Sorghum bicolor bivalent trait related gene dg1 and application thereof

By mining and utilizing the DG1 gene, which is associated with the double-grain trait in sorghum, and through genetic engineering to regulate the number of grains per spike and yield of sorghum, the problem of unclear genetic basis of the double-grain trait in sorghum has been solved, and high yields of sorghum and other gramineous crops have been achieved.

CN119685376BActive Publication Date: 2026-06-23INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Filing Date
2024-11-27
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The genetic basis and molecular mechanism of the two-grain trait in sorghum are not yet clear in the current technology, which has affected the full realization of the potential for yield improvement of sorghum and other gramineous crops.

Method used

The DG1 gene, associated with the two-grain trait in sorghum, was identified and utilized to regulate the number of grains per ear and yield of plants through genetic engineering. Specific methods included overexpressing or knocking out the related gene, increasing the content and activity of the DG1 protein, and using recombinant vectors and nucleic acid molecules for gene editing.

Benefits of technology

This study increased the number of grains per sorghum ear and improved yield, promoting high yields of sorghum and other gramineous crops and solving the problem of unclear genetic basis for the double-grain trait.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005156572760000051
    Figure BDA0005156572760000051
  • Figure BDA0005156572760000091
    Figure BDA0005156572760000091
  • Figure HDA0005156572770000011
    Figure HDA0005156572770000011
Patent Text Reader

Abstract

The application discloses a sorghum double-grain trait related gene DG1 and application thereof. The application provides application of any one of the following A1) to A3) in regulation of plant ear grain number, regulation of plant yield and / or cultivation of multiple-grain plants: A1), a protein DG1; A2), a nucleic acid molecule encoding the protein DG1; and A3), a recombinant carrier, an expression cassette or a recombinant bacterium containing the nucleic acid molecule encoding the protein DG1. The application finds that the protein DG1 is a gene for regulating plant ear grain number, overexpression of the gene can increase the plant ear grain number, make the sorghum multiple-grain and realize high yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the sorghum double-grain trait-related gene DG1 and its application, particularly the application of the sorghum double-grain trait-related gene DG1 in increasing the number of grains per sorghum ear and yield. Background Technology

[0002] Sorghum is one of the world's most important dryland food crops, widely used in brewing, food, and animal feed industries. Originating in Africa, sorghum was introduced to China from India. It is mainly distributed in Asia, Africa, and the Americas. Sorghum is highly adaptable, tolerating both drought and flood, and is also extremely tolerant of saline-alkali soils, enabling it to grow normally in harsh environments. In the context of global climate change, vigorously promoting sorghum cultivation is beneficial for improving the utilization rate of saline-alkali land, ensuring the security of food, feed, livestock, and energy without encroaching on staple food farmland. It holds significant strategic importance for maintaining crop diversity, efficient resource utilization, and addressing climate change.

[0003] Multiple grains are a common phenomenon in crops, characterized by the production of two or more seeds within a single spikelet at maturity, and are significant for increasing crop yield. The spikelet is the basic unit of the inflorescence structure in grasses, composed of a varying number of florets. In sorghum, each spikelet initially develops two florets; the inferior floret usually aborts, and only the superior floret develops normally to form a single seed. Abnormal floret development can result in double or multiple grains. Reports of the double-grain trait in sorghum date back to the 1930s, but the genetic basis and molecular mechanisms of this trait remain a mystery. Therefore, identifying genes related to the double-grain trait in sorghum and modifying it through genetic engineering is crucial for increasing the yield of sorghum and other grasses, and for alleviating the food crisis. Summary of the Invention

[0004] The technical problem solved by this invention is to provide genes related to the two-grain trait in sorghum and their applications.

[0005] To address the aforementioned technical problems, the first aspect of this invention provides the application of any one of the following substances (A1)–A4) in regulating the number of grains per spike, regulating plant yield, and / or cultivating compound-grain plants:

[0006] A1) Protein DG1;

[0007] A2) Nucleic acid molecules encoding protein DG1;

[0008] A3) Recombinant vectors, expression cassettes, or recombinant bacteria containing nucleic acid molecules encoding the protein DG1;

[0009] A4) The DNA molecule shown in positions 1-2576 of sequence 1;

[0010] The protein DG1 is either B1) or B2):

[0011] B1) A protein consisting of the amino acid sequence shown in sequence 3 of the sequence listing;

[0012] B2) Proteins derived from B1) with the same function, but with one or more amino acid residues substituted and / or deleted and / or added, according to the amino acid sequence shown in Sequence 3 of the sequence listing.

[0013] The protein mentioned above is derived from sorghum.

[0014] The term "more than one amino acid residue" as mentioned above can specifically refer to up to ten amino acid residues.

[0015] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0016] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, Myc tag, GST tag, and / or SUMO tag, etc.

[0017] In the application described above, the nucleic acid molecule encoding the protein DG1 is a DNA molecule of any one of the following C1)-C3):

[0018] C1) The coding region includes the DNA molecule shown in sequence 1 or positions 2577-4072 of sequence 1 in the sequence listing;

[0019] The C1 coding region includes the DNA molecule shown in sequence 2 of the sequence listing;

[0020] C2) DNA molecules that hybridize with the DNA sequence defined by C1) under strict conditions and encode proteins with the same function;

[0021] DNA molecules encoding proteins of the same function whose DNA sequences defined by C3) and C1) have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology.

