Application of MicroRNA-31 in repairing intestinal damage induced by vomitoxin
By regulating the expression of MicroRNA-31 in cellular and animal models, and using CRISPR/Cas9 technology to build a targeted treatment strategy, the problem of lack of effective treatment of intestinal damage induced by vomiting toxin was solved, the intestinal barrier function was significantly improved, and the healthy growth and breeding benefits of piglets were ensured.
Patent Information
- Application Number
- CN202411913069.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-24
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2044-12-24
AI Technical Summary
The prior art lacks effective treatment methods to repair intestinal damage induced by vomiting toxin (DON), and the existing prevention and treatment measures are limited in effect, and a comprehensive targeted treatment plan is lacking.
MicroRNA-31 and its related vectors and sgRNA are used to overexpress or knock out MicroRNA-31, and CRISPR/Cas9 technology is used to regulate its expression in cellular and animal models, and targeted therapeutic strategies are constructed, including the use of knockout vectors, silencing vectors and overexpression vectors, and engineered bacteria are used to repair intestinal damage induced by vomitotoxin.
It significantly improved the intestinal damage induced by vomiting toxin, improved the expression of intestinal barrier functional indicator parameters, provided new therapeutic targets, and helped to ensure the healthy growth of piglets and the economic benefits of farmers.
Smart Images

Figure CN119685405B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of DON-induced intestinal damage, and in particular to the application of MicroRNA-31 in repairing DON-induced intestinal damage. Background Art
[0002] Deoxynivalenol (DON), a common mycotoxin, has been extensively studied. Produced primarily by fungi, DON can cause a variety of health problems in animals, playing a particularly important role in intestinal damage in piglets. Studies have shown that DON significantly impacts piglet growth, development, and intestinal function, leading to symptoms such as diarrhea and nutrient malabsorption. Currently, research on DON-induced intestinal damage focuses primarily on its direct effects on cells and the mechanisms underlying this process. Studies have shown that DON damages intestinal epithelial cells by inducing apoptosis and inhibiting cell proliferation. Currently, there is a lack of effective treatments to repair intestinal damage caused by DON.
[0003] In addition, relevant literature also mentions some preventive and therapeutic measures for DON, but existing treatments often focus on reducing DON intake or reducing its toxicity, and most methods have limited effectiveness. In addition, existing research has mostly focused on single treatment strategies and lacks comprehensive targeted treatment options. Therefore, developing new targeted gene regulation strategies to improve DON-induced intestinal damage has become a hot topic and a challenge in current research. MicroRNA, as an important gene regulatory factor, has been found in recent years to play a key role in various biological processes. Summary of the Invention
[0004] The purpose of the present invention is to provide the use of MicroRNA-31 in repairing intestinal damage induced by vomitoxin, so as to provide a new treatment or intervention target for the treatment of intestinal damage induced by vomitoxin.
[0005] To achieve the above objectives, the present invention provides the use of MicroRNA-31 in repairing intestinal damage induced by vomitoxin. The CDS sequence of MicroRNA-31 is shown in SEQ ID NO.1. Overexpression of MicroRNA-31 reduces the degree of intestinal damage induced by vomitoxin and significantly increases the expression levels of intestinal barrier function index parameters. Knockout of MicroRNA-31 aggravates the degree of intestinal damage induced by vomitoxin and significantly decreases the expression levels of intestinal barrier function index parameters.
[0006] Preferably, the intestinal barrier function index parameters are ZO-1, Occludin, and Claudin-1.
[0007] The use of the sgRNA targeting the above-mentioned MicroRNA-31 in repairing intestinal damage induced by vomitoxin, the sequence of the sgRNA is shown in SEQ ID NO.3, the sequence of the upstream primer MicroRNA-31A1-sgR-F is shown in SEQ ID NO.5, and the sequence of the downstream primer MicroRNA-31A1-sgR-R is shown in SEQ ID NO.6.
[0008] The use of a vector containing the above-mentioned MicroRNA-31 in repairing intestinal damage induced by vomitoxin, wherein the vector includes a knockout vector, a silencing vector, and an overexpression vector.
[0009] The use of engineered bacteria containing the above-mentioned MicroRNA-31 vector in repairing intestinal damage induced by vomitoxin, the engineered bacteria including Escherichia coli and Agrobacterium.
[0010] As mentioned above, MicroRNA-31 is used in the breeding of vomitoxin-resistant animal varieties.
