Application of OVA in promoting cell production and / or exosome release

Abstract

The invention relates to the technical field of biology, and provides application of OVA in promoting cell production and / or exosome release. The tumor cell strain capable of stably expressing OVA is finally obtained by constructing a lentiviral vector of an overexpressed OVA gene and transfecting tumor cells with the lentiviral vector. Through extraction and detection, the cell strain obviously improves the yield of the exosome per unit cell and per unit culture medium volume, the yield of the exosome is obviously improved, and the tumor cell source exosome can carry OVA specific targeting tumor cells and can activate immune response, effectively immunize and kill cancer cells and inhibit proliferation of the cancer cells.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular, relates to the use of OVA in promoting cells to produce and / or release exosomes. Background Art

[0002] Cancer remains one of the diseases that threatens the lives of many people around the world. Cancer cells have characteristics such as high proliferation rate, self-renewal ability, tumor stem cell (CSC) characteristics, easy metastasis and drug resistance. Based on these characteristics, new treatments including nucleic acid drugs and anticancer drugs have been developed to target cancer cells and inhibit their progression. Exosomes are microvesicles with a diameter of 30 to 150 nm, which are collectively referred to as extracellular microvesicles together with microcapsules and apoptotic bodies. Exosomes have a typical phospholipid bilayer membrane structure and low immunogenicity, and can more efficiently cross the blood-brain barrier and placental barrier. In addition, exosomes contain a variety of metabolites and genetic materials from a variety of source cells, which can activate cell signaling pathways. Exosomes are secreted by mother cells, so the expression of their contents can be specifically increased by modifying mother cells. Therefore, engineered exosomes have more advantages than native exosomes.

[0003] OVA is composed of 12269aa and has a molecular weight of about 172.44kD. It can induce a moderate immune response in the body and has been used as a universal model antigen in immunological and vaccine research.

[0004] Overexpressed OVA exosomes can be recognized and activated by immune cells, thereby inducing an immune response. Immune cells produce a large number of cytotoxic T lymphocytes and natural killer cells, which locate and kill tumor cells. In addition, OVA antigens can also activate immune cells to produce a large number of cytokines, such as interferon and tumor necrosis factor, which can inhibit the growth and spread of tumor cells. Due to the important role of OVA in immune regulation, OVA has become one of the targets of immunotherapy research.

[0005] Because exosomes have good engineering and delivery properties, overexpressing the OVA gene in exosomes can produce better therapeutic effects on tumor immunotherapy and immunoregulation, which can promote the clinical treatment of OVA and provide a new therapeutic theoretical basis for exploring the use of exosomes to treat tumors, which is of great value. Summary of the invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to at least a certain extent. To this end, the present invention provides the use of OVA in promoting cells to produce and / or release exosomes.

[0007] The present invention is accomplished based on the following findings of the inventors:

[0008] At present, the number of exosomes produced and / or released in tumor cells is relatively small, and the effect of a small number of exosomes on tumor immunotherapy and immunoregulation is not significant. In order to overcome this problem, the present application surprisingly found that by constructing a lentiviral vector that overexpresses the OVA gene and transfecting it into tumor cells, a tumor cell line that stably expresses OVA can be obtained, and the expression of exosomes in tumor cells can be increased, thereby improving the effect of tumor immunotherapy and immunoregulation.

[0009] In the first aspect of the present invention, the present invention proposes the use of OVA in promoting cell production and / or release of exosomes. According to an embodiment of the present invention, stable expression of OVA in cells can increase the growth rate and yield of exosomes per unit cell and per unit culture medium volume, and increase the yield of exosomes.

[0010] In the second aspect of the present invention, the present invention proposes the use of a reagent in the preparation of a kit. According to the use of an embodiment of the present invention, the reagent is used to regulate the expression or activity of OVA, and the kit is used to regulate the production and / or release of exosomes in cells. As mentioned above, stable expression of OVA in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the production of exosomes. Therefore, the reagent that regulates the expression or activity of OVA can further regulate the production and / or release of exosomes in cells.