[0022] In the above text, the nucleic acid molecule can be DNA, cDNA, or CDS molecule.

[0023] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0024] The expression cassette containing a nucleic acid molecule encoding protein DG1, as described above, refers to DNA capable of expressing the protein described in the above applications within a host cell. This DNA may include not only promoters that initiate transcription of the protein-coding gene but also terminators that terminate transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters.

[0025] The recombinant vector containing the nucleic acid molecule encoding the protein DG1 mentioned above is a recombinant expression vector containing the protein-encoding gene expression cassette constructed using existing plant expression vectors.

[0026] In an embodiment of the present invention, the recombinant vector is pCAMBIA2300-Promoter-ORF1-Myc, specifically, the fragment shown in sequence 1 is used to replace the fragment between the MfeI and KpnI restriction sites of the pCambia2300-Myc vector to obtain the vector.

[0027] The recombinant bacteria can specifically be yeast, bacteria, algae, and fungi.

[0028] In the above application, the regulation of plant ear grain number is to increase the plant ear grain number;

[0029] Alternatively, the regulation of plant yield may be for the purpose of increasing plant yield.

[0030] Secondly, the present invention provides a method for cultivating transgenic plants with increased grain number per ear, as follows: D1) or D2):

[0031] The method described in D1) includes the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant;

[0032] The method described in D2) includes the following steps: increasing the expression of nucleic acid molecules encoding protein DG1 in the target plant to obtain transgenic plants;

[0033] The number of grains per spike of the transgenic plant is greater than that of the target plant;

[0034] The protein DG1 is either B1) or B2):

[0035] B1) A protein consisting of the amino acid sequence shown in sequence 3 of the sequence listing;

[0036] B2) Proteins derived from B1) with the same function, but with one or more amino acid residues substituted and / or deleted and / or added, according to the amino acid sequence shown in Sequence 3 of the sequence listing.

[0037] Thirdly, the present invention provides a method for cultivating transgenic plants with increased yield, as follows: D1) or D2):

[0038] The method described in D1) includes the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant;

[0039] The method described in D2) includes the following steps: increasing the expression of nucleic acid molecules encoding protein DG1 in the target plant to obtain transgenic plants;

[0040] The yield of the transgenic plant is greater than that of the target plant;

[0041] The protein DG1 is either B1) or B2):

[0042] B1) A protein consisting of the amino acid sequence shown in sequence 3 of the sequence listing;

[0043] B2) Proteins derived from B1) with the same function, but with one or more amino acid residues substituted and / or deleted and / or added, according to the amino acid sequence shown in Sequence 3 of the sequence listing.

[0044] In the above text, increasing yield is reflected in increasing the number of grains per ear, the grain weight per plant, and / or the yield of a plot.

[0045] Fourthly, the present invention provides a method for preparing compound transgenic plants, as follows: D1) or D2):

[0046] The method described in D1) includes the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant;

[0047] The method described in D2) includes the following steps: increasing the expression of nucleic acid molecules encoding protein DG1 in the target plant to obtain transgenic plants;

[0048] The genetically modified plant is a compound-grain plant;

[0049] The protein DG1 is either B1) or B2):

[0050] B1) A protein consisting of the amino acid sequence shown in sequence 3 of the sequence listing;

[0051] B2) Proteins derived from B1) with the same function, but with one or more amino acid residues substituted and / or deleted and / or added, according to the amino acid sequence shown in Sequence 3 of the sequence listing.

[0052] The compound grain mentioned above refers to a double grain.

[0053] As mentioned above, increasing the content and / or activity of protein DG1 in the target plant or increasing the expression of nucleic acid molecules encoding protein DG1 in the target plant can be achieved by expressing or altering the gene promoter, such as using the DNA molecule shown in positions 1-2576 of sequence 1 to drive CDS expression of DG1.

[0054] In an embodiment of the present invention, the nucleic acid molecule encoding the protein DG1 (Sequence 1) is introduced into the target plant via a recombinant vector.

[0055] Fifthly, the present invention provides a protein, which is B1) or B2) as follows:

[0056] B1) A protein consisting of the amino acid sequence shown in sequence 3 of the sequence listing;

[0057] B2) Proteins derived from B1) with the same function, but with one or more amino acid residues substituted and / or deleted and / or added, according to the amino acid sequence shown in Sequence 3 of the sequence listing.

[0058] In a sixth aspect, the present invention provides a nucleic acid molecule, expression cassette, recombinant vector, or recombinant bacteria encoding the protein described in the fifth aspect;

[0059] Or the DNA molecule shown in positions 1-2576 of sequence 1.

[0060] The plants mentioned above are either monocotyledonous or dicotyledonous plants.

[0061] The plant in question is a member of the Poaceae family.

[0062] The plant in question is sorghum.

[0063] The experiments of this invention demonstrate that the present invention discovered protein DG1, which is a gene that regulates the number of grains per spike in plants. Overexpression of DG1 can increase the number of grains per spike, enabling sorghum to produce multiple grains and achieve high yield. Attached Figure Description

[0064] Figure 1 Genetic analysis of sorghum double-grain trait materials, where A represents the phenotypes of double-grain and single-grain parents, and B represents the statistical ratio of double-grain spikelets in the parents and their F1 hybrids.

