Pharmaceutical preparation for diagnosing and treating alzheimer disease

Abstract

The invention belongs to the field of biological medicine, and relates to a marker for early diagnosis of Alzheimer's disease and application thereof. In particular discloses a marker for early diagnosis of the Alzheimer's disease, the marker is a Maf1 gene or a protein thereof, and when the Maf1 gene or the protein thereof is highly expressed in neuronal cells, a testee is a crowd with high incidence of the Alzheimer's disease. The invention provides a new diagnosis and treatment target for AD.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a marker that can be used for early diagnosis of Alzheimer's disease and a pharmaceutical preparation for its treatment. Background Art

[0002] Alzheimer's Disease (AD) is a progressive, irreversible, and degenerative brain disease characterized by progressive dementia. The pathological changes of this disease are widespread brain atrophy, also known as diffuse brain atrophy. As human life expectancy increases and age increases, the incidence of this disease has also tended to increase, and it has attracted increasing attention. The clinical manifestations of Alzheimer's disease are gradual onset, with mild personality changes, intellectual impairment, decreased judgment, lack of interest in surrounding things, fatigue, nervousness, anxiety, irritability, restless sleep, headache, dizziness, and then the following manifestations: ① memory impairment, mainly recent amnesia; ② thinking and judgment disorders; ③ personality changes; ④ emotional disorders: depression, taciturnity, etc.; ⑤ hallucinations and delusions: mainly auditory hallucinations, more common at night; ⑥ loss of the ability to integrate information obtained from sight, hearing, touch, and smell. As a result, the patient cannot live independently, and the disease progresses further. The patient cannot remember the names of relatives, or even recognizes relatives. The patient speaks incoherently and stutters, has poor appetite, and loses weight significantly. Finally, the patient's physical condition is so poor that he is bedridden, incontinent, and often dies due to infection. The basic symptom of Alzheimer's disease is organic dementia, but various psychiatric symptoms may also occur. Strecker et al. divide Alzheimer's disease into five types: simple dementia, delirium, paranoia, anxiety and depression, and premature senility. Among them, one of the typical symptoms of Alzheimer's disease is memory impairment, but the memory impairment of Alzheimer's disease is different from ordinary insomnia and amnesia. Ordinary insomnia and amnesia is the loss of memory traces in the brain, which manifests as the inability to recall things that have been perceived in the past. It is temporary amnesia, and the amnesia of memory may be restored under appropriate conditions. And the self-awareness of ordinary insomnia and amnesia patients generally remains intact, that is, the patient recognizes his abnormal mental activities, feels pain for this, and actively seeks medical help. The symptoms of insomnia and amnesia can be improved through psychological adjustment or other relaxation methods. However, Alzheimer's patients generally lack self-awareness, cannot recognize their own pathological manifestations, and have permanent amnesia, and cannot recall all events or experiences within a period of time. This is because the memory impairment in Alzheimer's disease often has an organic brain lesion as its basis.

[0003] Although the cause of AD is not yet fully understood, there are some known risk factors that cause the disease. Taking preventive measures against these risk factors should be able to achieve certain results. Its causes are classified into the following categories: head trauma, education level, family history of dementia, family history of Down syndrome and Parkinson's disease, previous medical history, aluminum pots, etc. Among them, boxers are prone to AD after repeated head trauma, which is called Dementia Pugilistica (Punchdrunk syndrome). Studies have shown that people with a history of head trauma have a significantly increased risk of developing the disease (RR is 1.8) (M onique MB, Breteler, Jules J. Claus, Cornelia M. Van Duijn, et al. Epidemiology of Alzheimer's Disease. Epidemiologic Reviews, 1992, 14: 59-82). Control studies have also found that head trauma accompanied by loss of consciousness and the occurrence of AD are positively correlated. If there is a history of head trauma 10 years before the onset of the disease, it is more likely to develop the disease; trauma-induced disease is more common in men. Previous medical history studies have shown that Alzheimer's disease is related to a history of thyroid disease. Therefore, both genetic and environmental factors can independently increase the risk of AD, and it is also conceivable that the combination of the two can have a greater impact on the occurrence of the disease. Cornelia M et al.'s study showed that those with both head trauma and a family history of dementia had an OR value of 9.2.

[0004] The hippocampus is an important tissue in the central nervous system, mainly involved in advanced physiological functions such as learning, memory, and emotion. Hippocampal neuron damage can affect hippocampal function, eventually evolving into learning disabilities, memory dysfunction, depression, and temporal lobe epilepsy, which is one of the pathological characteristics of Alzheimer's disease. By inhibiting hippocampal damage and improving hippocampal neuroplasticity, the symptoms of Alzheimer's disease can be alleviated to a certain extent.

[0005] Neuroinflammation also plays an important role in neurodegenerative diseases. Neuroinflammation is an inflammatory response that occurs in the brain and can be caused by a variety of factors, such as brain trauma, β-amyloid deposition, energy metabolism disorders, and even aging. Studies have shown that the large-scale release of pro-inflammatory factors can damage neurons and cause synaptic loss and neuronal death, which is related to the patient's condition and plays an important role in assessing the condition of Alzheimer's disease.

[0006] Studies have found that the decreased antioxidant capacity and free radical accumulation in patients with Alzheimer's disease are important causes of neuronal toxicity, which in turn affects learning and memory functions. SOD and GSH-PX are important antioxidant enzymes in the body. Their activity decreases in patients with learning and memory disorders, and a large amount of free radicals are produced, causing damage to brain tissue function.

[0007] At present, the clinical diagnosis of Alzheimer's disease is based on (1) clinical examination showing dementia and a Mini-Mental Status Examination (MMSE). (1) The diagnosis of cerebral insufficiency is supported by the positive results of the following tests: (1) 2 or more cognitive impairments; (2) 3) progressive worsening of memory and other cognitive impairments; (3) unconsciousness; (4) absence of consciousness; (5) most cases occur after the age of 65; (6) other brain lesions that may cause progressive memory and cognitive impairment are excluded; (7) laboratory tests: normal CSF in lumbar puncture, normal EEG or increased nonspecific slow waves; (8) CT shows progressive brain atrophy, often prominent in the frontal lobe; (9) radioisotope cistern scan shows enlarged ventricles that empty rapidly; (10) early EEG shows low amplitude and decreased alpha rhythm, followed by gradual disappearance of widespread theta and alpha waves, and later bursts or scattered delta waves, which may also be asymmetric on both sides. The diagnosis of Alzheimer's disease is generally believed to be confirmed only by pathological examination (neurofibrillary tangles and granulocytic vacuolar degeneration and senile plaques in neurons), but a detailed clinical course and related examinations to exclude other organic diseases that cause dementia can still be diagnosed clinically. The above diagnostic criteria are called NINCDS-ADRDA and are used by the United States and other countries (Alzheimer's Disease Epidemiology; Wang Zhijin et al., Chinese Journal of Epidemiology

[0008] 1998,(03),173-176).

[0009] Early-onset AD is mainly related to autosomal dominant inheritance, while late-onset AD is more closely associated with acquired factors. Studies have shown that high-risk factors for late-onset AD include hypertension, atherosclerosis, diabetes, smoking, and metabolic syndrome (NAGAIM, DOTE K, KATO M, et al. Visit-to-visit blood pressure variability and Alzheimer's disease: links and risks [J]. J Alzheimers Dis, 2017, 59(2): 515-526.); its pathological manifestations are mainly intracellular neurofibrillary tangles (NFTs) and extracellular Aβ deposition, and an increase in microglia can be seen in senile plaques (KENNEY K, IACONO D, EDLOW BL, et al. Dementia after moderate-severe traumatic brain injury: coexistence of multiple proteinopathies [J]. J Neuropathol Exp Neurol, 2018, 77(1): 50-63).

[0010] It is worth noting that AD is also a fatal neurodegenerative disease. AD pathological characteristics include senile plaques formed by the aggregation of beta-amyloid protein (Aβ) in the brain, neurofibrillary tangles (NFTs) formed by the aggregation of hyperphosphorylated Tau protein, chronic inflammatory response, synaptic loss and neuronal death, neurotransmitter deficiency, oxidative stress, inflammation, gene mutation, excitotoxic neurotoxins, etc. (Paasila, PJ, et al., Synapses, Microglia, and Lipids in Alzheimer's Disease. Front Neurosci, 2021.15: p.778822. 2022 Alzheimer's disease facts and figures. Alzheimers Dement, 2022.18(4): p.700-789.). Recent studies have also shown that in many Alzheimer's patients who do not have senile plaques and neurofibrillary tangles in their brains, the morphology and function of synapses have been significantly degraded, and some neurons have even died. Compared with amyloid plaque formation or neuronal loss, synaptic loss is the most obvious morphological correlate of cognitive impairment in early AD, and synaptic degeneration has become a biological marker of early AD (Lleó, A., et al., Changes in Synaptic Proteins Precede Neurodegeneration Markers in Preclinical Alzheimer's Disease Cerebrospinal Fluid. Mol Cell Proteomics, 2019. 18 (3): p. 546-560.). A recent study also found that transcriptional regulation coordinates and regulates synaptic plasticity (Michels, AA, et al., mTORC1 directly phosphorylates and regulates human MAF1. Mol Cell Biol, 2010. 30 (15): p. 3749-57.). In addition, studies have found that many transcriptional regulators in the brain after AD change significantly (Mathys, H., et al., Single-cell transcriptomic analysis of Alzheimer's disease. Nature, 2019. 570 (7761): p. 332-337.). However, the role of these transcription factors after AD is still unclear. Studies have also shown that NMDA receptors are ligand-gated ion channels that play a key role in memory formation. Presynaptic NMDA receptors regulate glutamate release and synaptic plasticity, which may be independent of Mg. 2+ and Ca2+ Controls spontaneous release, whereas evoked release depends on Mg 2+ Activation of NMDA extrasynaptic receptors can lead to long-term depression (LTD), spine retraction and synaptic loss, and cause glutamate excitotoxicity to cause AD (WANG R, REDDY PH. Role of glutamate and NMDA receptors in Alzheimer's disease [J]. J Alzheimers Dis, 2017, 57 (4): 1041-1048). Therefore, NMDA is one of the targets for the treatment of AD.