[0011] As described above, MicroRNA-31 is used in the construction of gene-edited cells or animal models, and the gene-edited cells or animal models are used to study the repair of vomitoxin-induced intestinal damage in pigs.
[0012] A kit comprising the above-mentioned MicroRNA-31 sgRNA sequence, CRISPR / Cas9 plasmid or overexpression vector.
[0013] Use of the above-mentioned kit in repairing vomitoxin-induced intestinal damage in pigs.
[0014] Therefore, the application of MicroRNA-31 provided by the present invention in repairing intestinal damage induced by vomitoxin has the following specific technical effects:
[0015] (1) The present invention discloses for the first time that MicroRNA-31 plays an important role in repairing intestinal damage induced by vomitoxin. Overexpression of MicroRNA-31 reduces the degree of intestinal damage induced by vomitoxin and significantly increases the expression of intestinal barrier function index parameters. Knockout of MicroRNA-31 aggravates the degree of intestinal damage induced by vomitoxin and significantly decreases the expression of intestinal barrier function index parameters.
[0016] (2) The present invention provides a new and effective treatment or intervention target for vomitoxin-induced intestinal damage, which helps to develop new targeted gene regulation strategies for the treatment of vomitoxin-induced intestinal damage, and helps to ensure the healthy growth of piglets and the sustainable and stable economic benefits of farmers. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.
[0018] Figure 1 : is a vector structure diagram of the knockout vector pLenti-U6-gRNA-Cas9-P2A-EGFP-Hygro used in Example 1 of the present invention;
[0019] Figure 2 This is an electrophoresis diagram of the PCR product of the genomic DNA of the monoclonal cell in Example 1 of the present invention;
[0020] Figure 3 is the sequencing result of Sanger sequencing of a single colony in Example 1 of the present invention;
[0021] Figure 4 The miR-31 after 10 generations of passage in Example 1 of the present invention - / - Photos of homozygous knockout cell lines;
[0022] Figure 5 is a vector structure diagram of the expression vector used in Example 2 of the present invention;
[0023] Figure 6 This is the result of fluorescence microscopy observation of the expression of MicroRNA-31 in the IPEC-J2 cell line stably expressing MicroRNA-31 in Example 2 of the present invention;
[0024] Figure 7 This is a melting curve diagram of the relative quantitative qPCR test in Example 2 of the present invention;
[0025] Figure 8 This is the result of investigating the effects of knocking out and overexpressing MicroRNA-31 on the expression levels of intestinal barrier function indicators ZO-1, Occludin, and Claudin-1 in Example 3 of the present invention. DETAILED DESCRIPTION
[0026] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.
[0027] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.
[0028] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources, and the methods and steps not described in detail in the examples are conventional techniques in the art.
[0029] Example 1
[0030] Preparation and identification of microRNA-31 knockout IPEC-J2 cell lines. The specific steps are as follows:
[0031] S1.1. sgRNA design and knockout vector construction.
[0032] An sgRNA sequence was designed targeting the region of MicroRNA-31 (Gene ID: 104796810, located on chromosome 1 at positions 201198469-201199088, sequence shown in SEQ ID NO. 2). The sgRNA sequence is shown in SEQ ID NO. 3, with the first and last three bases being the PAM sequence. Primers were designed for the designed sgRNA sequence and the designed primer sequences were sent to the company for synthesis of the sgRNA primer pair. The sequence of the upstream primer, MicroRNA-31A1-sgR-F, is shown in SEQ ID NO. 5, and the sequence of the downstream primer, MicroRNA-31A1-sgR-R, is shown in SEQ ID NO. 6.