[0065] Figure 2 For fine localization of the DG1 site.

[0066] Figure 3This study analyzes the gene sequences and expression levels of candidate regions for the two-grain trait in sorghum. In this diagram, A represents a schematic diagram of chromosomal structural variation at the DG1 locus, and B represents the PCR amplification results of chromosomal structural variation at the DG1 locus.

[0067] Figure 4 Expression analysis of five ORFs within the candidate regions of NIL-DG1 and NIL-dg1.

[0068] Figure 5 The construction and phenotype of ORF1-overexpressing plants are shown in Figure A. A is a schematic diagram of the ORF1 overexpression vector, B is the phenotype of the two ORF1 overexpression materials, C is the ORF1 expression level of the wild type and the two overexpression materials, and D is the ratio of two spikelets in the two ORF1 overexpression materials.

[0069] Figure 6 Construction and phenotype of ORF5 knockout plants, where A represents the first target sequence of the ORF5 gene and the ORF5 knockout plant. ko Sequence B represents the amino acid sequence of the ORF5 protein in wild-type and knockout plants, and sequence C represents the ORF5 sequence in ORF5 knockout plants. ko Spike phenotype.

[0070] Figure 7 The images show the phenotypes of near-isogenic lines NIL-DG1 and NIL-dg1. In the images, A shows the phenotypes of NIL-DG1 (left) and NIL-dg1 (right); B shows the ratio of two-grain spikelets in NIL-DG1 and NIL-dg1; C shows the comparison of the number of grains per spike in NIL-DG1 and NIL-dg1; D shows the comparison of the thousand-grain weight in NIL-DG1 and NIL-dg1; E shows the comparison of the grain weight per spike in NIL-DG1 and NIL-dg1; and F shows the comparison of the yield of each plot in NIL-DG1 and NIL-dg1. Detailed Implementation

[0071] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0072] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0073] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0074] Example 1: Discovery and genetic analysis of sorghum with two grain traits

[0075] I. Discovery and Genetic Analysis of Two-Grain Sorghum Materials

[0076] 1. Discovery and identification of sorghum two-grain trait materials

[0077] To identify sorghum with two grains, this invention utilizes 571 sorghum germplasm resources imported from the USDA Germplasm Bank for screening (each sorghum germplasm resource is described in the following references: Morris GP, Ramu P, et al. (2013) Population genomic and genome-wide association studies of agroclimatic traits in sorghum. Proc Natl Acad Sci USA 110:453-458; Burks PS, Kaiser CM, et al. (2015) Genome-wide association for sugar yield in sweetsorghum. Crop Sci 55:2138-2148. W197 is PI 660624 in the references, P126 is PI 534167 in the references, P243 is PI 655993 in the references, and P185 is PI 660624 in the references). 597945; P210 is PI613536 in the literature). These materials were planted in Beijing (39.5°N, 116.4°E) in the summer and in Ledong, Hainan (18.3°N, 108.8°E) in the winter for propagation and phenotypic observation. Field planting conditions were 4-meter row lengths, 0.5-meter row spacing, and 20-centimeter plant spacing, with approximately 15-20 individual plants per row. At seed maturity, spikelet phenotypic surveys were conducted on these 1577 sorghum materials. The results showed that two sorghum materials, designated W197 (PI 660624) and P126 (PI 534167), exhibited the double-grain trait in some spikelets. Both materials showed the double-grain trait in both Beijing and Hainan, indicating that the double-grain trait is genetically stable and less affected by environmental factors.

[0078] 2. Genetic analysis of sorghum double-grain trait materials

[0079] To analyze the inherited characteristics of the double-grain trait in W197 and P126, W197 and P126 were crossed with single-grain sorghum materials P185, P210, and P243, respectively, to form the F1 generation. All F1 materials exhibited the double-grain trait, indicating that the double-grain phenotype of W197 and P126 is controlled by dominant loci (Table 1). For further genetic analysis and gene mapping of the double-grain phenotype, W197 was selected for subsequent analysis. The phenotypes of the double-grain material W197 and the single-grain materials P185, P210, and P243 are as follows: Figure 1 As shown in Figure A, the ratio of two-grain spikelets in the F1 generation of the three different hybrid combinations is similar to that of the parental W197, further demonstrating that the locus controlling the two-grain trait in W197 exhibits dominant inheritance. Figure 1 B). Further investigation was conducted on the phenotypes of all individual ears in the F2 population obtained by self-pollination of the F1 generation plants from the three W197 hybrid combinations. The results showed that in all three F2 populations, the ears exhibited segregation between the two-grain trait and the one-grain trait. The chi-square test revealed that the phenotypic segregation ratio of the two traits was 3:1 (Table 2), indicating that the two-grain trait of W197 is controlled by a single dominant locus, which was named Double-Grain 1 (DG1).

[0080] Table 1 shows the genetic analysis of the two-grain sorghum material.

[0081]

[0082] Table 2 shows the genetic segregation from the W197 F2 population.

