55°C for 1 minute, and the melting curve from 55°C to 95°C is analyzed.

[0302] After PCR was completed, the Ct (threshold cycle) value of the target gene was corrected by the GAPDH gene, and then the ΔCt value was calculated using the control treated with the control sequence SAMiRNA (SAMiCONT) that does not induce gene expression inhibition. The relative expression level of the target gene was quantified using the ΔCt value and the equation 2 (-ΔCt) × 100.

[0303] In order to select highly efficient SAMiRNA from double-stranded DNA / RNA hybrids and RNA / RNA hybrids, a DNA / RNA hybrid SAMiRNA having a sequence of SEQ ID NO: 12 as a sense strand was finally selected. Here, the selected sequence DNA / RNA hybrid SAMiRNA (gene expression inhibition of 90% or more) showed the highest efficiency, wherein the mRNA expression level of amphiregulin was reduced at a final concentration of 200 nM, 600 nM or 1200 nM compared to the control.

[0304] like Figure 8 As shown, the DNA / RNA hybrid SAMiRNA 12 that most effectively inhibited the expression of the amphiregulin gene was finally selected from DNA / RNA and RNA / RNA hybrids containing three selected amphiregulin-specific SAMiRNAs, respectively.

[0305] Example 8. High-throughput screening (HTS) of SAMiRNA nanoparticles targeting mouse amphiregulin and inducing RNAi

[0306] In the case of siRNA therapeutic agents, it is difficult to identify the best sequence applicable to different strains. In this case, the U.S. FDA guidelines are applied, according to which a specific DNA sequence (alternative sequence; mouse gene-specific siRNA) is designed for the animal model for analyzing the therapeutic effect (in vivo efficacy test), so as to verify the pharmacological activity caused by suppressing the expression of a gene of interest and the toxicity caused by suppressing the expression of a gene of interest (presented by FDA / CDER pharmacology doctor / toxicology examiner Robert T.Dorsam).

[0307] The previously discovered screening has been modified by an existing algorithm-based siRNA program (Turbo-si-designer owned by the applicant company), and a high-throughput screening of siRNA sequences based on SAMiRNA was performed. A 1-base sliding window scan of 19-mer siRNA was performed for the entire target gene (the same method as the above-mentioned human amphiregulin target screening), and a total of 1,190 candidate siRNA sequences were generated for the possible mouse amphiregulin gene (NM_009704.4) complete transcript sequence. Blast sequence homology filtering was performed to remove unnecessary candidate sequences that affect the expression of other genes, and 237 final selected SAMiRNAs were synthesized. The mouse NIH3T3 cell line was treated with each selected SAMiRNA at a concentration of 1 μM in a cell culture medium containing 10% FBS, and the in vitro expression inhibition of SAMiRNA was first screened using the primers shown in Table 8 (primer sequence information for qPCR) ( Fig. 9).

[0308] Thereafter, the mouse lung fibroblast cell line MLg was treated with each of the two sequences (SEQ ID NOs: 19 and 20) selected in the NIH3T3 cell line and the mouse SAMiRNA-amphiregulin of SEQ ID NO: 21 discovered by a previous landmark study at a treatment concentration of 200 nM and 500 nM in a cell culture medium containing 10% FBS, and additional screening was performed. As a result, it was confirmed that SEQ ID NO: 20 exhibited the best expression inhibition effect ( Fig.10 A).

[0309] In addition, the mouse lung epithelial cell line LA-4 was treated with each of the two selected sequences (SEQ ID NOs: 19 and 20) and the mouse SAMiRNA-amphiregulin of SEQ ID NO: 21 discovered by a previous landmark study at treatment concentrations of 200 nM, 500 nM, and 1,000 nM in a cell culture medium containing 10% FBS, and the expression inhibition effect was additionally evaluated. As a result, it was confirmed again that SEQ ID NO: 20 exhibited the best expression inhibition effect ( Fig.10 B).

[0310] like Fig.10 As shown, two SAMiRNAs that most effectively inhibited the expression of the amphiregulin gene were finally selected from 237 SAMiRNAs targeting mouse amphiregulin, and the sequence information of the selected SAMiRNAs is shown in Table 9 below.

