Primer, probe, kit and method for detecting copy number variation of SMN1 and SMN2 genes

Abstract

The invention relates to a primer, a probe, a kit and a method for detecting copy number variation of SMN1 and SMN2 genes. According to the kit, an amplification block mutation system PCR (ARMS-PCR) and a competitive primer PCR (COP-PCR) are combined, a Taq-Man probe method is matched, the difference of the SMN1 gene and the SMN2 gene at two different sites of 7th and 8th exons can be effectively distinguished, meanwhile, the amplification efficiency of a target is guaranteed, and the kit is high in sensitivity, good in specificity and high in stability (precision). Besides, the kit is matched with stable PCR amplification reaction components, so that the copy number of SMN2 can be calculated and analyzed while the differences among SMN1 deletion, carrying and normality can be effectively distinguished, and basis is provided for illness state analysis, medication guidance, prognosis and the like of SMA patients.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and relates to a primer, a probe, a kit and a method for detecting SMN1 and SMN2 gene copy number variation. Background Art

[0002] Spinal muscular atrophy (SMA) is an autosomal recessive hereditary neuromuscular disease characterized by progressive muscle weakness and atrophy caused by degeneration of brainstem and spinal motor neurons. It is the most common fatal hereditary neuromuscular disease in infants and young children. SMA is autosomal recessive. The carrier frequency is 1 / 35 to 1 / 80. The incidence of SMA patients is about 1 / 8000-1 / 10000, with no obvious regional and ethnic differences.

[0003] According to the patient's age of onset and clinical course, SMA is divided into four types from severe to mild.

[0004] Children with type I SMA usually develop the disease within 6 months and account for about 45% of all SMA cases. The typical feature is that they cannot sit alone and need to rely on a stroller or wheelchair. Swallowing and feeding will become difficult, and because it is difficult to avoid aspiration (suffocation caused by inhaling secretions or food into the lungs), the child will eventually lose the ability to swallow safely. Most children die of respiratory failure within 2 years of age.

[0005] Children with type II SMA usually develop the disease within 6-18 months, accounting for about 30% to 40%. They have a range of motor abilities, but motor function indicators lag behind. The typical feature is that they can sit alone, but some children need help to get into a sitting position. With the help of a brace or external force, they may be able to stand, but they cannot walk independently and need a wheelchair to move. Although life expectancy is shortened, most can survive into adulthood.

[0006] Children with type III SMA usually develop the disease after 18 months, accounting for about 20%. Patients can stand and walk alone, but as the disease progresses, walking will become difficult at some point. The motor indicators that should be achieved in the early stage are normal, however, once they start walking, they will often fall, bend over or sit on the ground and find it difficult to stand up, and may not be able to run. As the disease progresses, limb fasciculations and foot deformities may occur. Some patients have scoliosis, respiratory insufficiency, etc., which affect their daily life. Life expectancy is not shortened or slightly reduced.

[0007] Symptoms of adult-onset type IV usually begin after age 35. SMA rarely develops between the ages of 18 and 30. Adult-onset SMA is much less common than the other types and is defined as weakness that does not develop until after age 18, but most reported cases of type IV develop after age 35. It is typically insidious and progresses very slowly. Muscles controlled by the medulla oblongata, which are used for swallowing and breathing, are rarely affected.

[0008] The SMN1 gene is the pathogenic gene of SMA. It can be roughly understood that people with SMN1 gene deletion are SMA patients, people with a single copy of the SMN1 gene are carriers, and people with at least 2 copies of the SMN1 gene are normal people.

[0009] The human genome contains two highly homologous SMN genes, namely SMN1 and SMN2. These two genes are arranged in tandem on chromosomes. SMN1 is also called SMNT because it is close to the telomere, and SMN2 is also called SMNC because it is located on the centromere. There are only 5 nucleotide sites different between these two genes (and only 2 in the coding region, located in exons 7 and 8, and the other three are located in introns 6 and 7), but they encode the same protein. These two genes are mainly distinguished by two gene sites on exons 7 and 8. SMN1 is the main functional gene, and SMN1 deficiency is the main cause of spinal muscular atrophy.

[0010] Since the SMN gene stop codon is located in exon 7, its exon 8 does not participate in the coding of amino acids. Therefore, there is only one base difference between the SMN1 and SMN2 coding sequences, that is, the difference of C>T in exon 7.

[0011] The SMN2 gene can only produce 10% to 15% of the functional and structurally stable full-length SMN protein. Most of the SMN truncated proteins produced by the SMN2 gene are structurally unstable and easily degraded. However, SMN2 is a compensatory gene for SMN1, and multiple copies of the SMN2 gene can delay the onset of disease or make the symptoms milder. The number of copies of SMN2 has guiding significance for the trial of drugs.