[0083] <![CDATA[F2 population]]> Double single grain <![CDATA[X 2 0.05 =3.84]]> W197×P185 302 90 0.77 W197×P210 236 76 0.04 W197×P243 135 36 1.22

[0084] II. Cloning of the sorghum two-grain trait gene DG1

[0085] 1. Preliminary localization of the sorghum two-grain trait gene DG1

[0086] This invention employs map-based cloning to clone DG1. First, three F2 segregating populations were constructed by crossing W197 with P185, P210, and P243, containing a total of 875 individual plants. Preliminary localization of this population was performed using 53 pairs of polymorphic molecular markers between W197 and P210, revealing that marker S6-29, located at the end of chromosome 6, is tightly linked to the dimorphic phenotype. S6-29 also exhibits polymorphism between the parents W197 and P185, and W197 and P243. Therefore, analysis of the F2 (W197×P185) and F2 (W197×P243) populations using marker S6-29 also detected a tight linkage between the S6-29 marker and the dimorphic phenotype. Further, new polymorphic markers were designed and screened near S6-29. These markers were used to detect individual plants in three F2 populations. By screening recombinant plants, DG1 was finally located in an approximately 800kb interval on chromosome 6 between the two markers SSR6-46 and SSR6-66. Figure 2 ).

[0087] 2. Fine mapping of the sorghum two-grain trait gene DG1

[0088] In the F2 population of the W197 and P243 pair, two heterozygous individuals with DG1 loci, F2-445 and F2-465, were selected and planted into two F3 populations. Using SSR6-46, SSR6-66, and 15 newly developed SNP pairs between them, 1449 F3 populations were screened for exchangeable individuals, identifying 16 exchangeable individuals of four different types. The identification of these four exchangeable individuals narrowed the DG1 locus to approximately 140 kb between SNP6-33 and SNP6-43. Using the same strategy, a new exchange type was further screened in the F4 population of 737 individuals, narrowing the DG1 interval to approximately 49.5 kb between SNP6-46 and SNP6-43 on chromosome 6. According to the annotation information of the sorghum genome on the Phytozome website, this region contains five coding genes: Sobic.006G254900, Sobic.006G255000, Sobic.006G255100, Sobic.006G255200, and Sobic.006G255300, which will be referred to as ORF1, ORF2, ORF3, ORF4, and ORF5, respectively. Figure 2 and Figure 3 A).

[0089] 3. Analysis of gene sequences and expression levels of candidate regions for the two-grain trait in sorghum

[0090] To identify the genes controlling the diploid trait, this invention sequenced the coding regions and promoter regions of five genes in the diploid parent W197 and the monoploid parents P185, P210, and P243. The results showed no difference in the coding regions of these five genes among the parents, and no significant difference in the promoter regions of ORF2, ORF3, and ORF4 among the parents either parent. Based on the reference genome information, primers F1 / R1 and F2 / R2 were designed to amplify the ORF1 and ORF5 promoter regions of P243 (Table 3). In P243, F1 / R1 and F2 / R2 amplified bands consistent with the reference genome, while in W197, only F1 / F2 and R1 / R2 amplified bands. Combined with the sequencing results, this confirmed the presence of intrachromosomal inversions in the promoter regions of ORF1 and ORF5 in W197, with an inversion interval of 35.7 kb. Figure 3 A and Figure 3 B). The same result was obtained in another dominant locus-controlled two-grain sorghum variety, P126, suggesting that the two-grain trait in P126 is also caused by the DG1 locus variation.

[0091] Table 3 shows the PCR primer sequences.

[0092] Primer Sequence(5'-3') F1 ATACCAGCATTAAGCAGCCTGAA R1 GCAGCCGTAGTAGAACTCCTTG F2 TCTACGTACCACAGGACGCAG R2 CCTGCGTTTCTCCCATGAGC

[0093] Intrachromosomal inversions in the promoter regions of ORF1 and ORF5 within the candidate region of W197 led to mutations in the promoter sequences of ORF1 and ORF5, which is speculated to potentially alter gene expression levels. This invention constructed a pair of near-isogenic lines, NIL-DG1 and NIL-dg1. The specific construction process was as follows: From the offspring population of the W197 / P243 cross, single plants with a heterozygous genotype in the target region (Sequence 1) were continuously selected (one homologous chromosome contained the DG1 gene with the mutant promoter shown in Sequence 1, and the other homologous chromosome contained the DG1 gene with the wild-type promoter shown in Sequence 4). After self-crossing to the F6 generation, single plants with a heterozygous genotype in the target region were selected, and this process was repeated to the F7 generation, selecting plants with homozygous wild-type genotypes in the target region. Plants of the wild type (containing the DG1 gene with the wild-type promoter shown in sequence 4 in the target region of both homologous chromosomes) and homozygous mutant type (containing the DG1 gene with the mutant promoter shown in sequence 1 in the target region of both homologous chromosomes) are used as a pair of near-isogenic materials. The near-isogenic material of the homozygous wild type is a single grain, denoted as NIL-DG1, and the near-isogenic material of the homozygous mutant type is a pair, denoted as NIL-dg1. The expression level of DG1 (ORF1) in NIL-dg1 is higher than that in NIL-DG1.

[0094] The expression levels of five candidate genes were detected using this near-isogenic pair. The results showed that compared to the monogranular NIL-DG1, the expression level of ORF1 was significantly upregulated and the expression level of ORF5 was significantly decreased in the digranular NIL-dg1 material, while there were no significant differences in the expression levels of ORF2, ORF3, and ORF4. Figure 4 This result indicates that variations in the promoter regions of ORF1 and ORF5 simultaneously affect the expression levels of both genes, thus identifying ORF1 and ORF5 as candidate genes controlling the DG1 site of the W197 digranulate trait.