[0011] In the third aspect of the present invention, the present invention proposes the use of an agent in the preparation of a drug. According to the use of an embodiment of the present invention, the agent is used to promote the expression or activity of OVA in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0012] In a fourth aspect of the present invention, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting an agent with the cells to be treated, wherein the agent is used to regulate the expression or activity of OVA. According to the method of an embodiment of the present invention, the yield of exosomes produced and / or released by tumor cells can be increased.

[0013] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0015] Figure 1 The schematic diagram of the structure of the basic carrier LV3 in Example 1 of the present invention is shown;

[0016] Figure 2 The schematic diagram of the structure of the recombinant lentiviral vector in Example 1 of the present invention is shown;

[0017] Figure 3 shows a light microscopic image (10X) of mouse colon cancer cells in Example 2 of the present invention;

[0018] Figure 4 The flow fluorescence image of CT26 cells transfected with LV3 lentivirus in Example 2 of the present invention is shown;

[0019] Figure 5 A schematic diagram of the process of extracting exosomes in Example 3 of the present invention is shown;

[0020] Figure 6 The electron micrographs of OVA EVs in Example 3 of the present invention are shown, wherein Figure A shows exosomes extracted from ordinary tumor cells, and Figure B shows exosomes extracted from cells overexpressing OVA. There is no significant difference between the exosomes extracted from cells overexpressing OVA and the control group, which is consistent with the structure of exosomes;

[0021] Figure 7 The graph shows the results of particle size analysis of OVA EVs in Example 3 of the present invention;

[0022] Figure 8 The result of the test of the number of exosome particles extracted in Example 3 of the present invention is shown, wherein:

[0023] Figure A shows the number of particles in the Control group after 10-fold dilution.

[0024] Panel B shows the particle number of the OVA EVs group at 20-fold dilution;

[0025] Fig. 9 The Western blot result of the expression of exosomal OVA protein in Example 3 of the present invention is shown;

[0026] Fig.10 The fluorescence detection results of mouse colon cancer cells taking up two types of exosomes in Example 3 of the present invention are shown;

[0027] Fig.11 The figure shows the result of two exosomes in Example 3 of the present invention inhibiting the proliferation of mouse colon cancer cells. DETAILED DESCRIPTION

[0028] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0029] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0030] In this document, the terms “contain”, “include” or “comprise” are open expressions, that is, they include the contents specified in the present invention but do not exclude other contents.

[0031] As used herein, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0032] The present invention proposes the use of OVA in promoting cells to produce and / or release exosomes, the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cells to produce and / or release exosomes, which will be described in detail below.

[0033] Use of OVA in promoting cell production and / or release of exosomes

[0034] In the first aspect of the present invention, the present invention proposes the use of OVA in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stable expression of OVA in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the yield of exosomes.

[0035] According to an embodiment of the present invention, the nucleotide sequence of OVA is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and misplacing one or more bases in the sequence shown in SEQ ID NO: 1.

[0036]

[0037] It should be noted that the "nucleic acid" described in the present application can be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA and RNA, and its length is not subject to any special restrictions. For constructs used to construct recombinant cells, it is preferred that the nucleic acid is DNA, because DNA is more stable and easy to operate compared to RNA. The "nucleic acid" described in the present application actually includes any one or two of the complementary double strands. For convenience, in this specification and claims, although only one strand is given in most cases, the other strand complementary to it is actually disclosed. For example, when mentioning SEQ ID NO: 1, its complementary sequence is actually included. Those skilled in the art can also understand that one strand can be used to detect another strand, and vice versa.

[0038] The "construct" described in the present application refers to a genetic vector that contains a specific nucleic acid sequence and can transfer the target nucleic acid sequence into a host cell to obtain a recombinant cell. The form of the construct is not particularly limited. According to an embodiment of the present invention, it can be at least one of a plasmid, a phage, an artificial chromosome, a cosmid, a virus, and a viral vector, preferably a virus or a viral vector, and those skilled in the art can select as needed.