[0011] Maf1 is a highly conserved protein in humans, rats, mice, and lower animals such as fruit flies and silkworms. Maf1 was first discovered in Saccharomyces cerevisiae and can be a transcriptional regulator of RNA polymerase III. It plays an essential role in tumors, sugar metabolism, lipid metabolism, etc. by activating the PTEN pathway. In recent years, it has also been found that Maf1 binds to and blocks the transcription initiation and elongation regulated by RNA polymerase III. Moreso, it was found that it can regulate the activity of RNA polymerase I and RNA polymerase II. It is worth noting that the activity of Maf1 in yeast is regulated by various environmental factors, such as rapamycin, nutritional restriction caused by sugar deficiency, DNA damage, and yeast secretion defect environment, which can affect the activity of Maf1. Human Maf1 activity changes in the context of DNA damage signals and rapamycin. Studies have also found that Maf1 can regulate the function of mitochondrial in yeast cells. In addition to affecting the function of mitochondria, Maf1 can also regulate sugar metabolism, autophagy, lipid metabolism, etc., thereby playing a role in tumors, reproductive capacity, obesity, growth and development, life expectancy, etc. It is also highly expressed in the central nervous system, especially in the hippocampus and cortex. In addition, the latest research has shown that Maf1 can negatively regulate the growth of hippocampal neuron dendrites through the PI3K-AKT-mTOR signaling pathway, and negatively regulate the growth of dendritic spines to affect the learning and memory ability of mice in vivo (Chen, K., et al., Maf1 regulates dendritic morphogenesis and influences learning and memory. Cell Death Dis, 2020.11(7): p.606.). The report also confirmed the neuroprotective effect of Maf1 on the survival period after RGC injury and provided a potential therapeutic strategy for traumatic optic neuropathy. As a result, Maf1 has become a hot spot in the central nervous system. Therefore, it is of great significance to diagnose and treat Alzheimer's disease by exploring the morphology and potential function of Maf1 in regulating neuronal synapses and finding small molecules that regulate Maf1. Summary of the invention

[0012] In the present invention, under the pathological state of AD, the expression of the transcriptional regulatory protein factor Maf1 increases, and through Maf1 binding to the promoter region of Grin1, the expression of NMDAR1 is regulated, and the calcium homeostasis is further regulated, the morphological structure and number of dendritic spines are changed, and the function of synapses is affected. The present invention reveals that the Maf1-NMDAR1 pathway causes synaptic and calcium defects, and discovers small molecule compounds that can act on this pathway, providing a new diagnostic and therapeutic approach for AD. Based on this, the present invention is completed.

[0013] In a first aspect, the present invention provides a marker for early diagnosis of Alzheimer's disease, wherein the marker is Maf1 gene or its protein. When the Maf1 gene or its protein is highly expressed in neuronal cells, it indicates that the test subject is a high-risk group for Alzheimer's disease.

[0014] In a second aspect, the present invention provides a reagent or a kit for early diagnosis of Alzheimer's disease; the reagent or the kit contains a reagent capable of detecting the expression of Maf1 gene or its protein.

[0015] In a third aspect, the present invention provides an application of a Maf1 gene or its protein in the preparation of a product for early diagnosis of Alzheimer's disease, wherein the application is to determine whether the patient is a high-risk group for Alzheimer's disease based on the expression of the Maf1 gene or its protein in neuronal cells.

[0016] Furthermore, when the Maf1 gene or its protein is highly expressed in neuronal cells, the test subject is judged to be a high-risk group for Alzheimer's disease.

[0017] Furthermore, the product includes a chip and a test kit.

[0018] In a fourth aspect, the present invention provides an inhibitor for inhibiting the expression of Maf1 protein.

[0019] Furthermore, the inhibitors include, but are not limited to, chemically synthesized, naturally occurring compounds and / or biosynthesized substances.

[0020] Furthermore, the inhibitor includes one or more of compounds, proteins, enzymes, nucleic acids, hormones, antibodies and cytokines.

[0021] Further, the structure of the inhibitor is as follows: (ETHYL4-[3-(3-{[2-(AZEPAN-1-YL)ETHYL]CARBAMOYL}PIPERIDIN-1-YL)-3-OXOPROPYL]-3,5-DIMETHYL-1H-PYRROLE-2-CARBOXYLATE)

[0022]

[0023] In a fifth aspect, the present invention provides a promoter for promoting the expression of Maf1 protein.

[0024] Furthermore, the promoter includes but is not limited to chemically synthesized, natural compounds and / or biosynthetic preparations.

[0025] Furthermore, the promoter includes one or more of compounds, proteins, enzymes, nucleic acids, hormones, antibodies and cytokines.

[0026] In a sixth aspect, the present invention provides a use of a promoter for promoting the expression of Maf1 gene or protein in preparing an animal model, wherein the promoter is an experimental preparation.

[0027] Furthermore, the animal model may be a Maf1 overexpression model, a cognitive dysfunction model, etc.

[0028] In a seventh aspect, the present invention provides a use of an inhibitor for inhibiting the expression of Maf1 gene or its protein in the preparation of a drug for treating AD.

[0029] Furthermore, the inhibitors include, but are not limited to, chemically synthesized, naturally occurring compounds and / or biosynthesized substances.

[0030] Furthermore, the inhibitor includes one or more of compounds, proteins, enzymes, nucleic acids, hormones, antibodies and cytokines.

[0031] Further, the structure of the inhibitor is as follows: (ETHYL4-[3-(3-{[2-(AZEPAN-1-YL)ETHYL]CARBAMOYL}PIPERIDIN-1-YL)-3-OXOPROPYL]-3,5-DIMETHYL-1H-PYRROLE-2-CARBOXYLATE)

[0032]

[0033] In an eighth aspect, the present invention provides a pharmaceutical preparation for treating AD, wherein the pharmaceutical preparation contains an inhibitor for inhibiting the expression of Maf1 gene or its protein, and further comprises a pharmaceutically acceptable carrier thereof.

[0034] Further, the structure of the inhibitor is as follows: (ETHYL4-[3-(3-{[2-(AZEPAN-1-YL)ETHYL]CARBAMOYL}PIPERIDIN-1-YL)-3-OXOPROPYL]-3,5-DIMETHYL-1H-PYRROLE-2-CARBOXYLATE)

[0035]

[0036] Beneficial Effects

[0037] In the present invention, it is found that Maf1 regulates the expression of NMDAR1 by binding to the promoter region of Grin1, further regulating the calcium homeostasis and synaptic remodeling of neurons. Therefore, the present invention reveals that the Maf1-NMDAR1 pathway causes synaptic and calcium defects and provides a new diagnostic and therapeutic target for AD. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 .Maf1 expression is increased in AD patients and APP / PS1 mice. (A) Heat map of total differentially expressed genes in the AD and normal human brain databases in GSE5281. (B) Heat map of Maf1 expression in normal and AD patients in the database. (C) Maf1 expression is elevated in the AD patient human brain database compared with the corresponding non-dementia control group (n=13 and n=10, respectively). (DE) Quantitative Western blot analysis of primary hippocampal neurons with increased Maf1 in the hippocampus transfected with APPswe virus compared with Vector, APP WT virus. WB electrophoresis and statistical graphs. (FG) Comparison of Maf1 protein levels in hippocampal neurons of 6-month-old APP / PS1 mice with WT mice. n=4 mice per group. (HI) Shows the immunohistochemistry results of Maf1 in 6-month-old APP / PS1 mice. n=4 mice per group. (JK) Shows the immunofluorescence results of Maf1 in 6-month-old APP / PS1 mice. Data are expressed as mean ± SEM. *p<0.05; **p<0.01; ***p<0.001.

[0039] Figure 2 .Maf1 is expressed in dendrites of primary hippocampal neurons (A) Laser confocal microscopy was used to observe the purity of NeuN in primary neurons. Scale bar: 250 μm. (B) Laser confocal microscopy was used to observe the immunostaining of Maf1 and MAP2 in hippocampal neurons and brain slices cultured for 14 days from 6-month-old mice. Scale bar: top, 25 μm; bottom, 50 μm.

[0040] Figure 3.Construction of Maf1-eCKO1-APP / PS1 transgenic knockout mice. (A) Schematic diagram of the design strategy for constructing Maf1-eCKO1 conditional knockout mice. Based on the principle of homologous recombination, the Maf1 gene was modified by flox through homologous recombination of fertilized eggs. (B) Schematic diagram of hybridization of Maf1-eCKO1-APP / PS1 mice. (C) PCR identification of DNA of Maf1-eCKO1-APP / PS1 hybrid mice. (D) Schematic diagram of stereotaxic injection of adeno-associated virus. (E) Schematic diagram of experimental design. Morris water maze (MWM) test was performed 1 month after virus injection. (F) After injection of AAV-Cre virus, Western blotting was used to confirm the successful knockdown of Maf1 and the corresponding reduction of NMDAR1 in Maf1-eCKO1-APP / PS1 transgenic mice. (G) Fluorescence image of Maf1-eCKO1-APP / PS1 hybrid mice injected with AAV-Cre virus. Scale bar: 20um.

[0041] Figure 4 .Maf1 conditional knockout can improve the learning and memory function of AD mice. (A) Representative images of the water maze trajectories of mice in each group on day 5 of the acquisition training phase. (B) The latency to find the escape platform was measured on days 1-5 of the acquisition training phase. (C) Representation of the water maze trajectories of mice in each group on day 6 of the spatial exploration test phase. (DE) The percentage of time in the target quadrant and the number of times the target platform area was crossed during the spatial exploration phase of the three groups of mice. n = 10 mice per group. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.

[0042] Figure 5Conditional knockout of Maf1 in hippocampal neurons promotes the maturation of dendritic spines in AD. (A) Golgi staining of mouse hippocampal neurons. Analysis of dendritic spines in mouse hippocampal neurons after virus injection. Neurons were selected under a 40x microscope and the number of dendritic spines was analyzed under a 100x microscope. (B) High-magnification expression of dendritic spines in hippocampal neurons of WT mice and Maf1-eCKO1-APP / PS1 mice injected with AAV-syn-Cre-GFP and AAV-syn-GFP vectors after Golgi staining. Scale bar, 10m. (C) Statistical analysis of the density of dendritic spines in neurons of the above three groups of mice. (D) Statistical graph of the percentage of dendritic spines in neurons of the above three groups of mice. n = 7-10 neurons per group. (E) Fluorescence microscopy of GFP fluorescence in primary hippocampal neurons after transfection of shSCR and shMaf1 plasmids. The magnified images of the white boxes are shown below. Scale bar: top, 20m; bottom, 2m. (F) Statistical analysis of the density of dendritic spines in neurons in vitro. (G) Statistical graph of the classification percentage of dendritic spines in neurons in vitro. n = 3-6 neurons per group. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.