[0033] SEQ ID NO.1:
[0034] ACTGGAGAGGAGGCAAGATGCTGGCATAGCTGTTAAACTGAGAACCTGCTATGCCAACATATTGCCATCTTTCTTGTC
[0035] SEQ ID NO.2:
[0036] CCCCCCATCGTTTCACAAGCAGTCAGTAAACATTCTTGGGGCTCATTTTAGATCAAAGGCCATGAAAAAAGAAACTGGCCACAACCTTCCTGTGCTTAACTCTATCTTGAAAATTGGATGCTCTAAGAAGCTTGTGTTGTAATGTTCAGAAACTAGTTTGCATTTTCAATTAATGAGTGTGTTTTCCCTCTCTCAGGTGGAAGGGAAGATTTTGGAAAAGTAAAACACTGAAGAGGCATGGTGTGTTGCTCCTGTAACTTGGAACTGGAGAGGAGGCAAGATGCTGGCATAGCTGTTAAACTGAGAACCTGCTATGCCAACATATTGCCATCTTTCTTGTCTGACAGCAGCCATGGCCACCTGCGTGCTGCTCCTCCATGCACTGCTCCAGATGTGTGCCCTTCTTTGGATGTGGGTTTCTATGACATGGTACCGCTCACCTCCCTGACCTCTCCTGCCACACTCTGGTCACTCCATTTTAGCCACACTGGCCTTTCTGGCTGATCCTTGAATGTATCCAGGATGGTCCTGCCTCTTTCTCCTTATTTGGGTCTCTTGAGGATACCACCTCCTCAGGAAAGCCCTCCTGATCACACTCTTTAAAACAGCTATCATATCCT
[0037] SEQ ID NO.3: ACTGCTTGTGAAACGATGGGGGG
[0038] SEQ ID NO.4: CAGGTGTGAAGGGCGACTAGAGG
[0039] Following the instructions included with the sgRNA primers, the primers were dissolved in sterile distilled water at a concentration of 10 pmol each. Genomic DNA was extracted from selected monoclonal IPEC-J2 cells. The resulting genomic DNA was used as a template to amplify the CRISPR / Cas9-edited site using primers shown in SEQ ID NOs. 5 and 6, followed by PCR sequencing. The following reaction system was prepared: 0.25 μL each of the upstream and downstream primers, 9.5 μL of sterile distilled water, 12.5 μL of SYBR Premix Ex Taq, 2.0 μL of genomic DNA (100 ng / μL), and 0.5 μL of dye. The reaction system was mixed thoroughly and annealed in a PCR instrument at 94°C for 5 minutes and then at 60°C for 60 minutes.
[0040] The annealed product was fused with the pLenti-U6-gRNA-Cas9-P2A-EGFP-Hygro vector (purchased from Biyuntian Biotechnology, product number: D8309) linearized with BsmBI (NEB) (see vector diagram). Figure 1 Connect according to the instructions included with the carrier.
[0041] The ligation product was electroporated into IPEC-J2 cells, plated, and cultured overnight in an incubator at 37°C, 5% CO2, and 95% relative humidity. The next day, a single colony was picked for Sanger sequencing identification. The upstream primer sequence for sequencing was shown as SEQ ID NO.5, and the downstream primer was shown as SEQ ID NO.6. Positive clone colonies with correct sequencing results were selected and expanded in an incubator at 37°C, 5% CO2, and 95% relative humidity. The plasmid was extracted using an endotoxin removal kit to obtain a vector for correctly expressing sgRNA, which was named "pLenti-U6-MicroRNA-31-KO."
[0042] SEQ ID NO.5: GATGGACACAACTTGTTTTCAGTTC
[0043] SEQ ID NO.6: TCTTTTCTAGGGCTGCACATGTA
[0044] S1.2. Preparation and identification of MicroRNA-31 knockout cell lines.
[0045] Porcine small intestinal epithelial cells (IPEC-J2) were tested for fungal, bacterial, and mycoplasma contamination to ensure that the IPEC-J2 cells were free of microbial contamination. After passing the test, routine cell culture was performed, and their proliferation capacity was tested before transfection. IPEC-J2 cells were transfected with pMD2.G:psPAX2:pLenti-U6-MicroRNA-31-KO at a mass ratio of 1:2:3 for lentiviral packaging. Subsequently, IPEC-J2 cells were inoculated with lentivirus and single cells were isolated by flow cytometry and transferred to 96-well cell culture plates for expansion. Genomic DNA from the single clones was then extracted using the Tiangen DNA Extraction Kit (KG203). Targeting the sgRNA target genomic region, amplification primers were designed using NCBI-BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The sequence of the upstream primer MicroRNA-31A1-PCR-F is shown in SEQ ID NO. 7, and the sequence of the downstream primer MicroRNA-31A1-PCR-R is shown in SEQ ID NO. 8.