[0039] According to an embodiment of the present invention, the cell is a tumor cell.

[0040] According to an embodiment of the present invention, the tumor cells include at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells, and bladder cancer cells.

[0041] According to an embodiment of the present invention, the breast cancer cells include luminal B-type breast cancer cells.

[0042] According to some specific embodiments of the present invention, the tumor cells are colon cancer cells.

[0043] Use of reagents in preparing kits

[0044] In the second aspect of the present invention, the present invention proposes the use of a reagent in the preparation of a kit. According to an embodiment of the present invention, the reagent is used to regulate the expression or activity of OVA, and the kit is used to regulate the production and / or release of exosomes in cells. As mentioned above, stable expression of OVA in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the production of exosomes. Therefore, the reagent that regulates the expression or activity of OVA can further regulate the production and / or release of exosomes in cells.

[0045] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of OVA, and the kit is used to promote the production and / or release of exosomes in cells.

[0046] According to an embodiment of the present invention, the reagent includes at least one of a viral vector and a virus for overexpressing OVA.

[0047] According to an embodiment of the present invention, the virus includes at least one of a lentivirus and an adenovirus.

[0048] According to an embodiment of the present invention, the viral vector includes retrovirus, lentivirus, adenovirus and other enveloped viral vectors.

[0049] According to an embodiment of the present invention, the viral vector is a lentiviral vector.

[0050] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of OVA, and the kit is used to inhibit the production and / or release of exosomes in cells.

[0051] According to an embodiment of the present invention, the reagent includes siRNA for inhibiting the expression of OVA.

[0052] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

[0053] aagcatggaattttgttttgatg (SEQ ID NO: 2).

[0054] Use of reagents in the preparation of drugs

[0055] In the third aspect of the present invention, the present invention proposes the use of an agent in the preparation of a drug. According to an embodiment of the present invention, the agent is used to promote the expression or activity of OVA in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0056] According to an embodiment of the present invention, the reagent includes at least one of a viral vector and a virus for overexpressing OVA.

[0057] Methods for regulating cell production and / or release of exosomes

[0058] In a fourth aspect of the present invention, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting an agent with the cells to be treated, wherein the agent is used to regulate the expression or activity of OVA. According to the method of an embodiment of the present invention, the yield of exosomes produced and / or released by cells can be increased.

[0059] According to an embodiment of the present invention, the cell is a tumor cell.

[0060] According to an embodiment of the present invention, the tumor cells include at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells, and bladder cancer cells.

[0061] According to an embodiment of the present invention, the breast cancer cells include luminal B-type breast cancer cells.

[0062] According to some specific embodiments of the present invention, the tumor cells are colon cancer cells.

[0063] According to an embodiment of the present invention, the agent is used to promote the expression or activity of OVA, and the agent includes at least one of a viral vector and a virus for overexpressing OVA.

[0064] According to an embodiment of the present invention, the agent is used to inhibit the expression or activity of OVA, and the agent includes siRNA for inhibiting the expression of OVA.

[0065] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

[0066] According to an embodiment of the present invention, the culture medium used for culturing the cells is serum-free DMEM culture medium.

[0067] According to an embodiment of the present invention, the method for producing and / or releasing exosomes is as follows: selecting mouse colon cancer cells transfected with a recombinant lentiviral vector in the P3 generation logarithmic growth phase, and continuing to culture with serum-free DMEM medium until the cell confluence is 70% to 80%, ultracentrifuging to obtain tumor cell exosomes.

[0068] Herein, the "cell confluence" refers to the percentage of the surface area covered by the cell layer in the culture container during the cell culture process.