[0043] Figure 6 .Construction of interference shRNA virus and full-length virus of target gene Maf1 and verification in cell lines and primary neurons. (A) The virus was transfected into 293T cell line, and the green fluorescence intensity of GFP was high 72h after transfection. (BC) Western blotting was used to detect the knockdown effect of shRNA on Maf1 and the effect of Maf1 overexpression in 293T cell line. (DE) Western blotting was used to detect the knockdown effect of shRNA on Maf1 in primary neurons and the effect of Maf1 overexpression. (F) The Maf1 overexpression plasmid with Flag tag was transfected into neurons, and immunofluorescence staining was performed after 14 days of culture.

[0044] Figure 7 .Knockout of endogenous Maf1 in hippocampal neurons can improve cognitive function in AD.

[0045] (A) AAV-GFP green fluorescence expression can be seen in the hippocampus of brain slices of mice 1 month after virus injection. (B) Western blotting detected the expression of Maf1 in the hippocampus of AD mice injected with AAV-shMaf1. (C) Golgi staining of mouse hippocampal neurons. Selected neurons were analyzed under a 40x microscope and the morphology and number of dendritic spines were analyzed under a 100x microscope. (D) Representative dendritic spines of hippocampal neurons of WT mice and APP / PS1 mice injected with AAV-syn-shSCR and AAV-syn-shMaf1 after Golgi staining. Scale bar, 10m. (E) Statistical analysis of the density of dendritic spines in the neurons of the above three groups of mice. (F) Statistical graph of the classification percentage of dendritic spines in the neurons of the above three groups of mice. n = 7-10 neurons per group. (G) The latency to find the escape platform was measured on days 1-5 of the acquisition training phase. (HI) The percentage of time in the target quadrant and the number of times the target platform area was crossed during the spatial exploration phase of the three groups of mice. n = 10 mice per group. Data are expressed as mean ± SEM. *p<0.05; **p<0.01; ***p<0.001.

[0046] Figure 8 .Knockout of Maf1 can affect calcium homeostasis and amyloid plaque deposition in AD hippocampal neurons.

[0047] (A) Primary hippocampal neurons were cultured in vitro after infection with APP, shSCR, and shMaf1 lentiviruses. Green fluorescence under fluorescence microscopy represents Fura-4 / AM intensity. (B) Statistical quantitative graph of fluorescence intensity obtained in 4 groups. (CD) Immunohistochemistry and statistical results of Aβ plaques in 6-month-old Maf1-eCKO1-APP / PS1 mice. (EF) Immunohistochemistry and statistical results of Aβ plaques in 6-month-old Maf1-eCKO1-APP / PS1. *p<0.05; **p<0.01; ***p<0.001.

[0048] Fig. 9Conditional knockout of Maf1 rescues synaptic dysfunction in AD mice. (A) mEPSCs were recorded from neurons in the CA1 region of the hippocampus of WT and Maf1-eCKO1-APP / PS1 mice injected with AAV-syn-Cre-GFP and AAV-syn-GFP vectors according to the procedure of acute brain slice electrophysiology experiments. (B) The average mEPSC amplitude is shown on the right, and the average mEPSC amplitude is shown on the left. Calibration: 15 Pa, 1 s. WT, n = 15 neurons from 4 mice; AAV-syn-vector, n = 12 neurons from 4 mice; AAV-syn-Cre, n = 12 neurons from 4 mice. (C) The upper figure shows fEPSP recordings of CA3-CA1 channels. The stimulating electrode was placed in the Schaffer area of ​​CA3 and the recording pipette was placed in the stratum radiatum of CA1. Stimulating electrode and recording pipette. In LTP recordings, the baseline and the last 10 min represent fEPSP recordings. Calibration: 0.5 mV, 10 ms. (D) Quantitative analysis of the average fEPSP slope of the last 10 min of LTP in 4 mice, WT, n = 9 neurons; AAV-syn-vector, n = 9 neurons from 4 mice; AAV-syn-Cre, n = 11 neurons from 4 mice. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.

[0049] Fig.10 .RNAseq analysis suggested that Maf1 regulates the downstream gene Grin1, which is involved in the calcium signaling pathway and synaptic function.

[0050] (A) RNAseq sequencing detected changes in neuronal gene expression profiles after Maf1 loss in AD. The volcano plot showed 884 differentially expressed genes, of which 320 were upregulated (red scatter) and 564 were downregulated (blue scatter). (B) The differential gene heat map showed that there were differences in the gene expression profiles between the two groups. (C) GO enrichment analysis was performed on different genes, and the top 30 entries are shown in the figure. (D) The differential heat map showed that the Grin1 gene was significantly downregulated after Maf1 loss. (E) KEGG pathway enrichment map of the top 5 differentially expressed genes. (F) Gene set enrichment analysis (GSEA) showed that the calcium signaling pathway was associated with Grin1.

[0051] Fig.11.CUT&Tag sequencing showed that there is a protein-DNA interaction between Maf1 and Grin1 genes. (A) Annotation map of Maf1 binding peaks in the gene functional element region. (B) Distribution of the distance between Maf1 binding peaks and gene translation start (TSS) sites. (C) GO enrichment analysis of the top 10 entries of binding site genes is related to synapses and calcium ion binding. (D) The top 30 entries of KEGG enrichment analysis of binding sites show that the calcium signaling pathway is closely related to synaptic glutamine secretion. (E) Schematic diagram of the co-intersection genes of GO-synaptic and KEGG-synaptic enriched genes. (F) GO and KEGG protein interaction network analysis showed that Grin1 is located in the core.

[0052] Fig.12 .Maf1 regulates Grin1 promoter activity and promotes NMDAR1 expression.

[0053] (A) Protein levels of NMDAR1 in mouse hippocampus; (B) Statistical quantification of in vivo Western blotting results. (C) Changes in NMDAR1 protein content in primary neurons; (D) Statistical quantification of in vitro Western blotting results. (EF) Immunoprecipitation of Maf1 and NMDAR1 in hippocampal neurons. Maf1 does not directly bind to NMDAR1. (G) Four sequences were designed for primer synthesis based on the Grin1 promoter. ChIP-quantitative PCR results showed that four sequences in fragments 1, 2 and 3 were enriched in IP-Maf1. (H) Schematic diagram of the construction of wild-type Grin1 promoter luciferase (Luc) and mutant Grin1 promoter luciferase plasmids. (I) Grin1 wild-type and mutant promoter plasmids (MT) were co-transfected with pcDNA-NC and pcDNA-Maf1 into HEK293T cells. Luciferase activity was detected by dual luciferase reporter gene method. (JL) Grin1 wild-type and mutant promoter plasmids (MT1, MT2, MT3) were co-transfected with pcDNA-NC and pcDNA-Maf1 into HEK293T cells.

[0054] Fig.13 .Grin1 promoter mutation attenuates the morphological effects of Maf1 knockdown.

[0055] (A) Representative GFP fluorescence images of primary hippocampal neurons transfected with shSCR, shMaf1, Grin1WT, and MT plasmids under a fluorescence microscope. The following are local magnifications in the white box. Scale bars: top, 20 μm; bottom, 2 μm.

[0056] (B) Statistical analysis of the density of dendritic spines of neurons in vitro. (C) Statistical graph of the percentage of classified dendritic spines of neurons in vitro. n = 7-20 neurons per group. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001. Fig.14 .The mechanism by which the Maf1-NMDAR1 signaling pathway in Alzheimer's disease regulates neuronal calcium homeostasis and participates in synaptic remodeling. In AD, the expression of the transcriptional regulator Maf1 increases, and by binding to the promoter region of Grin1, it further regulates calcium homeostasis, changes the morphological structure and number of dendritic spines, and thus affects synaptic function, thereby regulating the expression of NMDAR1. Ultimately, it regulates synaptic remodeling and affects learning and memory functions.

[0057] Fig.15 .Establishment and detection of Maf1 protein-test object interaction determination model

[0058] Fig.16 , Results and trends of drug concentration changes in mouse blood

[0059] Fig.17 , Detection of compound content changes in mouse brain tissue and comparison of blood / brain tissue content

[0060] Fig.18 , IC50 curve of the compound of formula I in 293T cell line

[0061] Fig.19 IC50 curve of compound I in primary neurons

[0062] Fig. 20 IC50 curves of the compound of formula II in cell lines and primary neurons

[0063] Fig.21 Compound intervention can improve the density of dendritic spines in AD in vitro models

[0064] Fig. 22 Compound intervention can improve learning and memory abilities in AD animal models

[0065] Fig.23 Compound intervention can improve the density of dendritic spines in AD animal models

[0066] Fig.24 , Changes of gene transcriptome in AD hippocampus tissue after compound intervention DETAILED DESCRIPTION

[0067] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0068] The "diagnosis of Alzheimer's disease" mentioned in this article includes both determining whether the subject has already suffered from Alzheimer's disease and determining whether the subject has a risk of suffering from Alzheimer's disease.

[0069] The term "Aβ" as used herein refers to amyloid β protein.

[0070] The term "NFTs" as used herein refers to neurofibrillary tangles.

[0071] The term "NMDA" as used herein refers to NMDA receptor, N-methyl-D-aspartate receptor; an ionotropic glutamate receptor subtype; as a key excitatory ionotropic glutamate receptor, it is crucial in the formation of the nervous system and synaptic plasticity.

[0072] The term "CaN" as used herein 2+ Calcineurin.

[0073] The term "CaMKII" as used herein refers to calmodulin-dependent protein kinase II.

[0074] The term "LTP" as used herein: Long Term Potential.

[0075] The term "LTD" as used herein is long term depression.

[0076] The term "mEPSC" as used herein refers to a miniature excitatory postsynaptic potential.

[0077] As used herein, the term "fEPSPs" refers to field excitatory postsynaptic potentials.

[0078] The term "HFS" as used herein means high frequency stimulation.

[0079] The term "ACSF" as used herein refers to artificial cerebrospinal fluid.

[0080] The term "MWM" described herein refers to the MWM test: Morris water maze test.