[0311] [Table 8] Primer sequence information for qPCR

[0312] Primers sequence mGAPDH-F AGGTCGGTGTGAACGGATTTG(SEQ ID NO:22) mGAPDH-R TGTAGACCATGTAGTTGAGGTCA SEQ ID NO:23) mAREG-F GAGGCTTCGACAAGAAAACG(SEQ ID NO:24) mAREG-R ACCAATGTCATTTCCGGTGT(SEQ ID NO:25)

[0313] (F represents forward primer, and R represents reverse primer)

[0314] [Table 9] SAMiRNA sequences that effectively inhibit mouse amphiregulin expression

[0315] SEQ ID NO Code Name Location Sense strand sequence 19 SAMi-mAREG#19 936-954 AACGGGACTGTGCATGCCA 20 SAMi-mAREG#20 937-955 ACGGGACTGTGCATGCCAT 21 SAMi-mAREG#21 1071-1089 CAGTTGTCACTTTTTATGA

[0316] Example 9. Study on the efficacy of SAMiRNA-mAREG administered intravenously in a silica-induced pulmonary fibrosis model

[0317] In order to analyze the efficacy of SAMi-mAREG in an animal model of pulmonary fibrosis induced by silica (Silicon Dioxide, SIGMA, South Korea), and experiments were performed. For the experiment, 7-week-old mice were obtained and allowed to adapt for 1 week. In order to induce the model, silica (3 mg) was dissolved and injected intratracheally into the mice. Three days after induction, mice showing no abnormal symptoms were selected and divided into a normal group, a test group given physiological buffered saline (PBS), a test group given SAMiRNA-control, and a test group (SAMi-mAREG#20) given three times at intervals of 2 days at 1 mg / kg and 5 mg / kg SAMi-mAREG#20. In addition, 14 days after model induction, mice were killed.

[0318] 9-1. Gene expression analysis of SAMiRNA in silica-induced pulmonary fibrosis animal model

[0319] Lung tissue was obtained from the sacrificed mice and crushed using a homogenizer. Total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 above using an RNA extraction kit (AccuPrep Cell Total RNA Extraction Kit, BIONEER, Korea). RNA reverse transcriptase (with oligo(dT)20 (Bioneer, Korea) was used. RocketScript TM The extracted RNA was synthesized into cDNA using the SYBR Green real-time qPCR (RT Premix) as follows. Using the synthesized cDNA as a template, SYBR Green real-time qPCR was performed, and the relative expression level of total RNA in the group was analyzed as follows. The synthesized cDNA was diluted 5 times with distilled water, and in order to analyze the mRNA expression level of amphiregulin, 3 μl of the diluted cDNA, 25 μl of 2X GreenStar TM qPCR MasterMix (BIONEER, Korea), 19 μl of distilled water and 3 μl of amphiregulin qPCR primers (SEQ ID NOs: 24 and 25 (Table 8); 10 pmol / μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to prepare a mixture. At the same time, RPL13A (housekeeping gene (hereinafter referred to as HK gene)) was used as a standard gene for normalizing the mRNA expression levels of amphiregulin, fibronectin, and collagen 3α1.

[0320] After PCR was completed, the Ct (threshold cycle) value of each target gene was corrected by the RPL13A gene, and then the ΔCt value between each group was calculated. The relative expression levels of amphiregulin, fibronectin and collagen 3α1 genes were quantified using the ΔCt value and the equation 2 (-ΔCt)×100.

[0321] As a result, it was confirmed that the expression of amphiregulin was decreased in the groups treated with 1 mg / kg SAMiRNA-AREG and 5 mg / kg SAMiRNA-AREG, respectively, compared with the silica-induced pulmonary fibrosis model group treated with physiological buffered saline and the silica-induced pulmonary fibrosis model group treated with SAMiRNA-control. In addition, it was confirmed that fibronectin and collagen 3α1 were decreased in a concentration-dependent manner in the groups treated with 1 mg / kg SAMiRNA-AREG and 5 mg / kg SAMiRNA-AREG, respectively, compared with the silica-induced pulmonary fibrosis model group treated with physiological buffered saline and the silica-induced pulmonary fibrosis model group treated with SAMiRNA-control.