[0095] The full-length sequences of ORF1 and its promoter are shown in Sequence 1, where positions 1-2576 constitute the promoter region and positions 2577-4072 constitute the gene coding region. The ORF1 CDS sequence is shown in Sequence 2, encoding a protein containing 327 amino acids, where positions 33-98 constitute a homeodomain. The protein sequence is shown in Sequence 3.

[0096] The amino acid sequence encoded by the ORF5 gene is as follows: Figure 6 B is shown in WT.

[0097] Example 2: Functional verification of the sorghum two-grain trait gene DG1

[0098] To verify whether the upregulation of ORF1 expression or the downregulation of ORF5 expression caused the two-grain trait in W197, this invention used Wheatland sorghum (granted by the USDA, Population genomic and genome-wide association studies of agroclimatic traits in sorghum. (2013). Proceedings of the National Academy of Science of the United States of America 110:453-458., hereinafter also referred to as wild-type sorghum) as the recipient material to conduct ORF1 overexpression and ORF5 gene knockout experiments.

[0099] 1. Functional verification of sorghum ORF1 gene

[0100] 1) Construction of sorghum ORF1 gene overexpression vector

[0101] The overexpression vector pCambia2300-Myc was preserved in our laboratory (i.e., a recombinant vector containing the Ubi promoter and OCS terminator, along with the Myc tag sequence, added to the commercial pCAMBIA2300 vector; publicly available from the applicant for replication of this invention. Reference: Xie P, Tang S, et al. Natural variation in Glume Coverage1 causes naked grains in sorghum. Nat Commun. 2022 Feb 25; 13(1):1068.). First, the vector pCambia2300-Myc was linearized by digesting it with restriction endonucleases MfeI and KpnI. Then, using W197 DNA as a template, the ORF1 promoter and the full-length gene (nucleotide sequence shown in Sequence 1 of the sequence listing) were amplified using primers carrying the adapter to obtain the target fragment with the adapter. Finally, the target fragment with adapter (promoter + ORF1 gene fragment) and the obtained linearized vector were seamlessly cloned and ligated using the pEASY-Uni Seamless Cloning and Assembly Kit (CU101-01) to obtain the recombinant product.

[0102] The seamless cloning ligation system is as follows: 2×Assembly mix 5μL, add appropriate amounts of linearization vector and DNA fragment according to the recovery concentration and fragment length, and bring the total volume to 10μL with deionized water.

[0103] Seamless cloning reaction conditions: 50℃ for 20 min.

[0104] After the reaction, place the centrifuge tube on ice to cool for a few seconds. Then, transform the recombinant product into *E. coli* XL1-Blue, extract the plasmid, and digest it with enzymes (MfeI and KpnI digestion, yielding a 4074 bp positive plasmid). Confirm the positive recombinant plasmid and name it pCAMBIA2300-Promoter-ORF1-Myc. Figure 5 A) The sample was sent to Ribo Biotech for further sequencing and verification.

[0105] pCAMBIA2300-Promoter-ORF1-Myc is a vector obtained by replacing the fragment shown in Sequence 1 between the MfeI and KpnI restriction sites of the pCambia2300-Myc vector.

[0106] 2) Obtaining plants overexpressing the ORF1 gene

[0107] 1 μg of the prepared recombinant vector plasmid pCAMBIA2300-Promoter-ORF1-Myc was transformed into competent Agrobacterium EHA105 cells. The positive bacteria obtained by PCR were named recombinant Agrobacterium EHA105 / pCAMBIA2300-Promoter-ORF1-Myc. The recombinant Agrobacterium was then transformed into Wheatland sorghum (hereinafter referred to as wild-type sorghum) recipient material via Agrobacterium-mediated transformation. T0 transgenic plants were obtained by screening on kanamycin-resistant medium. The sorghum genetic transformation method is as follows:

[0108] (1) Preparation of sorghum recipient material:

[0109] Wheatland sorghum plants are grown in a greenhouse. About 15 days after flowering, the ears are cut off and the immature embryos in the grains are squeezed out as much as possible in a sterile laminar flow hood and evenly placed on a callus culture medium for callus culture.

[0110] (2) Preparation of infecting bacterial suspension:

[0111] Recombinant Agrobacterium EHA105 / pCAMBIA2300-Promoter-ORF1-Myc, stored at -80℃, was streaked in YEP solid medium supplemented with Kan. Single colonies were inoculated into 10 mL of YEP liquid medium (containing Kan) for initial activation (28℃, 220 rpm shaking overnight). The activated bacterial culture was then inoculated at a 1:1000 ratio into 80 mL of YEP liquid medium (containing Kan) and incubated at 28℃, 220 rpm shaking until the OD 600nm reached 0.8-1.0, yielding the Agrobacterium culture.

[0112] (3) Infection process:

[0113] The Agrobacterium tumefaciens culture obtained in (2) with the required OD value was transferred to a 50 mL centrifuge tube and centrifuged at 5000 rpm for 10 min to enrich the bacterial cells. The bacterial cells were then fully resuspended with a resuspension buffer to obtain a resuspended infection solution. The callus tissue obtained in (1) was added to the resuspended infection solution for infection and transformation. The infected callus was transferred to a differentiation and regeneration medium. After regeneration and emergence, it was transferred to a rooting medium (containing Kan) for rooting culture. If the medium turned brown, the rooting medium needed to be transferred multiple times.