[0081] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0082] Example

[0083] 1. Animals

[0084] APP / PS1 transgenic mice were derived from Shanghai Model Organisms with a C57BL / 6J genetic background. Shanghai Model Organisms constructed Maf1-eCKO1 transgenic mice, and floxed the recombination of fertilized eggs by homologous modification of the Maf1 gene. Based on the principle of homologous recombination, CRISPR / Cas9-mediated gene editing was used in mice with a C57BL / 6J background. Tissue-specific infection by local injection of AAV-Cre virus, coupled with a neuron-specific promoter driving the Cre gene, enabled stronger tissue-specific and neuron-specific gene recombination. Maf1-eCKO1 transgenic mice were further hybridized with APP / PS1 mice to obtain Maf1-eCKO1-APP / PS1 transgenic mice. ICR mice were purchased from Shanghai Jiesijie Laboratory. Animals were housed in a specific pathogen-free environment (23±2℃, 45±5% humidity, 12h light / dark cycle) with free access to pelleted feed and water.

[0085] 2. Generation of Plasmid and Viral Constructs

[0086] Design 3 shRNA target sequences and 1 scramble shRNA sequence based on the Maf1 gene, and synthesize primers. The primer sequences are as follows:

[0087] shRNA1:TTGGAGAACTCCAGCTTTGAGGCCATCAA;

[0088] shRNA2:TCTGCTTAGCTGAGTG TGACATCTACAGC;

[0089] shRNA3:CCTCAATGAGTCCTTCCGGCCAGACTATG;

[0090] scramble shRNA (shSCR): GCACTACCAGAGCTAACTCAGATAGTACT.

[0091] The following single-stranded primers were annealed into double-stranded oligo sequences and connected to the RNA interference vector linearized by double restriction enzyme digestion. The transformants were verified to be correct by sequencing, and high-purity plasmids were extracted.

[0092] The maf1 shRNA plasmid was constructed using the pGFP-CMV-ShLenti vector and further packaged into lentivirus. The Maf1 interference adeno-associated virus was constructed using the pAAV-hSyn-EGFP-3xFLAG-WPRE vector. The Cre interference adeno-associated virus was constructed using the pAAV-hSyn-EGFP-WPRE vector. The APP695swe (K595N / M596L) virus was expressed by the pSLenti-CMV vector. Both the lentivirus and the adeno-associated virus were commissioned by Obio Technology (Shanghai) and stored at -80°C.

[0093] 3. Cell Culture and Transfection

[0094] Primary hippocampal cultures were prepared from embryonic day 18 mouse brains (Xu, NJ and M. Henkemeyer, Ephrin-B3 reverse signaling through Grb4 and cytoskeletal regulators mediatesaxon pruning. Nat Neurosci, 2009. 12(3): p. 268-76.). Neurons isolated from hippocampal tissue were inoculated with poly-lysine and cultured in neurobasal medium containing B27 supplement and GlutaMAX. For neurons infected with lentivirus, concentrated lentivirus was added to the culture medium and cells were transfected on day 6 in vitro. The transfection efficiency was verified by fluorescence and protein levels after cell lysis. APPswe virus was transfected for 6 days in vitro (DIV), and then calcium phosphate transfection of shRNA plasmid was performed for 2 days, and then continued for 10 days to verify the regulatory effect of Maf1 on neuronal dendrite growth. When two plasmids were transfected at the same time, the plasmid carrying GFP was mixed with the other plasmid in a ratio of 1:3.

[0095] 4. Real-time Quantitative PCR

[0096] Total RNA was extracted from primary hippocampal cultures using Trizol reagent (Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed into cDNA using a kit (Yeasen, Shanghai, China). SYBR Green Master Mix (Yeasen) was used, and real-time qPCR was performed on a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA).

[0097] 5. Western Blotting

[0098] Mouse hippocampi were dissected, homogenized, and lysed in lysis buffer at 4°C for 30 min. The lysate was centrifuged at 12,000 g for 20 min at 4°C to remove insoluble sediments, and the protein concentration was estimated by bicinchoninic acid (BCA) protein assay kit (Thermo Scientific Rockford, IL, USA). Then, the proteins were denatured by boiling at 95°C for 10 min in sodium dodecyl sulfate (SDS) loading buffer. The proteins were run on a 10% polyacrylamide gel and then transferred to a nitrocellulose membrane. The membrane was blocked in TBST (150 mm NaCl, 10 mm Tris, 0.1% Tween 20, pH 7.6) containing 5% BSA for 1 h at room temperature. The primary antibody was diluted in blocking buffer and incubated overnight at 4°C. After washing with TBST, the blot was incubated with HRP-conjugated secondary antibody for 1 h at room temperature. After washing again, the blot was exposed to enhanced chemiluminescence substrate. The relative density of the exposed film was analyzed using ImageJ software for quantification. For primary antibodies, we used rabbit anti-Maf1 (1:500, Abcam, catalog ab230499), rabbit anti-β-actin antibody (1:1000, Cell Signaling Technology, catalog 8457S), mouse anti-GAPDH (1:3000, Invitrogen, catalog MA5-15738-D680), rabbit anti-NMDAR1 (1:1000, Abcam, catalog ab109182), mouse anti-NMDAR1 (1:1000, Abcam, catalog ab134308), rabbit anti-APP (6E10) antibody (1:1000, Novusbio, catalog NBP2-62566), and immunoprecipitation-rabbit IgG (1:1000, Abcam, catalog ab172730).

[0099] 6. Immunohistochemistry and Immunofluorescence

[0100] Primary hippocampal neurons were fixed with 4% paraformaldehyde (PFA) in PBS for 30 min and stored at 4°C. Mice were perfused and the brains were fixed with 4% PFA solution in PBS at 4°C overnight. 30 μm coronal brain slices were generated using a VT1000 vibratome (Leica Biosystems, Wetzlar, Germany). For immunohistochemistry (IHC), endogenous peroxidase activity was blocked with 3% H2O2 for 10 min at room temperature and blocked with blocking solution for 10 min at room temperature: 0.03% Triton X-100 (MilliporeSigma) and 10% donkey serum (Invitrogen) in PBS. The sections were then incubated with primary antibodies in antibody solution (PBS containing 0.03% Triton X-100 and 2% donkey serum) at 4°C overnight. The next day, the sections were incubated with enzymatic anti-rabbit antibodies and stained with a DAB kit (Vector Labs, Carlsbad, CA, USA). For immunofluorescence (IF), sections were blocked with blocking solution for 30 min, incubated with primary antibodies, and nuclei were stained with DAPI in antibody solution overnight. Sections were rinsed in PBS for 10 min and then incubated with Alexa Fluor secondary antibodies for 2 h at room temperature. Sections were rinsed in PBS for 10 min, then mounted with mounting medium and imaged. The following antibodies were used: rabbit anti-Maf1 (1:150, Abcam, catalog ab230499), chicken anti-Map2 (1:10000, Abcam, catalog ab5392), Alexa Fluor secondary antibodies (Alexa Fluor 488, Alexa Fluor 555, Alexa Fluor 647; 1:500, Thermo Fisher).

[0101] 7. Image Analysis and Quantification

[0102] Confocal (Leica SP8) to obtain high-resolution images of double immunofluorescence experiments. Z series of 7-12 images were taken at a resolution of 1024×1024 pixels, with a depth interval of 0.5m-1μm, and each image was averaged twice. The synthetic stack was flattened into a single image using maximum intensity projection (Jaworski, J., et al., Control of dendritic arborization by the phosphoinositide-3'-kinase-Akt-mammalian target of rapamycin pathway. J Neurosci, 2005. 25(49): p.11300-12.). The fluorescence intensity and cellular localization of the target protein were measured using a ×20 objective. For the analysis of dendritic spines, neurons were imaged with a ×63 objective and 2 zoom with a pixel resolution of 1024×1024. The spine shape was further quantitatively determined, and the neuronal spine shape was classified and GFP-positive cells were evaluated. Image J.

[0103] 8. Quantification of RNA-sequencing and Data Analysis

[0104] Total RNA was extracted using the mirVana miRNA Isolation Kit (Ambion). RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Samples with an RNA integrity number (RIN) ≥ 7 were subjected to subsequent analysis. Libraries were constructed using the TruSeq Stranded mRNA LTSample Prep Kit (Illumina, San Diego, CA, USA). These libraries were then sequenced on an Illumina sequencing platform (HiSeqTM 2500 or Illumina HiSeq XTen) and 125 bp / 150 bp paired-end reads were generated. Transcriptome sequencing and analysis were performed by OE biotech Co., Ltd. (Shanghai, China). Cutting and labeling analysis After anesthesia, hippocampal tissue and brain tissue were separated, and lysate was added to the collected tissue to split the tissue mass and promote rapid release of the nucleus, and ConA magnetic beads resuspended in Binding buffer were added. The target protein was bound to the primary antibody and incubated with the secondary antibody. Next, ChiTag transposon was used to bind antibodies and activate ChiTag transposon to fragment the target DNA. Finally, DNA was extracted, PCR was performed, and computer sequencing was performed after DNA purification. Shanghai Ouyi Biomedical Technology Co., Ltd. assisted in sequencing and data analysis.

[0105] 9. Co-immunoprecipitation (CoIP) assay

[0106] Thermo Scientific IP Lysis Buffer (Catalog No. 87787) was used. 1 μg of Maf1 antibody or NMDAR1 antibody was added to the protein extract and reacted at 4°C overnight. After incubation with protein G beads at 4°C for 3 hours, immunoblotting was performed and detected with the indicated antibodies.

[0107] 10. Chromatin Immunoprecipitation (ChIP)

[0108] Using Pierce TM ChIP assays were performed using an agarose ChIP kit (Thermo Fisher Scientific). Chromatin was extracted and DNA was cut into 0.2 kb to 1 kb fragments. Primary hippocampal neurons were cross-linked with 1% formaldehyde and chromatin was immunoprecipitated with antibody Maf1 (Abcam). IgG was used as a negative control. DNA was resuspended in 50 μL TE buffer and amplified by PCR. PCR products were determined on a 1.5% agarose gel. DNA was purified (TransGen Biotech, catalog number: No. EP101) and further analyzed by qPCR using primers against the Grin1 promoter. The ChIP-PCR primers used in this study are as follows:

[0109] Grin1-Promoter-F1: GCCCAAGAAGAGCCCAAGAA,

[0110] R1:CCAGGGAAGATTTGTCACGC;

[0111] Grin1-Promoter-F2: GACAGGGGTCTTAGACAGTGC,

[0112] R2: ACCCACACGTTCACACTCC;

[0113] Grin1-Promoter-F3: CTTTACATGGCAGGAGGGGG,

[0114] R3: CATCTTGCTCCCAGCAGTCA;

[0115] Grin1-Promoter-F4: CGGATCCAAGGTGGTGTT,

[0116] R4:TCTAGAGGGTGAGATAGGATTGCT.