[0069] The present invention exemplarily uses the LV3 vector as the base vector to construct a lentiviral vector that overexpresses the OVA gene, transfects tumor cells with it, and obtains a stably expressed OVA cell line. Through exosome extraction and detection, the cell line significantly improves the exosome yield per unit cell and unit culture medium volume, and the exosome yield is improved. In addition, the present invention purifies and separates exosomes through the GFP tag carried by the lentivirus, which solves the defects of traditional methods to a certain extent and promotes the scientific research and clinical level of tumor cell exosomes.

[0070] Tumor cells

[0071] In a fifth aspect of the present invention, the present invention provides a tumor cell. According to an embodiment of the present invention, OVA is overexpressed in the tumor cell. According to the tumor cell of the embodiment of the present invention, the production of exosomes can be increased.

[0072] When OVA is overexpressed, it can activate more intracellular signaling pathways that play a key role in the production and secretion of exosomes. The activated signaling pathways can promote the biosynthesis and secretion of exosomes, thereby increasing the production of exosomes. When OVA is overexpressed, it may affect cell metabolism and overreaction. Under such conditions, cells will initiate a series of protective mechanisms, thereby increasing the production of exosomes.

[0073] According to an embodiment of the present invention, the tumor cells are selected from at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells, and bladder cancer cells.

[0074] According to an embodiment of the present invention, the tumor cell is at least one of a colon cancer cell, a breast cancer cell, and a melanoma cell.

[0075] According to an embodiment of the present invention, the breast cancer cells include luminal B-type breast cancer cells.

[0076] According to an embodiment of the present invention, the tumor cells are colon cancer cells.

[0077] According to an embodiment of the present invention, the colon cancer cells overexpressing OVA are prepared by the following method: constructing a recombinant lentivirus overexpressing OVA and mouse colon cancer cells.

[0078] Specifically, the tumor cells overexpressing the OVA gene of the present invention are prepared by the following method:

[0079] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-OVA overexpressing the OVA gene was constructed. The recombinant lentivirus was packaged into the 293T cell line and named LV3-OVA. The recombinant lentivirus LV3-OVA was transfected into tumor cells to obtain a tumor cell line stably expressing OVA.

[0080] The present invention also provides a method for preparing the above-mentioned tumor cells overexpressing the OVA gene, which is prepared by the following method:

[0081] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-OVA overexpressing the OVA gene was constructed and transfected into the 293T cell line to package the recombinant lentivirus, named LV3-OVA. The recombinant lentivirus LV3-OVA was transfected into tumor cells to obtain a cell line stably expressing OVA.

[0082] According to an embodiment of the present invention, the OVA gene is the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and ectopic one or more bases of the sequence shown in SEQ ID NO: 1.

[0083] According to an embodiment of the present invention, the lentivirus is LV3.

[0084] In the present invention, the recombinant lentivirus overexpressing the OVA gene is constructed, named pLV3-OVA, and is transfected into tumor cells to screen and obtain tumor cell lines that highly express OVA.

[0085] The present invention uses pLV3 vector as the basic vector, constructs a recombinant plasmid of overexpressed OVA gene, pLV3-OVA, transfects 293T cell line to package to obtain recombinant lentivirus, named LV3-OVA, transfects the recombinant lentivirus LV3-OVA into tumor cells, and obtains a stably expressed OVA cell line. The cell line was tested to significantly increase the exosome yield per unit cell and unit culture medium volume, and the exosome yield was significantly increased.

[0086] According to an embodiment of the present invention, the OVA overexpression is achieved by at least one of the following methods: viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and gene editing or transcriptional activation based on the CRISPR / CAS system.

[0087] According to an embodiment of the present invention, the gene / mRNA transfection technology is not particularly limited and is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection agent-mediated transfection, virus-like particle VLP-mediated transfection, electroporation transfection, lentiviral vector for gene delivery, adeno-associated virus vector for gene delivery, adenoviral vector for gene delivery and Sendai virus vector for gene delivery.