[0322] 9-2. Histopathological analysis of SAMiRNA in the silica-induced pulmonary fibrosis animal model

[0323] To verify whether SAMiRNA-AREG for silica-induced pulmonary fibrosis model affects the expression of extracellular matrix components, immunohistochemical staining was performed. Each animal model group was sacrificed, and paraffin sections were prepared by tissue fixation, washing, dehydration, clearing, infiltration, embedding and cutting processes. The paraffin sections were sliced ​​thin with a slicer, and the tissues were fixed on glass slides. For pathological observation of lung tissue, hematopoietic and eosin (H&E) staining was performed, and Masson trichrome staining was performed to examine the expression level of collagen 3α1. In addition, immunohistochemical staining was performed to analyze the expression level of amphiregulin.

[0324] By hematoxylin and eosin staining, it can be seen that the pulmonary fibrosis tissue induced by silica is more damaged than the lung tissue of the normal group. However, it can be seen that, like the lung tissue of the normal group, the lung tissue of the mice given SAMiRNA-AREG has little damage. In addition, Masson trichrome staining was performed to examine the degree of fibrosis. It was confirmed that the degree of fibrosis of the lung tissue interstitial in the group given SAMiRNA-AREG was reduced compared with those in the lung tissue interstitial in the silica-induced pulmonary fibrosis model group given physiological buffered saline (PBS) and the group given SAMiRNA-control. In addition, by immunohistochemical staining of amphiregulin, it can be seen that in the silica-induced pulmonary fibrosis animal group, amphiregulin is expressed in large quantities in the interstitium between cells. However, it can be confirmed that in the group given SAMiRNA-AREG, the expression of AREG in the lung tissue interstitium is reduced.

[0325] In summary, 1 mg / kg and 5 mg / kg SAMiRNA-AREG were intravenously administered to silica-induced pulmonary fibrosis model mice three times (10th, 12th and 14th days), and the inhibitory effect of SAMiRNA-AREG on the expression of the target gene amphiregulin and fibrosis marker genes in lung tissue was evaluated, and H&E staining and Masson trichrome staining of lung tissue were performed. As a result of analyzing the expression of the target gene amphiregulin and the fibrosis marker genes collagen 3α1 and fibronectin, it was confirmed that the expression was increased by silica-induced pulmonary fibrosis, and the effect of inhibiting the expression in a concentration-dependent manner by treatment with SAMiRNA-AREG was confirmed. In addition, as a result of tissue staining, it was confirmed that in silica-induced pulmonary fibrosis mice treated with PBS or SAMiRNA-control, the infiltration of cells into the lung tissue and the expression of collagen increased, but in the test group treated with SAMiRNA-AREG, the cell infiltration and collagen were significantly reduced to a level comparable to that of the control group treated with DPBS ( Fig.11 ).

[0326] In addition, immunohistochemical staining of AREG was performed in the silica-induced pulmonary fibrosis model. Fig.11As shown, the expression level of AREG in the tissues of silica-induced pulmonary fibrosis model mice given 1 mg / kg and 5 mg / kg SAMiRNA-AREG was analyzed by IHC staining. It was confirmed that in the lung tissues of model mice given silica+PBS or silica+SAMi-control, the expression of AREG in the interstitial part was significantly increased compared with the expression of AREG in normal lung tissue. However, as a result of analyzing the expression of AREG in tissues given 1 mg / kg and 5 mg / kg SAMiRNA-AREG, it was confirmed that the expression of AREG in the tissues was significantly decreased compared with the expression of AREG in silica-induced pulmonary fibrosis tissues ( Fig.11 ).

[0327] Example 10. Study on the efficacy of SAMiRNA-mAREG in the bleomycin-induced pulmonary fibrosis model by intravenous administration

[0328] 5mg / kg SAMiRNA-AREG (SAMi-mAREG#20) was intravenously administered to the bleomycin-induced pulmonary fibrosis mouse model three times (the 8th, 10th and 12th day), and Sircol was determined. As a result, it was confirmed that the amount of collagen in the test group given SAMiRNA-AREG was reduced by>40% compared with the amount of collagen in the control group SAMiRNA-control. In addition, RNA was extracted from the lung tissue of the same test group, and the effect of suppressing the expression of the target gene amphiregulin and the fibrosis marker gene collagen 3α1 was analyzed. As a result, the expression inhibition compared with the control was found. It was confirmed that the effect of the test substance of the newly identified SEQ IDNO:20 was equal to or higher than the effect of the existing sequence. H&E staining of lung tissue and collagen 3α1-specific Masson trichrome staining of lung tissue were performed. As a result of tissue staining, it was confirmed that in the bleomycin-induced pulmonary fibrosis mouse group treated with PBS or SAMiRNA-control, the infiltration of cells into the lung tissue increased, and due to collagen accumulation, staining increased. It was confirmed that in the test group treated with SAMiRNA-AREG, cell infiltration and collagen accumulation were significantly reduced ( Fig.12 ). In the same manner as in Example 8, tissue staining and analysis of target gene expression were performed.