[0117] 11. Dual luciferase reporter gene assay

[0118] Interaction between Maf1 and Grin1 promoter region. The plasmid vector was pGL3 promoter vector. Maf1 overexpression plasmid, wild-type Grin1 promoter luciferase (Luc), and mutant Grin1 promoter luciferase were constructed by Genomeditech Co. Ltd. Cells were co-transfected with WT or MT plasmid and Maf1 or negative control using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, Inc.). After 48 h of transfection, relative luciferase activity was determined using a dual-luciferase reporter gene assay kit (Promega, Madison, WI, USA). Firefly luciferase activity was normalized to Renilla luciferase activity. The experiment was performed in triplicate. Mutations on the Grin1 promoter were constructed at -1774 to 951 (MT), -1774 to -1697 (MT1), -1308 to -1217 (MT2), and -1039 to -951 (MT3).

[0119] 12. Calcium Imaging Experiment

[0120] Primary hippocampal neurons were treated with appswe lentivirus and shmaf1 lentivirus at DIV8. Calcium imaging experiments were performed at about DIV14-DIV16. Neurons were incubated with Fura-4 AM (Biyuntian, catalog number: S1061M) at a final concentration of 2umol / ml at 37°C for 30 minutes. After rinsing with saline, 340nm exited the cells and observed with an inverted fluorescence microscope at 510nm.

[0121] 13. Stereotaxic Injection

[0122] Mice were anesthetized using 1% sodium pentobarbital solution (50 mg / kg, intraperitoneal). A hole was drilled above the CA1 region of the hippocampus (front / back = ±1.25 mm, inside / outside = ±1.7 mm, back / ventral = ±1.6 mm). AAV2 / 9-syn-shSCR-GFP, AAV2 / 9-syn-shMaf1-GFP, AAV-syn-GFP vector or AAV-syn-Cre-GFP (10 12 IU / mL, 2 μL) was bilaterally microinfused into the hippocampus through the cannula connected to the Hamilton (Reno, NV) microinjector. The infusion rate was 0.2 μL / min, and the cannula was left in place for 10 min after the infusion was completed.

[0123] 14. Morris Water Maze

[0124] Learning and memory functions were assessed 1 month after AAV2 / 9 injection. The Morris water maze is a white circular pool (120 cm in diameter) filled with water and dyed white with milk. A platform (6 cm in diameter and 30 cm in height) was placed in one of the quadrants of the pool. The pool was filled with water at 20 ± 1 °C, and the platform was hidden 1 cm below the surface. The mice were placed in the same room as the water maze one day before the experiment to acclimate to the environment. During the acquisition phase, the mice were gently placed into the water from the inner wall of the pool in the non-target quadrant. At the same time, the experiment started recording, and the total recording time was 60 s. If the mouse found the platform and stayed for 3 s or more, it was judged that the mouse found the platform, and the recording stopped automatically. For mice that could not find the platform within 60 s, the latency was recorded as 60 s, and the mice should be guided to stay on the platform for 20 s. The latency and travel distance of the mice to find the platform were recorded. Spatial exploration phase: On the 6th day, the circular platform in the target quadrant was removed, and the straight-line distance farthest from the platform was selected as the water entry point for the mice. The mice were allowed to swim in the water for 60 seconds, and the number of times the mice crossed the platform, the total movement distance, and the percentage of time spent in each quadrant were recorded. The ANY-maze automatic video system (MEDAssociates, Georgia, VT, United States) was used to record all the activities of the mice through video cameras, collect and calculate the results for statistical analysis, and measure the latency to reach the platform position, the percentage of time spent in the target quadrant, and the number of times the platform was crossed.

[0125] 15. Golgi staining

[0126] Mice were anesthetized using 1% sodium pentobarbital solution (50 mg / kg, intraperitoneally). After immersion in a mordant solution for 3 days and then in a 1.5% AgNO3 solution at room temperature in a dark environment for 5 days, the brain tissue was dehydrated in a gradient ethanol series (70%, 2h; 80%, 2h; 90%, overnight; 95%, 90min×2; and 100%, 40min×2), transparent in xylene (20min×2), embedded in paraffin, and cut into 60μm sections continuously. Using digital images at 1000× magnification, 15 or more fully impregnated neurons that were not obscured by adjacent neurons were randomly selected from the sections for analysis for each group of mice. Dendritic spine density (number / μm) was calculated using Image J.

[0127] 16. Electrophysiological Recordings from Brain Slices

[0128] The brains were rapidly disassembled and placed in a humidified atmosphere containing (in mM): 125 NaCl, 2.5 KCl, 2 CaCl2, 1 MgCl2, 25 NaHCO3, 1.25 NaH2PO4, and 12.5 glucose. Coronal brain slices (300 μm thick) were prepared using a vibratome and immersed in ACSF containing 95% O2 and 5% CO2 for 1 h at 31°C and then stored at room temperature (22-25°C). Miniature excitatory postsynaptic potentials (mEPSCs) at -70 mV were recorded in the presence of 100 μM microtoxin and 1 μM tetrodotoxin. For recording long-term potentiation (LTP), synaptically evoked extracellular field excitatory postsynaptic potentials (FESPs) of the Schaffer collateral pathway were recorded in the CA1 region. LTP was induced by high-frequency stimulation (HFS) consisting of 1-se 100 Hz trains, each with an intensity of 70-80%, eliciting peak fepps. Data were analyzed in pCLAMP10.6 (Molecular Devices), 3 cells per plate were averaged, and 2-3 cells were recorded per mouse.

[0129] 17. Statistical Analysis

[0130] All statistical analyses were performed in GraphPad Prism 6.01 program. Data are presented as the mean ± standard error (SEM) of at least 3 biological replicates in the experiment. One-way ANOVA or two-way ANOVA followed by Dunnett's test or t-test was used. Non-normal distribution was analyzed using the Kruskal–Wallis test. When p < 0.05, the differences between groups were judged to be statistically significant. Asterisks indicate statistical significance *p < 0.05; **p < 0.01; ***p < 0.001.

[0131] Example 1 Expression of Maf1 in the hippocampus of AD patients and APP / PS1 mice

[0132] AD memory decline and intellectual loss are directly related to the morphology and function of neurons. Maf1, as a transcription factor, may regulate the presence of other genes in the pathogenesis of AD. Therefore, a genomic study of the human brain GEO database GSE5281 was conducted, and R software version 4.0.5 and limma toolkit were used for analysis. In doing so, all differential genes between AD and normal hippocampal tissues can be found.

[0133] The experimental results showed that compared with the corresponding non-dementia control group (n=13 and n=10, respectively), the expression of Maf1 in the AD patient human brain database was increased; that is, the expression level of Maf1 in AD was significantly increased ( Figure 1 A, B, and C; P value = 0.007256926).

[0134] When cultured in vitro, primary hippocampal neurons were transfected with APPswe virus. The results showed that compared with Vector and APP WT viruses, the Maf1 protein in primary hippocampal neurons transfected with APPswe virus was significantly increased ( Figure 1 D and E). At the same time, protein was extracted from the hippocampus of 6-month-old APP / PS1 mice, and it was found that the level of Maf1 protein was also significantly increased ( Figure 1 F and G). In addition, we confirmed that the expression of Maf1 protein was increased in AD by immunohistochemistry and immunofluorescence ( Figure 1 HK). Therefore, these data suggest that Maf1 expression levels are abnormally elevated in AD.

[0135] To further verify whether the above results exist in neurons in AD models and AD transgenic mice, in order to explore the expression of Maf1 in hippocampal neurons, primary hippocampal neurons extracted from the hippocampus of fetal mice were used as an in vitro model; first, NeuN staining was used to verify the purity of primary neurons extracted in vitro; and immunofluorescence technology was used to explore the expression of Maf1 in hippocampal neurons in vivo and in vitro.

[0136] The experimental results are as follows Figure 2 As shown in A, NeuN expression was found in more than 90% of the cells, proving that the extracted cells were relatively pure primary neurons.

[0137] The experimental results are as follows Figure 2 As shown in B, Maf1 and MAP2 (neuronal markers) were found to be co-labeled in brain slices and primary neurons in vitro, indicating that Maf1 is expressed in both the cell bodies and dendrites of hippocampal neurons.

[0138] Example 2 Conditional knockout of Maf1 in hippocampal neurons can improve learning and memory functions

[0139] The CRISPR-Cas9 system was used to generate Maf1 conditional knockout mice (Maf1-eCKO1) to study the effects of Maf1 deficiency on hippocampal neurons in AD brains. Guide RNAs were designed to target specific exons to construct Maf1-eCKO1 mice, and transgenic mice were hybridized with APP / PS1 mice to obtain Maf1-eCKO1-APP / PS1 mice ( Figure 3 AB). Genotyping was performed from the tail tip of mice, and PCR confirmed the homozygous Maf1 gene flox and APP / PS1 mice that could be conditionally knocked out ( Figure 3 C). AAV-hsyn-Cre-GFP or AAV-hsyn-GFP vector was injected into the CA1 region of the hippocampus of Maf1-eCKO1-APP / PS1 mice using stereotaxic microinjection at 5 months of age ( Figure 3D and E). One month after virus injection, mice were subjected to a 5-day MWM learning and acquisition experiment and a probe test on day 6 to measure the ability of mice to locate the quadrant that previously contained the hidden platform ( Figure 3 E). After AAV-hsyn-Cre-GFP was injected into the hippocampus, immunofluorescence confirmed the loss of Maf1 protein, and WB analysis was performed on the mouse hippocampus ( Figure 3 F and G).

[0140] The experimental results showed that the Maf1 bands in Maf1-eCKO1-APP / PS1 mice injected with AAV-hsyn-Cre-GFP were significantly reduced compared with those in control mice injected with virus (e.g. Figure 3 F).

[0141] After verifying the effectiveness of conditional knockout, the mice were subjected to Morris water maze behavioral tests to determine the effect of hippocampal Maf1 expression on learning and memory behavior. During the acquisition test, the average escape latency of Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice was significantly shortened on the 2nd, 3rd, 4th and 5th days of training compared with Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice; Moreso, conditional knockout of Maf1 resulted in a shortened latency on the 5th day of training in Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP mice compared with Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice ( Figure 4 A and B).

[0142] From the probe test, we first analyzed the percentage of time spent in the target quadrant and found that mice from WT and Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice swam mainly in or near the target quadrant, while Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice swam less near the target quadrant ( Figure 4 C). Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice spent more time in the target quadrant compared to Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice ( Figure 4 D). In addition, the number of platform crossings of Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice was significantly higher than that of Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice ( Figure 4 E).