[0012] In 2020, a review published in Germany described the relationship between the clinical type of 3459 SMA patients and the number of SMN2 copies: Generally speaking, the more SMN2 copies a patient carries, the milder the phenotype: 73% of patients with type I SMA carry 2 copies of SMN2; 78% of patients with type II SMA carry three copies of SMN2; 49% of patients with type III SMA carry three SMN2 copies, and 44% carry four SMN2 copies; 81% of patients with type IV SMA carry four copies of SMN2.

[0013] At present, the main detection methods for SMN gene copy number detection in clinical practice are: restriction fragment length polymorphism analysis polymerase chain reaction technology (PCR-RFLP), denaturing high performance liquid chromatography analysis (PCR-DHPLC), multiple ligation probe amplification technology (MLPA), real-time fluorescence quantitative PCR, etc. PCR-RFLP can only be used for qualitative analysis of patients with homozygous deletion of exon 7 of SMN1 gene (i.e., 0 copies), and cannot detect carriers of heterozygous deletion type (i.e., single copy), and the technology itself also has the problem of incomplete enzyme cutting leading to misjudgment results; PCR-DHLPC method and MLPA method can be used to detect homozygous deletion patients and heterozygous deletion carriers, and MLPA method can realize quantitative analysis of 0 copies, single copies, two copies, three copies and four copies of the gene, but the operation is complicated, the throughput is low, the time is long (48~72 hours), specific instruments are required and the price is expensive, so it cannot be widely carried out in actual application.

[0014] Therefore, there is currently a lack of a method for rapid detection of exons 7 and 8 and copy number of SMN1 and SMN2 genes. Summary of the invention

[0015] In order to solve the above technical problems, the purpose of the present invention is to provide a primer, probe, kit and method for detecting the copy number variation of SMN1 and SMN2 genes. The kit of the present invention combines amplification retardation mutation system PCR (ARMS-PCR) and competitive primer PCR (COP-PCR), and is matched with the Taq-Man probe method, which can effectively distinguish the differences between SMN1 gene and SMN2 gene at two different sites in exon 7 and 8, while ensuring the amplification efficiency of the target. In addition, the kit is matched with stable PCR amplification reaction components, which can effectively distinguish the differences between SMN1 deletion, carrier and normal, and can also calculate and analyze the copy number of SMN2, which can help SMA patients with disease analysis, medication guidance and prognosis.

[0016] Amplification retardation mutation system PCR (ARMS), also known as allele specific amplification (ASA), was first established by Newton et al. to detect known mutations. The basic principle is that if the 3′ end base of the primer is not complementary to the template base, it cannot be extended by general DNA polymerase. Therefore, three primers are designed based on known point mutations (see primer design), and their 3′ end bases are complementary to the mutant and normal template bases, respectively, so as to distinguish the template with a certain point mutation from the normal template. This method has been used to detect a variety of SNP sites and mutations.

[0017] Competitive primer PCR (COP-PCR) designs allele-specific oligonucleotides for a point mutation on one side of the target DNA. Unlike the primers of ARMS-PCR, the mutation point of the competitive primer is in the middle of the primer rather than at the end, and the length is preferably 12-16 nucleotides. The two compete for renaturation at the same site of the module, and the renaturation chance of a completely complementary primer is 20-100 times greater than that of a single-base mismatched primer. If only one primer is used as a marker, the competitive amplification results are different for different templates, and the amplification of incompletely bound templates is poor.

[0018] In order to further improve the specificity of the competitive primer, the present invention modifies the primer with a locked nucleotide, shortens the length of the primer, and reduces the mismatch of the primer. A locked nucleotide (LNA) is a nucleotide analog whose ribose ring is "locked" by a methylene bridge connecting the 2'-O atom and the 4'-C atom. LNA mononucleotides include the same nucleic acid bases as those found in DNA and RNA, and can form base pairs according to the Watson-Crick base pairing principle. However, by "locking" the molecule with a methylene bridge, LNA tends to form an ideal conformation for Watson-Crick binding. When incorporated into a DNA or RNA oligonucleotide, LNA makes pairing with a complementary nucleotide chain more rapid and increases the stability of the resulting duplex.

[0019] In summary, AMRS-PCR uses the principle that mismatch at the end of the primer causes difficulty in polymerase amplification, while COP-PCR uses the difficulty of renaturation caused by mismatch between primer and template to reduce non-specific amplification. However, both AMRS-PCR and COP-PCR have differences in base matching, and some base mismatches do not have a significant effect on amplification. Therefore, the present invention innovatively combines COP-PCR and AMRS-PCR, which can distinguish the influence of SMN1 and SMN2 genes on each other to a greater extent.