[0329] Example 11. Evaluation of the effect of SAMiRNA-AREG on renal fibrosis induced by UUO (unilateral ureteral obstruction) in mice

[0330] In the renal fibrosis animal model induced by UUO surgery, the effect of SAMiRNA-AREG (SAMi-mAREG#20) was analyzed. First, mice were anesthetized by inhalation with iFran solution (Hana Pharmaceutical, South Korea) to prepare a renal fibrosis animal model. The skin and peritoneum were incised, and the ureter of the left kidney was tied with 4-0 silk thread at two locations. In order to prevent urinary tract infection, the middle between the two locations was incised. In addition, the right kidney was operated on in the same way, but the ureter was not tied. Similarly, the abdomen of the normal group was also open, and the ureter of the left kidney was checked, but not tied. In addition, the peritoneum and skin were sutured to prevent infection. 6 hours after the model was induced, 1mg / kg or 5mg / kg SAMiRNA-AREG was given for the first time. After 24 hours, the second administration was performed. It was given twice, and the animal was killed 24 hours after the last administration. The animal model group was divided into a total of four groups: a normal group, a UUO model group administered with physiological buffered saline, and a UUO group administered with 1 mg / kg and 5 mg / kg of SAMiRNA-AREG, respectively.

[0331] 11-1. Analysis of SAMiRNA gene expression in renal fibrosis induced by UUO (unilateral ureteral obstruction)

[0332] Lung tissue was obtained from the sacrificed mice and crushed using a homogenizer. Total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 above using an RNA extraction kit (AccuPrep Cell Total RNA Extraction Kit, BIONEER, Korea). RNA reverse transcriptase (with oligo(dT)20 (Bioneer, Korea) was used. RocketScript TM The extracted RNA was synthesized into cDNA using the SYBR Green real-time qPCR (RT Premix) as follows. Using the synthesized cDNA as a template, SYBR Green real-time qPCR was performed, and the relative expression level of total RNA in the group was analyzed as follows. The synthesized cDNA was diluted 5 times with distilled water, and for the analysis of the mRNA expression levels of amphiregulin and fibrosis markers, 3 μl of the diluted cDNA, 25 μl of 2X GreenStar TMqPCR MasterMix (BIONEER, South Korea), 19 μl of distilled water and 3 μl of qPCR primers for amphiregulin and fibrosis markers (SEQ ID NO: 24 and 25 (Table 8); 10 pmol / μl for each primer, BIONEER, South Korea) were added to each well of a 96-well plate to prepare a mixture. At the same time, RPL13A (housekeeping gene (hereinafter referred to as HK gene)) was used as a standard gene for normalizing the mRNA expression levels of transforming growth factor 1, amphiregulin, fibronectin, collagen 1, smooth muscle actin, and collagen 3α1. In addition, the CCR2 gene was also analyzed to verify its efficacy on inflammatory factors.

[0333] After PCR was completed, the Ct (threshold cycle) value of the target gene was corrected by the RPL13A gene, and then the ΔCt value between the groups was calculated. The relative expression levels of transforming growth factor-1, amphiregulin, fibronectin, collagen 1, smooth muscle actin, collagen 3α1 and CCR2 genes were quantified using the ΔCt value and the equation 2(-ΔCt)×100.