[0143] Taken together, these results suggest that Maf1 is important for cognitive function in AD.

[0144] Example 3 Effects of Maf1 knockdown on neural synapses

[0145] Studies have shown that synaptic loss and dysfunction will more directly lead to a decline in cognitive function in the brain of AD patients. This is manifested in a decrease in the number of mushroom dendritic spines, a decline in learning and memory, etc. These changes in the morphology and basic functions of nerve cells lead to a loss of cognitive function in AD patients. It is worth noting that the structure, number and function of synapses are crucial to maintaining brain function.

[0146] Spine density was measured using Golgi-Cox staining ( Figure 5 A) to examine whether the behavioral recovery induced by Maf1 knockout is associated with structural changes in dendritic spine density in vivo. Compared with Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice, the spine density of Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice increased by 18% ( Figure 5 , B and C); the density of mushroom-like spines also increased by about 10%, and the density of thin / filopodia-like spines decreased by about 17% ( Figure 5 D). This suggests that the reduction of Maf1 can significantly restore the damage of dendritic spines in hippocampal neurons in AD.

[0147] Therefore, primary neurons were extracted, transfected with APP lentivirus, and then transfected with shSCR and shMaf1 plasmids to verify this phenomenon in vitro AD model (5E). Consistent with the in vivo studies, knocking out Maf1 increased the density of mushroom spines and reduced the density of filopodia / lamellae in vitro ( Figure 5 F and G).

[0148] In general, knockdown of endogenous Maf1 expression in hippocampal neurons can promote the growth and development of neuronal dendritic spines under AD pathological conditions and increase the density of dendritic spines. Moreso, the type of dendritic spines is mainly mushroom. This shows that Maf1 plays a vital role in the progression of AD disease by regulating dendritic spines and regulating synapses.

[0149] To verify this phenomenon in vitro, three shRNA sequences were designed, a scrambled shRNA with nonspecific sequence interference as a control sequence and a Maf1 overexpression plasmid with a Flag tag (Maf1-OE).

[0150] The experimental results showed that after lentivirus transfection of 293T cells, a higher GFP green fluorescence intensity was observed under fluorescence microscope 72 hours after transfection ( Figure 6A); ShRNAs targeting Maf1 effectively reduced endogenous protein levels compared to neurons transfected with shSCR, with shMaf1-2 having the best effect ( Figure 6 B). In addition, the expression of Maf1 was significantly increased in the WB experiment, and the presence of marker protein confirmed the successful overexpression of Maf1 ( Figure 6 C).

[0151] ShSCR, shMaf1, and Maf1-OE lentiviruses were further used to transfect mature primary hippocampal neurons in vitro. It was observed that both shMaf1-2 and shMaf1-3 lentiviruses could effectively reduce the expression level of Maf1 in hippocampal neurons ( Figure 6 D). After transfection with Maf1-OE lentivirus, the protein level of Maf1 also increased significantly ( Figure 6 E) All subsequent viral experiments used shMaf1-3, with shMaf1 as the representative.

[0152] The results showed that Maf1 is highly expressed in neuronal dendrites and dendritic spines ( Figure 6 F).

[0153] AAV-syn-shSCR-GFP and AAV2 / 9-syn-shMaf1-GFP were injected into the hippocampus of AD mice for study. The effects of Maf1 knockdown in the mouse hippocampus were confirmed by immunofluorescence and WB analysis ( Figure 7 A and B).

[0154] Consistent with the phenomenon observed in Maf1-eCKO1-APP / PS1, knockout of Maf1 affected the number and morphology of dendritic spines in neurons ( Figure 7 CF) and improved learning and memory dysfunction in mice ( Figure 7 GI).

[0155] Example 4 Effects of Maf1 on calcium homeostasis and amyloid plaque deposition in AD hippocampal neurons

[0156] In neural activity, many biological effects, such as synaptic transmission of nerve cells, transmitter release, cell morphology and growth, activation of various enzymes, etc., are related to calcium signaling pathways. Calcium signaling in dendritic spines plays an important role in controlling synaptic plasticity. Previous studies have also shown that calcium imbalance may be an important cause of AD. Ca2+ in the endoplasmic reticulum in AD and aging neurons is significantly increased. 2+ levels, leading to subsequent compensatory changes and neuronal Ca 2+ Signal transduction defects. Given the increasing evidence that Ca 2+ Overload blocks LTP, leading to synaptic loss and neurodegeneration. We then examined whether Maf1 regulates intracellular Ca2+ Signals affect neuronal morphology and function. Primary hippocampal neurons were extracted and transfected with APP lentivirus, followed by shSCR and shMaf1 plasmids. Then, total Ca was estimated using Fura-4 / AM calcium imaging. 2+ internal flow.

[0157] Under AD conditions, Ca2+ in primary hippocampal neurons was found to be 2+ The influx was significantly increased; in addition, the knockout of Maf1 reduced the Ca 2+ Inflow level ( Figure 8 A and B). Thus, our findings suggest that Maf1 can regulate calcium concentrations in primary hippocampal neurons.

[0158] To further determine whether the increased expression level of Maf1 is related to AD pathology, we performed Aβ immunohistochemistry and immunofluorescence staining. We found that compared with Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice, Maf1 knockout mice had significantly reduced hippocampal Aβ plaques ( Figure 8 CF).

[0159] Example 5 MEPSCs and LTP are rescued by Maf1 conditional knockout in hippocampal neurons

[0160] Synaptic plasticity is the ability of synapses to respond to increases or decreases in neuronal activity over time. Many studies have suggested that there are potential mechanisms for synaptic plasticity, including changes in the amount of neurotransmitters released presynaptically and the number of receptors on the postsynaptic membrane, which leads to changes in the efficiency of the postsynaptic cell's response to neurotransmitters. It is worth noting that LTP is one of the most commonly used techniques in electrophysiological testing to reflect changes in synaptic plasticity. In addition, mEPSC is a spontaneous synaptic activity that refers to the shift in postsynaptic membrane current caused by the action of each vesicle on the postsynaptic membrane, reflecting the development and maturation of synapses. Previously, it was found that Maf1 knockdown can restore the morphology and structure of dendritic spines in APP / PS1 mice. Whether this restoration can reverse neurophysiological dysfunction; therefore, we further studied the changes in hippocampal synaptic plasticity.

[0161] Maf1-eCKO1-APP / PS1 mice after stereotaxic injection of AAV-hsyn-GFP vector or AAV-hsyn-Cre-GFP. To examine synaptic function, whole-cell patch clamp electrophysiology was used to measure mEPSCs (postsynaptic potentials) in brain slices, and it was observed that the frequency of mEPSCs in these neurons of Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice was reduced, while the hippocampal neurons of Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice returned to WT levels ( Fig. 9 A and B). LTP (long-duration potential) in the Schaffer collateral-CA1 pathway, a key cellular mechanism of learning and memory, was also examined.

[0162] Compared with wild-type mice, LTP levels were decreased in Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice and restored in Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice ( Fig. 9 C and 9D). These results demonstrate that Maf1 knockout can restore synaptic plasticity in the hippocampus.

[0163] Example 6: Verification of Maf1 regulation of Grin1 and involvement in synaptic function and calcium signaling pathways

[0164] RNAseq experiments were performed to screen for genes and signaling pathways that were altered after Maf1 was knocked down in AD. The analysis showed that there were 884 differentially expressed genes after Maf1 was knocked down in AD, of which 564 genes were downregulated and 320 genes were upregulated ( Fig.10 AC).

[0165] GO enrichment analysis and KEGG pathway analysis of these different genes showed that the down-regulated genes were mainly related to synapses, calcium ion signaling pathways, nerve-related ligand-receptor reactions, etc. The up-regulated genes showed that the up-regulated genes were mainly related to immune system diseases, complement and coagulation cascade reactions.

[0166] Among the genes related to synaptic function and calcium signaling pathways, Grin1 gene was found to have the best compliance ( Fig.10 DF). Grin1 encodes NMDAR1, a protein that is essential for calcium homeostasis and synaptic remodeling in neurons. Therefore, these results suggest that Maf1 may regulate synaptic function by regulating Grin1 gene expression.

[0167] CUT&Tag experiments further explored the mechanism of Maf1 ( Fig.11 A and B). GO analysis suggests that synapses are related to calcium ion binding ( Fig.11C), KEGG suggests that the genes that may bind to Maf1 are closely related to the calcium ion signaling pathway and synaptic glutamine secretion ( Fig.11 D). GO analysis and KEGG pathway analysis enriched 409 synapse-related genes and 74 synapse-related genes, respectively; 30 genes, including Grin1, Grin2a, Grin2b and Gria1, were co-intersected ( Fig.11 E). We further analyzed the protein interaction network of these 30 genes, and it is noteworthy that Grin1 is located in the core position ( Fig.11 F), indicating that Maf1-NMDAR1 may regulate synaptic function by modulating calcium homeostasis in AD.

[0168] Example 7 Maf1 regulates NMDAR1 transcription by binding to the Grin1 promoter region

[0169] Previous sequencing and biomarker analysis have suggested that Maf1 may regulate calcium homeostasis and synaptic function by regulating Grin1 in AD. It was found that the level of NMDAR1 protein was downregulated after conditional knockout of Maf1 in hippocampal neurons ( Fig.12 A and B), which was also verified in primary neurons ( Fig.12 C and D).

[0170] In order to clarify the molecular mechanism of how Maf1 regulates the structural remodeling of neuronal dendritic spines through Grin1-encoded protein NMDAR1 and thus affects cognitive function, the protein interaction relationship between Maf1 and NMDAR1 was first verified by Co-IP (co-immunoprecipitation) experiment. The Co-IP experiment showed that no co-IP of Maf1 and NMDAR1 proteins from hippocampal neurons was found, proving that Maf1 and NMDAR1 proteins in hippocampal neurons do not interact ( Fig.12 E and F).

[0171] In view of the gene regulation function of Maf1 as a transcription factor, the interaction between Maf1 and the Grin1 gene in the cell nucleus was further verified. In order to screen the binding site of Maf1, four primers 2000bp upstream of the Grin1 gene were designed in the CH-IP (chromatin immunoprecipitation) experiment (as shown in 10. Chromatin immunoprecipitation (Ch-IP)). The results of Ch-IP-qPCR confirmed the potential binding site of Maf1 in the promoter region of Grin1 ( Fig.12 G).