[0114] (4) Obtaining positive seeds

[0115] Transplant T0 generation sorghum seedlings with a plant height of about 5-7cm and good root growth into soil, cultivate them in a greenhouse and maintain a certain humidity to ensure the survival rate of the regenerated seedlings.

[0116] T0 generation transgenic plants were obtained.

[0117] RNA was extracted from the young spikelets of T0 generation transgenic plants and amplified by RT-PCR using primers ORF1-qPCR-F and ORF1-qPCR-R. The sorghum SbEIF gene was used as an internal control (primers were Sb-EIF-F and Sb-EIF-R), and wild-type sorghum was used as a control.

[0118] The nucleotide sequences of the primers are as follows:

[0119] ORF1-qPCR-F: 5'-AGTGCCACTTCCATTGGGAT-3';

[0120] ORF1-qPCR-R: 5'-CCTCTCACATGGTCCCTGC-3';

[0121] Sb-EIF-F: 5'-CAACTTTGTCACCCGCGATGA-3';

[0122] Sb-EIF-R: 5'-TCCAGAAACCTTAGCAGCCCA-3'.

[0123] Compared with wild-type sorghum, the positive T0 generation transgenic plants showed increased ORF1 gene expression. These positive T0 generation transgenic plants were named T0 generation ORF1 overexpressing plants, and two T0 generation ORF1 overexpressing plant lines were retained. OE-1 and ORF1 OE-2 For use in subsequent experiments.

[0124] T0 generation ORF1 overexpressing plant lines ORF1 OE-1 and ORF1 OE-2 T2 generation ORF1 overexpressing plant lines were obtained. OE-1 and ORF1 OE-2 Homozygous lines were used for subsequent analysis.

[0125] 3) Phenotypic analysis of ORF1 overexpressing plants

[0126] Wild-type sorghum and T2 generation ORF1-overexpressing plant lines ORF1 OE-1 ORF1 overexpression in T2 generation plants OE-2 Sowing of seeds.

[0127] (1) Detection of young spikelets by real-time quantitative PCR

[0128] During the young spikelet development stage, wild-type sorghum and T2 generation ORF1 overexpressing plant lines were selected. OE-1 ORF1 overexpression in T2 generation plantsOE-2 Real-time quantitative PCR was performed on young spikelets 1-2 cm long. RT-PCR amplification was performed using ORF1-qPCR-F and ORF1-qPCR-R primers, with the sorghum SbEIF gene used as an internal control.

[0129] The nucleotide sequences of the primers are as follows:

[0130] ORF1-qPCR-F: 5'-AGTGCCACTTCCATTGGGAT-3';

[0131] ORF1-qPCR-R: 5'-CCTCTCACATGGTCCCTGC-3';

[0132] SbEIF-F: 5'-CAACTTTGTCACCCGCGATGA-3';

[0133] SbEIF-R: 5'-TCCAGAAACCTTAGCAGCCCA-3'.

[0134] The results showed that, compared to wild-type sorghum Wheatland (WT), ORF1 OE-1 and ORF1 OE-2 The expression level of the ORF1 gene in the plant was about 10 times higher. Figure 5 C).

[0135] (2) Ear and grain phenotype

[0136] Phenotypic behavior was observed during seed maturity.

[0137] The results showed that, compared with the single-grain phenotype of wild-type sorghum Wheatland, ORF1 OE-1 and ORF1 OE-2 All plants and ears of grain exhibited a two-grain phenotype. Figure 5 B).

[0138] The percentage of spikelets with two grains per spike was statistically analyzed, and the results showed that ORF1 OE-1 The proportion of double spikelets was approximately 34.2%, ORF1 OE-2 The proportion of spikelets with two grains is approximately 29.5%. Figure 5 D).

[0139] This result demonstrates that increasing ORF1 expression levels in single-grain sorghum can indeed produce a double-spikelet phenotype. Therefore, ORF1 (Sobic.006G254900) is the regulatory gene for double-spikelets in sorghum.

[0140] 2. Functional verification of sorghum ORF5 gene

[0141] 1) Construction of sorghum ORF5 gene knockout vector

[0142] The plant gene editing vectors pYLCRISPR / Cas9 Pubi-B and intermediate vectors pYLsgRNA-OsU3 and pYLsgRNA-OsU6a were kindly provided by Professor Liu Yaoguang of South China Agricultural University (related literature: Ma X, Zhang Q, Zhu Q, et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency MultiplexGenome Editing in Monocot and Dicot Plants. Mol Plant. 2015 Aug; 8(8):1274-84. doi:10.1016 / j.molp.2015.04.007. Epub 2015Apr 24.PMID:25917172.). Specific methods are described in the literature, and the experimental protocol is as follows:

[0143] (1) Plasmid extraction: The bacterial strain is streaked onto an LB plate containing the corresponding antibiotic. After the bacteria have grown, a single clone is picked and cultured in LB liquid containing the corresponding antibiotic with shaking to extract the plasmid.