[0334] As a result, the expression level of amphiregulin in the UUO model group given physiological buffered saline was 60 times higher than that in the normal group. It was confirmed that the expression of amphiregulin gene was reduced in the groups given 1 mg / kg SAMiRNA-AREG and 5 mg / kg SAMiRNA-AREG, respectively. In addition, it was confirmed that fibronectin and transforming growth factor 1 were reduced in a concentration-dependent manner in the groups given 1 mg / kg SAMiRNA-AREG and 5 mg / kg SAMiRNA-AREG, respectively, compared with the UUO model group. In addition, collagen 3α1, collagen 1, and smooth muscle actin tended to decrease in the group given 1 mg / kg SAMiRNA-AREG compared with the UUO model group. However, it was confirmed that the effect of reducing gene expression was better in the group given 5 mg / kg SAMiRNA-AREG compared with the group given 1 mg / kg SAMiRNA-AREG. In addition, it was confirmed that CCR2 increased by about 6 times in the UUO model group, but decreased in the group given SAMiRNA-AREG.

[0335] Although the present invention has been described in detail with reference to specific features, it will be apparent to those skilled in the art that this description only describes the preferred embodiments of the present invention and does not limit the scope of the present invention. Therefore, the essential scope of the present invention will be defined by the appended claims and their equivalents.

[0336] Industrial Applicability

[0337] The double-stranded oligonucleotide structure comprising the amphiregulin-specific double-stranded oligonucleotide according to the present invention, and the pharmaceutical composition comprising the same as an active ingredient, can inhibit amphiregulin with high efficiency without side effects, and thus can exhibit excellent effects in preventing and treating diseases caused by excessive fibrosis and respiratory diseases.

[0338] Sequence Listing Text

[0339] Electronic files are attached.

Claims

1. A compound having a structure of structural formula (3) or structural formula (4): [Structural formula (3)] [Structural formula (4)] Where A represents hexaethylene glycol-(PO3-hexaethylene glycol)3, B represents C 24 (C6-SSC 18 ), X and Y each represent a simple covalent bond or a linker-mediated covalent bond, and S represents a DNA sense strand and AS represents an RNA antisense strand having a sequence complementary thereto, and wherein S and AS form a DNA-RNA hybrid. 2 . The compound according to claim 1 , wherein S is amphiregulin-specific DNA sense strand. 3 . The compound according to claim 2 , wherein S is a DNA sense strand having a sequence selected from SEQ ID NOs: 1-14, and AS is an RNA antisense strand having a sequence complementary to the DNA sense strand. The compound according to claim 2 , wherein S is a sense strand of a DNA having a sequence of SEQ ID NO: 10, 11 or 12. The compound according to claim 4 , wherein S is a sense strand of a DNA having a sequence of SEQ ID NO:

12. The compound of claim 1 , wherein the DNA sense strand or the RNA antisense strand comprises a chemical modification.

7. The compound according to claim 6, wherein the chemical modification is selected from the group consisting of: A modification wherein the hydroxyl (OH) group at the 2' carbon position of the sugar structure in the nucleotide is substituted by any one selected from the group consisting of -CH3 (methyl), -OCH3 (methoxy), amine (-NH2), fluorine (-F), -O-2-methoxyethyl, -O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido, and -O-dimethylamidooxyethyl; A modification in which the oxygen in the sugar structure of the nucleotide is replaced by sulfur; Modifying the bond between nucleotides into any one bond selected from the group consisting of a phosphorothioate bond, a boranephosphonate bond, and a methylphosphonate bond; and Modifications are PNA (peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic acid). The compound according to claim 1 , wherein the covalent bond represented by X and Y is a non-degradable bond or a degradable bond.

9. The compound according to claim 8, comprising a non-degradable bond, wherein the non-degradable bond is an amide bond or a phosphate bond.

10. The compound according to claim 9, comprising a degradable bond, wherein the degradable bond is selected from the group consisting of a disulfide bond, an acid degradable bond, an ester bond, an anhydride bond, a biodegradable bond or an enzyme degradable bond.

11. The compound according to claim 1, further comprising a hexosamine, a sugar or a carbohydrate conjugated to A.

12. The compound according to claim 1, further comprising N-acetylgalactosamine (NAG) conjugated to A.

13. The compound according to claim 1, further comprising glucose or mannose conjugated to A.

14. A nanoparticle comprising the compound according to claim 1.

15. The nanoparticle of claim 14, wherein the nanoparticle comprises a mixture of double-stranded oligonucleotides, wherein each double-stranded oligonucleotide has a DNA sense strand with a unique sequence.

16. A pharmaceutical composition comprising the compound according to claim 1 as an active ingredient.

17. A pharmaceutical composition comprising the nanoparticles according to claim 14 as an active ingredient.

Images