[0172] Subsequently, a dual-luciferase reporter gene assay was performed to verify that Maf1 promoted Grin1 transcription. According to the instructions for Ch-IP, Maf1 NC and overexpression plasmids were constructed, Grin1 promoter plasmids were constructed, and the Grin1 promoter site was mutated to obtain MT, MT1, MT2, MT3 ( Fig.12 H). In addition, luciferase reporter plasmid was used to detect the activity of Grin1 promoter in 293T cells.

[0173] Overexpression of Grin1 promoter WT and Maf1 enhanced the activity of the luciferase reporter gene, suggesting that Maf1 can interact with the Grin1 promoter and exert an enhanced regulatory effect at a specific site of the Grin1 promoter ( Fig.12 IL). It was found that the active luciferase reporter gene of the mutant Grin1 promoter was not affected by Maf1 activation ( Fig.12 IL), there was no difference in the activity of the luciferase reporter gene among the four mutant plasmids of the Grin1 promoter, suggesting that there is a synergistic effect among the three sites on the Grin1 promoter.

[0174] The results of CH-IP analysis and dual-luciferase reporter gene analysis showed that Maf1 promoted Grin1 transcription by binding to the Grin1 promoter.

[0175] Example 8 Grin1 promoter mutation attenuates the morphological effects of Maf1 knockdown

[0176] To further confirm that Maf1 affects the specificity of neuronal dendritic spines by regulating the Grin1 promoter, a "rescue" experiment was carried out using the Grin1 promoter mutant vector. To this end, hippocampal neurons were transfected with shSCR and shMaf1 plasmids with GFP fluorescence and wild-type and mutant plasmids without GFP. Fig.13 A), analyze the morphology and number of neuronal dendritic spines. The experiment found that compared with the SCR group, the density of neuronal dendritic spines in the shMaf1+Grin1WT group increased significantly, and the number of mature dendritic spines also increased significantly ( Fig.13 B and C), which is consistent with the phenotype of Maf1 in the above-mentioned knockout mice. Compared with the shMaf1+Grin1WT group, whether the three sites of the Grin1 promoter were mutated separately (MT1 / 2 / 3) or the whole mutation (MT), the dendritic spine density of these four groups of neurons was significantly reduced, and the number of mushroom dendritic spines was also reduced ( Fig.13 B and C), indicating that there is a synergistic effect among the three binding sites and that Maf1 participates in the regulation of dendritic spines through the Grin1 gene.

[0177] The Maf1-NMDAR1 signaling pathway regulates neuronal calcium homeostasis and participates in a new mechanism of AD synaptic remodeling. Under the pathological state of AD, the expression of the transcriptional regulatory protein factor Maf1 increases, which regulates the expression of NMDAR1 by binding to the promoter region of Grin1, further regulating calcium homeostasis, changing the morphological structure and number of dendritic spines, and thus affecting synaptic function. Ultimately, it regulates synaptic remodeling and affects learning and memory function ( Fig.14 )

[0178] Example 9 Screening of compounds binding to Maf1 protein

[0179] Screening method:

[0180] SPR single concentration detection technology: Surface plasmon is an electromagnetic wave on the surface of a metal, generated by the interaction of freely vibrating photons and electrons. Surface plasmon resonance (SPR) is an optical phenomenon that occurs on the surface of two media, which can be induced by photons or electrons. When light is emitted from a dense medium into a sparse medium, it undergoes total reflection, forming an evanescent wave that enters the sparse medium. When the totally reflected evanescent wave meets the plasma wave on the metal surface, resonance may occur, the energy of the reflected light decreases, and a resonance peak appears on the energy spectrum of the reflected light. This resonance is called surface plasmon resonance. The incident angle that causes surface plasmon resonance is called the SPR angle. SPR biosensors provide a sensitive, label-free detection technology for real-time monitoring of intermolecular interactions. The sensor detects changes in the SPR angle, which is related to the refractive index of the metal surface. When an analyte binds to the chip surface, the refractive index of the chip surface changes, which causes changes in the SPR angle. This is the basic principle of SPR biosensors for real-time detection of intermolecular interactions. During interaction analysis, changes in the SPR angle are recorded in real time on the sensor graph. The surface plasmon resonance technique was used to establish a target protein-analyte interaction determination model and to determine the analyte. The amino coupling method was used for protein immobilization, and the Maf1 protein antibody was diluted to several concentrations in a 96-well plate, and the target protein was interacted with from low concentration to high concentration through the chip. The flow rate was 30 μL / min, and the duration was 150 s. The mother solutions of the analytes were all prepared to 10 mM with DMSO, and diluted to 100 μM with PBS (5% DMSO) in a 96-well plate before the test, and interacted with the protein in turn. After each concentration point flowed through, the chip was regenerated for 5 min with 10 mM glycine hydrochloride (pH 2.0) solution, and this process was repeated until the corresponding concentrations of all analytes were run. The data of the samples were collected using BIAcore T200 Control software (v.2.0, GE Healthcare), and the data of the reference channel was subtracted from it. The data were globally fitted to a 1:1 Langmuir binding model using BIAcore T200 Evaluation Software (v.2.0, GE Healthcare), and signal values ​​RU were obtained for analytes tested at a single concentration, and association and dissociation constants were obtained for analytes tested at multiple concentrations.

[0181] Filter results:

[0182] Based on SPR affinity detection, we screened out 8 compounds that can actually bind to Maf1 protein.

[0183] Fig.15 A: Maf1 protein coupling diagram; Fig.15B: Interaction determination between Maf1 protein and Maf1 protein antibody (top: interaction sensor diagram; bottom: quality control); Fig.15 C: Single-point screening result diagram.

[0184] Example 10: Pharmacokinetic Verification of Compounds

[0185] Compound preparation:

[0186] The commercially available compound of formula I was dissolved and diluted in a solution of 10% DMSO + 90% (20% HP-β-CD).

[0187]

[0188] Research Methodology:

[0189] Balb / c mice were given a single intraperitoneal injection at a concentration of 2.5 mg / kg, and the compound content in the serum was detected at 0.25, 0.5, 1, 2, 4, 6, 8, and 24 hours after injection; secondly, the mouse brain tissue was taken 0.5, 4, and 24 hours after injection, respectively, for compound content detection to evaluate the blood-brain barrier passage rate.

[0190] Single-dose mouse blood drug concentration detection

[0191] The following table shows the changes in the average blood drug concentration of the compound of formula I over time after intraperitoneal injection of mice at a concentration of 2.5 mg / kg. The test results show that the blood drug concentration of this compound gradually decreases at 0.25, 0.5, 1, 2, and 4 hours after a single injection, and is not detected in the animal body after 6 hours (see Fig.16 ).

[0192]

[0193] Drug content test in brain tissue after single administration

[0194] The following figure ( Fig.17 ) shows the concentration in the brain tissue of mice 0.5, 4, and 24 hours after intraperitoneal injection of the compound of formula I at a concentration of 2.5 mg / kg. The test results show that this compound can be detected in the animal brain tissue 0.5 hours after a single injection, but the concentration is low, indicating that this small molecule compound can pass through the blood-brain barrier and enter the brain tissue.

[0195]

[0196] Example 11: Compound toxicity test

[0197] CCK8 cell viability assay (CCK8) is mainly based on the reduction reaction of WST-8 (chemical name: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid benzene)-2H-tetrazolyl monosodium salt). In the presence of living cells, WST-8 can be reduced by dehydrogenases in mitochondria to generate highly water-soluble orange-yellow formazan products. The color depth is proportional to the number of living cells, so the number of living cells can be indirectly reflected by measuring the absorbance of the formazan product (usually at a wavelength of 450nm). CCK-8 experiments are widely used in cell proliferation assays, cytotoxicity assays, and tumor drug sensitivity tests.

[0198] In the in vitro test, the compound stock solution was prepared with DMSO to 10mM and diluted with culture medium before use. The 293T cell line was used to explore the initial concentration of the compound, and the concentration gradient was set: 5umol, 10umol, 20umol, 40umol, 80umol and 160umol. After the cells were treated with the compound for 24 hours, the CCK8 detection kit was used to calculate the cell viability based on the absorbance value detected by the microplate reader. The data was processed in Graphpad Prism software, and the IC50 curve was drawn. The cell viability is shown in the following table:

[0199]

[0200] Draw the IC50 curve of the compound of formula I as shown below ( Fig.18 ) as shown.

[0201] Considering that the next step is to identify the drug efficacy phenotype on neurons, further use primary neurons extracted from mouse brain tissue to explore the preliminary concentration of the compound.

[0202] Primary hippocampal neuron culture: After anesthetizing ICR fetal mice (E18-E21) at 18-21 days of gestation, dissect out the fetal mice in a clean area and soak the mice in 75% ethanol for 1-2 minutes. Take the head of the mouse, remove the surface skull with microscissors, and transfer the brain tissue to the dissection separation solution. Under the microscope, remove the blood vessels and meninges, separate the hippocampal tissue, and place the removed hippocampal tissue in a 3.5cm dish containing dissection separation solution. Use microscissors to cut the hippocampal tissue into small pieces. Use a pipette to transfer the shredded hippocampal tissue to a 7ml EP tube. Centrifuge at 1000rpm for 3-5min and discard the dissection separation solution. Add 0.5-1ml papain digestion solution to the above EP tube and place it in a 37℃ incubator for 30min. Add 300μL Trituration buffer300 (DNase) and 5ml complete culture medium, and gently blow the hippocampal tissue with a pipette more than 10 times. Let the cell solution stand for 3 minutes, and use a pipette to gently pipette 3-4 ml of supernatant into a 15 ml tube. Add 3-4 ml of complete culture medium again, and use a pipette to gently blow the hippocampal tissue more than 10 times. Repeat step 8, and transfer 3-4 ml of supernatant to the same 15 ml tube again. Repeat the previous step again. Centrifuge the collected supernatant at 1000 rpm, remove the supernatant, add 5 ml of complete culture medium, gently blow to suspend, and centrifuge again at 1000 rpm for 5 minutes. Add complete culture medium to resuspend the cells, and pipette a portion of the cells to count. Generally speaking, when planting neuronal cells in a 24-well plate, the concentration of the cell suspension is generally 2×10 5 / ml, 500μl was inoculated into each well. The resuspended and diluted neuronal cells were plated on the glass slide treated with PDL, placed in a 37℃ incubator for 10min, and then an appropriate amount of complete culture medium was added and placed in the incubator for further culture.