[0144] (2) Preparation of target adapters: The designed and synthesized target adapter primers were added to 100 μM with sterile distilled water. Then, 0.5 μL of forward and reverse primers were added to 49 μL of sterile distilled water, heated at 90 °C for 30 s, and cooled to room temperature to obtain target adapters ORF5-KO-Target1 (obtained by annealing ORF5-KO-F1 / R1) and ORF5-KO-Target2 (obtained by annealing ORF5-KO-F2 / R2).

[0145] The target primers are shown in Table 4, and the target locations are as follows: Figure 6 As shown in Figure A.

[0146] Table 4 lists the primers for ORF5 gene knockout target sites.

[0147]

[0148] (3) Enzyme digestion of sgRNA vector: Take 2 μg pYLgRNA-OsU3 and pYLgRNA-OsU6a plasmids, add 20 U BsaI-HF, prepare a 50 μL system, digest for 20 min, store at -20℃ to obtain the enzyme digested plasmid.

[0149] (4) Ligation of sgRNA expression cassettes: The digested plasmids were ligated to the corresponding target adapters (ORF5-KO-Target1 ligated to pYLgRNA-OsU3, ORF5-KO-Target2 ligated to pYLgRNA-OsU6a) to obtain the ligation products sgRNA1 expression cassette ligation product and sgRNA2 expression cassette ligation product. The reaction system was as follows: 20 ng of digested plasmid, 0.5 μL of target adapter, 0.2 μL of T4 DNA ligase and 1 μL of 10×T4 DNA ligase buffer, with deionized water added to 10 μL. After mixing, the mixture was ligated at 25℃ for 15 min.

[0150] (5) PCR amplification of sgRNA expression cassettes: Amplification was performed in two rounds. The first round of amplification involved performing PCR amplification on the sgRNA1 expression cassette ligation products and the sgRNA2 expression cassette ligation products obtained in step (4). The amplified products were named Product 1 and Product 2, respectively. In the reaction system, 0.5 μL of ligation product, 0.2 μM primers UF and gRNA-R, 7.5 μL of 2×PCR buffer, 3 μL of 2 mM dNTPs, 0.3 μL of KOD FX Neo, and deionized water was added to a final volume of 15 μL. The PCR reaction program was: 94℃ for 10 s, 60℃ for 15 s, 68℃ for 20 s, for 28 cycles. Second round of amplification: Using B1' / B2 as primers, product 1 was amplified by a second round of PCR, and the product was named sgRNA1 expression cassette (containing ORF5-KO-Target1); using B2' / BL as primers, product 2 was amplified by a second round of PCR, and the product was named sgRNA2 expression cassette (containing ORF5-KO-Target2).

[0151] PCR amplification was performed using KOD FX Neo high-fidelity enzyme, with the same reaction system as above. The reaction program was: 95℃ for 10s, 58℃ for 15s, 68℃ for 20s, for 20 cycles.

[0152] The nucleotide sequences of the primers are as follows:

[0153] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0154] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0155] B1': 5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3';

[0156] B2: 5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3';

[0157] B2': 5'-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3';

[0158] BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3'.

[0159] (6) Ligate the sgRNA1 and sgRNA2 expression cassettes to the pYLCRISPR / Cas9 Pubi-B vector: The ligation-by-die method was used. The reaction mixture consisted of 15 ng each of the sgRNA1 and sgRNA2 expression cassettes, 80 ng of pYLCRISPR / Cas9 Pubi-B plasmid, 1.5 μL of 10×Cut Smart Buffer, 1.5 μL of 10 mM ATP, 0.2 μL of BsaI-HF, and 0.2 μL of T4 DNA ligase in a 15 μL reaction mixture. The reaction program was: 37℃ for 5 min, 10℃ for 5 min, 20℃ for 5 min, for 15 cycles; then 37℃ for 5 min.

[0160] (7) Transform the ligation product into E. coli and incubate upside down on LB agar plates containing kanamycin. Pick a single colony from the plate and incubate overnight in LB liquid medium containing kanamycin. Perform PCR verification using primers SP1 and SP2.

[0161] The nucleotide sequences of primers SP1 and SP2 are as follows:

[0162] SP1: 5'-CCCGACATAGATGCAATAACTTC-3';

[0163] SP2: 5'-GCGCGGTGTCATCTATGTTACT-3'.

[0164] The reaction system consisted of 10 μl of 2×Taq mix, 0.4 μl each of 10 μM SP1 and 10 μM SP2, and 2 μl of bacterial culture in a 20 μl reaction mixture. The amplification program was: 94℃ for 5 min; 94℃ for 30 s, 57℃ for 30 s, 72℃ for 45 s, for 30 cycles; 72℃ for 5 min; and storage at 4℃. Plasmids extracted from bacterial cultures showing a 1.2 kb target band were identified by agarose gel electrophoresis. Successful sequencing confirmed the plasmid to be pYLCRISPR / Cas9Pubi-B-ORF5.

[0165] 2) Obtaining sorghum ORF5 gene knockout plants

[0166] The successfully constructed plasmid was transformed into Agrobacterium competent cells EHA105, and genetic transformation was performed on sorghum Wheatland embryos using the same procedure as above. T0 transgenic plants were obtained by screening on a medium containing glyphosate resistance.

[0167] Genomic DNA was extracted from T0 generation transgenic seedlings and identified using primers SP1 and SP2. Plants that amplified the target fragment to 1.2 kb were identified as T0 transgenic positive plants. PCR amplification and sequencing of the T0 transgenic positive plant DNA were performed using ORF5 gene sequence amplification primers ORF5-F and ORF5-R to detect whether the target site had been edited.