[0046] SEQ ID NO.7: GATGGACACAAACTTGTTTTCAGTTC
[0047] SEQ ID NO.8: TCTTTTCTAGGGCTGCACATGTA
[0048] The genomic DNA of the obtained monoclonal cells was used as a template, and a PCR reaction was performed using the designed amplification primer pair targeting the sgRNA target genome. The upstream primer sequence is shown in SEQ ID NO.9, and the downstream primer sequence is shown in SEQ ID NO.10. The result was a positive clone. The positive clone colony was selected and expanded in an incubator at 37°C, 5% CO2, and 95% relative humidity. The electrophoresis of the plasmid PCR product was extracted using an endotoxin removal kit. Figure 2 As shown, the PCR product of the wild type WT is 1270 bp, and the PCR product of the MicroRNA-31-KO homozygote is 560 bp.
[0049] SEQ ID NO.9: GATGGACACAACTTGTTTTCAGTTC
[0050] SEQ ID NO.10: TCTTTTCTAGGGCTGCACATGTA
[0051] The sequencing results are as follows Figure 3 As shown, miR-31 was successfully obtained - / - Homozygous knockout cells. miR-31 after 10 generations- / - Knockout homozygous cells such as Figure 4 As shown, it shows that passage does not affect miR-31 - / - Normal proliferation of homozygous knockout cells.
[0052] Example 2
[0053] The construction and preparation of IPEC-J2 cell lines stably expressing microRNA-31 were performed as follows:
[0054] S2.1. Construction of MicroRNA-31 overexpression vector.
[0055] IPEC-J2 cells were selected as the experimental model. IPEC-J2 cells are a cell line derived from the piglet intestine and exhibit favorable intestinal epithelial cell characteristics. IPEC-J2 cells were cultured in DMEM / F-12 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a 37°C, 5% CO2 incubator. Subsequent manipulations were performed when the cells reached 80% confluency.
[0056] Primers were designed for MicroRNA-31 (Gene ID: 104796810). The upstream primer sequence is shown in SEQ ID NO. 5, and the downstream primer sequence is shown in SEQ ID NO. 6. The primers were dissolved in sterile distilled water to a concentration of 10 pmol according to the accompanying instructions. PCR amplification was performed using IPEC-J2 cell RNA as the template. The reaction system consisted of 0.25 μL of each upstream and downstream primer, 9.5 μL of sterile distilled water, 12.5 μL of SYBR Premix Ex Taq, 2.0 μL of IPEC-J2 cell RNA, and 0.5 μL of dye. The reaction system was mixed and annealed in a PCR instrument: 95°C for 5 min; 94°C for 15 s, 60°C for 45 s, 40 cycles; 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, and 60°C for 15 s.
[0057] The amplified product was sent to the company to synthesize the overexpression vector (named LV-EF1a>EGFP / pri-ssc-mir-31-PGK>Puro) and the control vector (named LV-EF1a>EGFP-PGK>Puro). The structure of the overexpression vector used is shown in the figure. Figure 5 shown.
[0058] S2.2. Use the method described in step S1.2 of Example 1 (except replace the knockout vector in step S1.2 of Example 1 with the overexpression vector LV-EF1a>EGFP / pri-ssc-mir-31-PGK>Puro). Package the overexpression vector into lentivirus and titer it to ensure that the virus quality meets the requirements of subsequent experiments. Perform bacterial, fungal, and mycoplasma tests to ensure that the porcine intestinal epithelial cells (IPEC-J2) are free of microbial contamination.
[0059] The constructed microRNA-31 overexpression vector was transfected into IPEC-J2 cells using a liposome transfection reagent. Following the ratio in the liposome transfection reagent instructions, the microRNA-31 overexpression vector was mixed with the transfection reagent, gently shaken, and allowed to stand for 5 minutes. The cells were then added to the cell culture medium containing IPEC-J2 cells and gently mixed. The cells were cultured for 24 hours after transfection to ensure that the cells had adapted to the transfection. 24 hours after transfection, selection medium (DMEM-F12 medium) containing 0.5 μg / mL puromycin was added for selection. After 1-2 weeks of selection, the cell growth was observed, and surviving cells were selected for expansion to obtain an IPEC-J2 cell line stably expressing microRNA-31.
[0060] The expression level of MicroRNA-31 in the IPEC-J2 cell line stably expressing MicroRNA-31 was observed by fluorescence microscopy to confirm its overexpression effect in IPEC-J2 cells. Figure 6 As shown, the target gene MicroRNA-31 showed high expression of green fluorescent protein in the IPEC-J2 cell line, indicating that the IPEC-J2 cell line overexpressing MicroRNA-31 can proliferate and grow normally.