[0088] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0089] Example 1: Construction of OVA lentivirus

[0090] According to the OVA gene sequence information in the NCBI (National Center for Biotechnology Information) database (Gene ID: 396058), the OVA gene shown in SEQ ID NO: 1 was cloned and expressed as Figure 1 The pLV3 shown in the figure was used as the basic vector to construct the recombinant vector pLV3-OVA containing the OVA gene, and the recombinant vector pLV3-OVA was packaged by transfecting the 293T cell line to produce Figure 2 LV3-OVA lentivirus as indicated.

[0091] Example 2: Preparation of OVA-stable tumor cells

[0092] The lentivirus LV3-OVA constructed in Example 1 was transfected into mouse colon cancer cells (Biyuntian Biotechnology Co., Ltd., catalog number: C7259) (virus infection multiplicity MOI value: 20-100) to obtain tumor cells overexpressing the OVA gene, which were cultured in 1640 medium, and the growth of tumor cells was observed. The expression of OVA was detected by flow cytometry. The detection method is a routine operation in the art and will not be described here. The results are shown in FIG. Figure 3 and Figure 4 As shown, it is shown that the cell viability cultured in the present invention is higher than 90%, and the OVA fluorescence expression is normal when detected by flow cytometry.

[0093] Example 3: Extraction and identification of exosomes from tumor cells

[0094] 3.1 Extraction of exosomes from tumor cells:

[0095] Tumor cells in the logarithmic growth phase of P3 (Control group) and tumor cells overexpressing OVA constructed in Example 2 (OVA EVs group) were selected for culture and exosomes were extracted.

[0096] The specific method is as follows: Use DMEM complete medium to culture cells. When the cell confluence reaches 70% to 80%, wash the cells with PBS to remove exosomes in the serum. Use serum-free DMEM complete medium for 48 hours, and then separate and extract exosomes by ultracentrifugation. Take 100mL of cell culture supernatant and centrifuge at 300g for 10 minutes to remove cells, centrifuge at 2000g for 10 minutes to remove cell debris, and then centrifuge at 10000g for 30 minutes to remove apoptotic bodies. Finally, centrifuge at 100000g for 70 minutes to discard the supernatant, collect the crude exosome precipitate and resuspend it with 1mL PBS, then centrifuge at 100000g for 70 minutes to discard the supernatant, and finally resuspend it with 200μL sterile PBS to obtain exosomes, divide it into portions and store it at -80℃. The flow chart is as follows Figure 5 shown.

[0097] 3.2 Electron microscopy detection of tumor cell-derived exosomes

[0098] The extracted exosomes were resuspended in 20-30 μL PBS, 10 μm was added to the copper grid of transmission electron microscope for precipitation for 5 min, the floating liquid was aspirated with filter paper, 10 μm of phosphotungstic acid counterstaining solution was added to the copper grid of transmission electron microscope for precipitation for 5 min, the floating liquid was aspirated with filter paper, and the mixture was dried at room temperature and observed by the microscope.

[0099] Figure 6 The electron microscopy image showed that the size of exosomes was about 50 to 150 nm, and the exosomes had a saucer-like shape, indicating that there was no significant difference between the overexpressed OVA exosomes and the control group, which was consistent with the structure of exosomes.

[0100] 3.3 Analysis of the particle size of tumor cell-derived exosomes

[0101] The extracted exosomes were resuspended in 2 mL of PBS and placed in a Nano ZS90 Plus (Malvern, UK) for exosome size analysis. Figure 7 As shown, the particle size of the exosomes detected is between 60 and 100 nm, which corresponds to the size of the exosomes detected by TEM and is consistent with the particle size range of the exosomes.

[0102] 3.4 Detection of exosome particle number from tumor cells

[0103] The extracted exosomes were resuspended in 2 mL of PBS, and the control and OVA EVs groups were diluted 10 and 20 times, respectively, and nanoflow cytometry was performed. This test is a routine operation in the field and will not be described here. Figure 8 As shown in the figure, the number of particles in the Control group was 4.73E+11Particles / mL when diluted 10 times, while the number of particles in the OVA EVs group could reach 5.26E+11Particles / mL when diluted 20 times. The results showed that the number of exosome particles extracted from tumor cells in the OVA EVs group was significantly higher than that in the Control group.