[0168] The nucleotide sequences of the primers are as follows:

[0169] SP1: 5'-CCCGACATAGATGCAATAACTTC-3';

[0170] SP2: 5'-GCGCGGTGTCATCTATGTTACT-3';

[0171] ORF5-F: 5'-GGCGTGGTAGAGTTCTCAGC-3';

[0172] ORF5-R: 5'-CATGTTCATTCACCTTGGGAC-3'.

[0173] The PCR reaction system is as follows: KOD is added to a 50 μl reaction mixture. PCR Master mix 25 μl, 10 μM ORF5-F, 1.5 μl ORF5-R, 1 μl DNA. The reaction program was: 94℃ for 3 min; 98℃ for 10 s, 54℃ for 15 s, 68℃ for 45 s, 30 cycles; 68℃ for 5 min, store at 4℃.

[0174] T0 positive plants were self-pollinated to obtain T1 generation seeds. T1 generation transgenic plants were then planted, and PCR amplification and sequencing were performed using primers ORF5-F and ORF5-R. Plants with homozygous target mutations were selected. KO In the recipient material Wheatland, ORF5 encodes a 945-amino acid protein. In gene-edited plants, ORF5... KO The test terminated prematurely near the first target site, predicting a protein encoding 55 amino acids. Figure 6 B).

[0175] The nucleotide sequences of the primers are as follows:

[0176] ORF5-F: 5'-GGCGTGGTAGAGTTCTCAGC-3';

[0177] ORF5-R: 5'-CATGTTCATTCACCTTGGGAC-3'.

[0178] 3) Phenotypic analysis of sorghum ORF5 gene knockout plants

[0179] Observe wild-type sorghum Wheatland and T1 generation ORF5 during the seed maturity period. KO Plant spikelet phenotype, ORF5 was found KO All spikelets of the plant exhibited a single-grain trait, consistent with the wild-type recipient material. Figure 6 C). This result proves that ORF5 is not related to the development of two spikelets.

[0180] The above analysis proves that ORF1 is the DG1 gene controlling the two-grain trait in sorghum. In W197, chromosomal structural variations led to changes in the DG1 promoter region, which in turn resulted in increased DG1 expression and the appearance of the two-grain phenotype.

[0181] In W197, the DG1 promoter and full-length gene are shown in Sequence 1, where positions 1-2576 constitute the promoter region and positions 2577-4072 constitute the gene coding region. The DG1 CDS sequence is shown in Sequence 2, encoding a 327-amino acid protein named DG1, where positions 33-98 constitute a homeodomain. The protein sequence is shown in Sequence 3.

[0182] Example 3: Application of the sorghum double-grain trait gene DG1 in increasing the number of grains per sorghum ear and yield.

[0183] Double-grain sorghum produces two seeds within a single spikelet, potentially increasing the number of grains per spike and yield. This invention utilizes near-isogenic lines NIL-DG1 and NIL-dg1 to analyze the effects of DG1 variation on yield-related traits.

[0184] Statistical results showed that approximately 56.7% of the spikelets of NIL-dg1 ear exhibited the double-grain trait. Figure 7 A and 7B). Compared with NIL-DG1, NIL-dg1 significantly increased the number of grains per spike, while the thousand-grain weight decreased to some extent, ultimately resulting in higher yield per plant and plot yield. Figure 7 C-7F).

[0185] Yield statistics demonstrate that DG1, which controls the double-grain trait, is a key gene for increasing the number of grains per ear and yield, and has the potential to increase sorghum yield.

[0186] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of any one of the substances listed in A1)–A3) below in increasing the number of double spikelets in sorghum or in cultivating double spikelet sorghum: A1) Protein DG1; A2) Nucleic acid molecules encoding protein DG1; A3) Recombinant vectors, expression cassettes, or recombinant Agrobacterium containing nucleic acid molecules encoding the protein DG1; The protein DG1 is a protein composed of the amino acid sequence shown in Sequence 3 of the sequence listing.

2. The application according to claim 1, characterized in that: The nucleic acid molecule encoding the protein DG1 is either C1) or C2) as follows: C1) The coding region includes the DNA molecule shown in sequence 1 or positions 2577-4072 of sequence 1 in the sequence listing; The C2 coding region includes the DNA molecule shown in sequence 2 of the sequence listing.

3. A method for breeding transgenic plants with increased number of double spikelets, comprising the following D1) or D2): The method described in D1) includes the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant; The method described in D2) includes the following steps: increasing the expression of nucleic acid molecules encoding protein DG1 in the target plant to obtain transgenic plants; The transgenic plant has a greater number of double spikelets than the target plant; The protein DG1 is a protein consisting of the amino acid sequence shown in sequence 3 of the sequence listing; The plant in question is sorghum.

4. A method for preparing transgenic plants with two spikelets, comprising the following D1) or D2): The method described in D1) includes the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant; The method described in D2) includes the following steps: increasing the expression of nucleic acid molecules encoding protein DG1 in the target plant to obtain transgenic plants; The transgenic plant is a two-spickled plant; The protein DG1 is a protein consisting of the amino acid sequence shown in sequence 3 of the sequence listing; The plant in question is sorghum.