[0061] The expression level of MicroRNA-31 in the IPEC-J2 cell line stably expressing MicroRNA-31 was detected by qPCR technology. The relative quantitative qPCR test was performed using the genes and primer sequences listed in Table 1. -ΔΔCT The data were analyzed and processed by the PCR method to confirm the overexpression effect in IPEC-J2 cells.
[0062] Table 1
[0063]
[0064] The results are shown in Table 2. Figure 8 As shown, the expression efficiency of MicroRNA-31 in the IPEC-J2 cell line was 4301.4%, indicating that the target gene MicroRNA-31 was successfully highly expressed in the IPEC-J2 cell line.
[0065] Table 2
[0066]
[0067] Example 3
[0068] The effects of DON induction on MicroRNA-31 knockout and overexpression IPEC-J2 cell lines were investigated as follows:
[0069] S3.1. Selection and culture of cell lines.
[0070] The IPEC-J2 cell lines constructed in Example 1 and Example 2, with knockout and overexpression of microRNA-31, were selected as experimental subjects. IPEC-J2 cells were cultured in DMEM / F-12 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a 37°C, 5% CO2 incubator. Subsequent experiments were performed after the cells reached 80% confluency. These cells were designated as the treatment group. A control group, cultured in medium without DON, was maintained under the same culture methods and conditions as the treatment group.
[0071] S3.2. DON induction test.
[0072] The 80% confluency IPEC-J2 cells obtained in step S3.1 were treated separately with DON (1.0 μg / mL) and the control group (80% confluency). The treatment method was described in Zha, A., Liao, S., Tan, B., Liao, P. (2023). Integrated lncRNA transcriptomics, proteomics, and metabolomics to identify early cellular response variation in deoxynivalenol-treated IPEC-J2 cells. Food and chemical toxicology, 177, 113863. The cells were mixed and cultured for 24 hours. After treatment, cell samples were collected for subsequent analysis.
[0073] S3.3. Analysis of intestinal barrier function.
[0074] The expression levels of intestinal tight junction proteins in cells were detected by ELISA to evaluate the effects on intestinal barrier function.
[0075] The results are as follows Figure 8As shown in the results, compared with the control group, after knocking out MicroRNA-31, the degree of DON-induced damage to IPEC-J2 cells was aggravated, and the intestinal barrier function indicators ZO-1, Occludin, and Claudin-1 parameters were significantly decreased; while overexpression of MicroRNA-31 After treatment, the degree of DON-induced damage to IPEC-J2 cells decreased, and the expression levels of intestinal barrier function indicators ZO-1, Occludin, and Claudin-1 parameters increased significantly.
[0076] Therefore, the present invention discloses for the first time that MicroRNA-31 plays an important role in repairing vomitoxin-induced intestinal damage. Overexpression of MicroRNA-31 reduces the degree of vomitoxin-induced intestinal damage, and the expression levels of intestinal barrier function index parameters are significantly increased; knockout of MicroRNA-31 aggravates the degree of vomitoxin-induced intestinal damage, and the expression levels of intestinal barrier function index parameters are significantly decreased; it provides a new and effective treatment or intervention target for vomitoxin-induced intestinal damage, helps to develop new targeted gene regulation strategies for the treatment of vomitoxin-induced intestinal damage, and helps to ensure the healthy growth of piglets and the sustained and stable economic benefits of farmers.
[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. Application of microRNA-31 in the preparation of a product for repairing vomitoxin-induced intestinal damage in pigs, characterized by: The sequence of microRNA-31 is shown in SEQ ID NO.1; by overexpressing microRNA-31, the degree of vomitoxin-induced pig intestinal damage is reduced, and the expression levels of proteins related to pig intestinal barrier function index parameters are increased; the proteins related to pig intestinal barrier function index parameters are ZO-1, Occludin, and Claudin-1.
2. Use of a vector expressing microRNA-31 in the preparation of a product for repairing vomitoxin-induced intestinal damage in pigs, characterized by: The vector is a vector for overexpressing MicroRNA-31; the sequence of MicroRNA-31 is shown in SEQ ID NO.
1.
3. Use of an engineered bacterium containing a vector expressing microRNA-31 in the preparation of a product for repairing vomitoxin-induced intestinal damage in pigs, characterized in that: The engineered bacteria include Escherichia coli and Agrobacterium; the vector is a vector for overexpressing MicroRNA-31; the sequence of MicroRNA-31 is shown in SEQ ID NO.1.