[0203] The compound concentration gradient was set to 5umol, 10umol, 20umol, 40umol, 80umol and 160umol. The compound was added when the primary neurons were cultured in vitro for 13 days. The CCK8 detection kit was used after treating the cells for 24 hours. The cell viability was calculated according to the absorbance value detected by the microplate reader using the CCK8 detection kit. The data was processed in Graphpad Prism software and the IC50 curve was drawn. The cell viability is shown in the table below:

[0204]

[0205]

[0206] Draw the IC50 curve as shown below ( Fig.19 ) as shown.

[0207] The compound of formula II, which has an inhibitory effect on MAF1 protein, was subjected to CCK8 toxicity test on 293T and primary neurons, and IC50 curves were drawn. The IC50 values ​​were 38.65umol (293T cell line) and 1.665umol (primary neurons), respectively, indicating that the concentration that reached the cell half-lethal dose was low and the compound was highly toxic, so follow-up research was not considered. As shown in the following figure ( Fig. 20 ) as shown:

[0208] The structure of the compound of formula II is as follows:

[0209]

[0210] Example 12: In vitro efficacy test of compounds

[0211] Experimental methods:

[0212] The extraction and culture of primary neurons were the same as above (toxicity experiment part).

[0213] Method for transfecting neurons with plasmid calcium: aspirate the culture medium of neurons (half of the medium is replaced) and place it in a 37℃ water bath for later use, and add Neurobasel A to the 24-well plate. Dissolve 500ng of plasmid DNA in 12.5μl CaCl2 solution and centrifuge. Add 12.5μl HBS to the EP tube and centrifuge. Add the above mixture to the 24-well plate, shake it slightly, and put the 24-well plate back into the 37℃ incubator for 90min. Aspirate the new Neurobasel A into a new 15ml EP tube, perfuse CO2 to saturate NeurobaselA, and when the color turns yellow, discard the original culture medium of the 24-well plate, add Neurobasel A saturated with CO2, and place it in a 37℃ incubator for 15min. Discard the culture medium and add the original culture medium and fresh complete culture medium in a 1:1 ratio. Place the 24-well plate in the incubator and continue to culture. After 24h-48h, the transfection situation can be observed under a microscope. Neuronal cells were collected at DIV 14 and fixed with paraformaldehyde to observe the changes in dendritic spines.

[0214] Lentiviral infection of neurons:

[0215] Planting about 2.0×10 4The neurons were cultured in a 37°C, 5% CO2 incubator with 1 ml / well cell culture medium at a concentration of 1 cell / L. On the 6th day of in vitro culture (DIV6), the original culture medium was semi-quantitatively collected, and the lentivirus stock solution (100ul) was diluted with the original culture medium (10ml) at a ratio of 1:60-1:40. The diluted virus-containing culture medium was added to a 24-well culture dish at a ratio of 1 ml / well. 8-12 hours after the neurons were infected with the virus, the cell culture medium containing the lentivirus was removed, and an equal volume (1 ml / well) of the original culture medium was added and the cells were cultured in an incubator.

[0216] When primary neurons were cultured in vitro for 4 days, the GFP plasmid was transfected to make the neurons carry green fluorescence, which was convenient for observing neuronal dendrites; on the 6th day, the APPsw lentivirus was transfected to simulate the in vitro model of Alzheimer's disease. The compound mother solution was made into 10mM with DMSO. When the primary neurons were cultured in vitro for 13 days, the culture medium was used to dilute the concentration to 2.5umol, and the compound was added to treat the cells for 24h. After 14 days of in vitro culture, the neurons were fixed with 4% PFA, and photographed at 100 times magnification under the oil lens of the confocal fluorescence microscope. The density of dendritic spines per 10um length of neurons was calculated by observing the GFP green fluorescence.

[0217] Result analysis:

[0218] The following figure ( Fig.21 ) The green fluorescence image is a representative pattern image of the three groups (the upper part is the whole neuron, and the lower part is the dendritic spine branch). The right image is a statistical graph of the dendritic spine density of the three groups (normalized to the control group, n=8). The results showed that compared with the blank control, the total density of dendritic spines of neurons in the in vitro AD model (APPsw virus) decreased, while the density of dendritic spines increased after compound intervention. The results suggest that compound intervention can increase the number of dendritic spines of neurons in the in vitro AD model and improve synapses, such as Fig.21 As shown:

[0219] The number of dendritic spines of the neurons in the statistical graph is shown in the table below (normalized to the control group):

[0220]

[0221]

[0222] Example 13 In vivo efficacy experiment of the compound

[0223] Experimental methods:

[0224] Thy1-GFP mice are often used in neuroscience research. Through the fluorescent labeling of GFP, specific cell types, especially neurons, can be easily observed and tracked. APP / PS1 transgenic mice (animal model of Alzheimer's disease) were crossed with Thy1-GFP mice. The compound solution was intraperitoneally injected at 5 months of age. The concentration of 2.5 mg / kg was continuously injected for 1 month. At 6 months of age, behavioral tests (Morris water maze MWM test) were performed to evaluate learning and memory abilities ( Fig. 22 shown).

[0225] Water maze: The water maze experimental device is a round stainless steel with a diameter of 100 cm and a height of 50 cm. The pool is divided into four quadrants according to the four directions of east, south, west and north. A round black hidden platform with a diameter of 9 cm and a height of 27 cm is placed in the center of the target quadrant. During the acquisition training phase, the position of the hidden platform remains unchanged and the water temperature is maintained at 22-24°C. The camera directly above the pool can synchronously record the movement trajectory of the mouse, and the EthovisionXT monitoring and analysis system is used for analysis. During the entire experimental process, the first day is a visual platform experiment, and the subsequent five consecutive days of hidden platforms are the acquisition experimental stage, and the seventh day is the spatial exploration experimental stage. The mice were placed in the room where the water maze was located one day before the experiment to adapt to the environment. Hidden platform acquisition experimental stage: The mice were trained twice a day at the same time, and each time the same mouse entered the water from a different quadrant, while different mice entered the water at the same location. The swimming time is 60 seconds. Mice that find the platform and stay on it for more than 5 seconds are considered to have found the platform. Mice that fail to find the platform within 60 seconds need to be guided to the platform and allowed to stay for 15 seconds. Space exploration experiment phase: On the 7th day, the platform in the pool was removed, and the point farthest from the platform was selected as the entry point for monitoring and the mice were placed in the water. The mice swam in the water for 60 seconds, and the percentage of time the mice spent in the quadrant where the target platform was located was recorded, which represented the learning and memory ability of the mice.

[0226] After the water maze behavioral test, the mice were anesthetized and perfused, and brain tissue sections were taken to observe the density of neuronal dendritic spines by GFP green fluorescence under a confocal fluorescence microscope.

[0227] Result analysis:

[0228] Fig. 22This is a heat map of the swimming trajectories of mice in each group within 60 seconds during the spatial exploration phase on the 7th day. It can be observed that the trajectory of the Alzheimer's disease animal model mouse (APP / PS1) is close to the wall edge. By statistically analyzing the percentage of time spent in the quadrant where the platform is located (upper right) of the three groups, compared with WT mice, the percentage of time spent in the platform quadrant by APP / PS1 mice decreased, and the percentage of time spent in the platform quadrant by mice after compound intervention increased. The results show that continuous injection of compounds can improve the learning and memory ability of AD mice.

[0229] The values ​​of the statistical chart are shown in the following table:

[0230]

[0231] Fig.23 The representative images of hippocampal neurons in brain slices of three groups of mice. The statistical analysis results show that compared with Ctrl, the total density of dendritic spines in hippocampal neurons of AD mice is reduced, while the density of dendritic spines increases after compound intervention, such as Fig.23 As shown, the right figure is a statistical diagram of the dendritic spine density of three groups:

[0232] The values ​​of the statistical graph are shown in the following table (normalized by the control group):

[0233]

[0234] Example 14 Transcriptomic Detection of Hippocampal Tissue after Compound Intervention

[0235] After the water maze behavioral test, the AD group mice and the AD+compound intervention group mice were anesthetized and perfused, and the hippocampal tissue of the brain was taken for transcriptomic sequencing to explore the related genes and signal pathways involved in the changes after compound intervention based on the AD group. The differentially expressed genes were further enriched and analyzed by KEGG pathways. The results (such as Fig.24 ) found that compared with the transcription levels of genes in the hippocampus of AD mice, the genes with differential transcription levels that changed after compound intervention were mainly involved in the nervous system, neurodegenerative diseases and signal transduction, such as 50 genes in the nervous system-related gene set had changed transcription levels, and 16 genes in the neurodegenerative disease-related gene set had changed transcription levels. Transcriptomic analysis suggests that the pathways through which small molecule compounds exert their effects after binding to the target Maf1 protein may be related to neural signal transduction.

Claims

1. A marker for early diagnosis of Alzheimer's disease, wherein the marker is Maf1 gene or its protein. When the Maf1 gene or its protein is highly expressed in neuronal cells, it indicates that the test subject is a high-risk group for Alzheimer's disease.

2. A reagent or kit for early diagnosis of Alzheimer's disease; the reagent or kit contains a reagent that can detect the expression of Maf1 gene or its protein.

3. An application of Maf1 gene or its protein in the preparation of a product for early diagnosis of Alzheimer's disease, wherein the application is to determine whether the patient is a high-risk group for Alzheimer's disease based on the expression of Maf1 gene or its protein in neuronal cells.

4. The use of the Maf1 gene or its protein in the preparation of a product for early diagnosis of Alzheimer's disease according to claim 3, characterized in that: When the Maf1 gene or its protein is highly expressed in neuronal cells, the test subject is judged to be a high-risk group for Alzheimer's disease.

5. An inhibitor for inhibiting the expression of Maf1 protein, wherein the mechanism of the inhibitor is as follows:

6. The inhibitor for inhibiting the expression of Maf1 protein according to claim 5, characterized in that: The inhibitors include, but are not limited to, chemically synthesized, naturally occurring compounds, and / or biosynthesized substances.

7. A promoter for promoting the expression of Maf1 protein.

8. Use of a promoter for promoting the expression of Maf1 gene or protein in preparing an animal model, wherein the promoter is an experimental preparation.

9. Use of the inhibitor for inhibiting the expression of Maf1 gene or its protein according to claim 5 in the preparation of a drug for treating AD.

10. A pharmaceutical preparation for treating AD, the pharmaceutical preparation containing a substance that inhibits the expression of Maf1 gene or its protein, the structure of the substance being as follows: The pharmaceutical preparation also includes a pharmaceutically acceptable carrier.

Images