[0104] 3.5 Western blot detection of tumor cell-derived exosomes

[0105] Add protein lysis buffer to the extracted exosome precipitate and place on ice for 10-20 minutes, shaking 4-6 times, 20-30 seconds each time. Then centrifuge at 4°C and 11000 rpm for 3-5 minutes, transfer the supernatant to a new centrifuge tube, and perform Western blot to detect OVA protein expression. The results are as follows: Fig. 9The results showed that the expression of OVA protein could be detected in the OVAEVs group extracted by ultracentrifugation.

[0106] 3.6 Cellular exosome uptake experiment

[0107] The exosome fluorescent material Cy5 (Xi'an Qiyue Biotechnology, Q-0345731) was prepared and mixed with the exosomes extracted above to connect the dye to the exosomes. Then, the excess dye was washed away. A small amount of exosomes containing Cy5 fluorescent dye were added to the cultured tumor cells. The culture was continued for 1 to 4 hours. The supernatant was aspirated and washed 2 to 3 times with PBS. The cells were placed under an inverted fluorescence microscope for detection. The results were as follows: Fig.10 As shown, the exosomes overexpressing OVA can be observed to have obvious Cy5 fluorescent dye compared with the control group.

[0108] Red fluorescent signal.

[0109] 3.7 Effects of exosomes on tumor cell proliferation

[0110] Control and OVA EVs cells were co-cultured with mouse colon cancer cell CT26 cells in 1640 culture medium at 37°C and 5% CO2. The proliferation of mouse colon cancer cells at 24, 48, 72 and 96 hours of culture was detected by CCK8 (Biyuntian Biotechnology Co., Ltd., C0037). The detection steps were carried out according to the instructions of the kit. The results are shown in Fig.11 As shown, OVA EVs have an inhibitory effect on cancer cells. After 96 hours of co-culture, the survival rate of cancer cells in the OVA EVs group was only about 60%.

[0111] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0112] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. Use of OVA in promoting cells to produce and / or release exosomes.

2. The use according to claim 1, characterized in that The nucleotide sequence of OVA is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting or misplacing one or more bases in the sequence shown in SEQ ID NO: 1; Preferably, the cells are tumor cells.

3. Use of a reagent in preparing a kit, wherein the reagent is used to regulate the expression or activity of OVA, and the kit is used to regulate the production and / or release of exosomes in cells.

4. The use according to claim 3, wherein the reagent is used to promote the expression or activity of OVA, and the kit is used to promote the production and / or release of exosomes in cells; Optionally, the reagent includes at least one of a viral vector and a virus for overexpressing OVA.

5. The use according to claim 3, wherein the reagent is used to inhibit the expression or activity of OVA, and the kit is used to inhibit the production and / or release of exosomes in cells; Optionally, the reagent includes siRNA for inhibiting OVA expression; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:

2.

6. Use of an agent in the preparation of a drug, wherein the agent is used to promote the expression or activity of OVA in tumor cells, and the drug is used to treat and / or prevent cancer, or to increase the immune killing effect on tumor cells; Optionally, the reagent includes at least one of a viral vector and a virus for overexpressing OVA.

7. A method for regulating cell production and / or release of exosomes, characterized in that: include: contacting the cells to be treated with an agent for regulating the expression or activity of OVA; Optionally, the cell is a tumor cell. 8 . The method according to claim 7 , wherein the agent is used to promote the expression or activity of OVA, and the agent comprises at least one of a viral vector and a virus for overexpressing OVA.

9. The method according to claim 7, wherein the agent is used to inhibit the expression or activity of OVA, and the agent comprises siRNA for inhibiting the expression of OVA; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:2.

Images