[0020] In addition, in order to further eliminate the influence between SMN1 and SMN2 genes, the present invention sets a closed Blocker, and closes the pseudogene by introducing C3Spacer termination modification at the 3' end to avoid its non-specific amplification and make the detection more accurate.

[0021] The purpose of the present invention can be achieved by the following scheme: In a first aspect, the present invention provides a primer and probe combination for detecting SMN1 and SMN2 gene copy number variation, comprising the following sequences: The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON7 site of the SMN1 gene are shown in SEQ ID No. 1-3, respectively; the nucleotide sequence of the probe for detecting the EXON7 site of the SMN1 gene is shown in SEQ ID No. 4; The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON7 site of the SMN2 gene are shown in SEQ ID No. 5-7, respectively; the nucleotide sequence of the probe for detecting the EXON7 site of the SMN2 gene is shown in SEQ ID No. 4; The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON8 site of the SMN1 gene are shown in SEQ ID No. 8-10, respectively; the nucleotide sequence of the probe for detecting the EXON8 site of the SMN1 gene is shown in SEQ ID No. 11; The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON8 site of the SMN2 gene are shown in SEQ ID No. 12, SEQ ID No. 13, and SEQ ID No. 10, respectively; the nucleotide sequence of the probe for detecting the EXON8 site of the SMN2 gene is shown in SEQ ID No. 11; The nucleotide sequences of the primers used to detect the internal standard gene TOP3A are shown in SEQ ID No.14-15 respectively; the nucleotide sequence of the probe used to detect the internal standard gene TOP3A is shown in SEQ ID No.16.

[0022] The primer and probe combination of the present invention is used for rapid identification of the SMN1 gene, the 7th exon and the 8th exon of the SMN2 gene, and the internal standard gene TOP3A.

[0023] The details are as follows:

[0025] As an embodiment of the present invention, the 5' and 3' ends of the probe carry a fluorescent group and a quenching group respectively, wherein the fluorescent group is selected from any one or more of FAM, HEX, VIC, TET, TAMRA, ROX, CY3.5, and CY5; the quenching group is selected from any one or more of BHQ1, BHQ2, BHQ3, DABCYL, and MGB.

[0026] In a second aspect, the present invention provides a use of the primer and probe combination in preparing a kit for detecting SMN1 and SMN2 gene copy number variation.

[0027] In a third aspect, the present invention provides a kit for detecting SMN1 and SMN2 gene copy number variation, the kit comprising a detection solution and an enzyme mixture; the detection solution comprises a primer and a probe combination, and the concentration of each primer or probe in the primer and probe combination is 0.2-0.4 μM.

[0028] As an embodiment of the present invention, the detection solution includes SMN1 gene E7 detection solution, SMN1 gene E8 detection solution, SMN2 gene E7 detection solution, and SMN2 gene E7 detection solution; In the SMN1 gene E7 detection solution, the concentration of the primers or probes shown in SEQ ID No.1, SEQ ID No.3, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No.2, SEQ ID No.4, and SEQ ID No.16 is 0.2 μM; In the SMN2 gene E7 detection solution, the concentration of the primers or probes shown in SEQ ID No.5, SEQ ID No.7, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No.6, SEQ ID No.4, and SEQ ID No.16 is 0.2 μM; In the SMN1 gene E8 detection solution, the concentration of the primers or probes shown in SEQ ID No.8, SEQ ID No.10, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No.9, SEQ ID No.11, and SEQ ID No.16 is 0.2 μM; In the SMN2 gene E8 detection solution, the concentration of the primers or probes shown in SEQ ID No.12, SEQ ID No.10, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No.13, SEQ ID No.11, and SEQ ID No.16 is 0.2 μM.

[0029] As an embodiment of the present invention, the detection solution further comprises PCR buffer, 3.2-3.4 mM MgCl 2 , 0.1-0.4 mM dNTPs; the dNTPs include one or more of dATP, dTTP, dCTP, dGTP, and dUTP.

[0030] In some embodiments, the molar ratio of dATP, dTTP, dCTP, dGTP and dUTP is 1:1:1:1:1.

[0031] As one embodiment of the present invention, the enzyme mixture includes DNA polymerase.

[0032] As an embodiment of the present invention, the kit further includes a normal control, a single copy control, a deletion control and a blank control; in the normal control, the copy numbers of the internal standard gene: SMN1 gene: SMN2 gene are 2:2:2; in the single copy control, the copy numbers of the internal standard gene: SMN1 gene: SMN2 gene are 2:1:1; in the deletion control (referring to SMN1 deletion, there are no individuals with simultaneous deletion of SMN1 and SMN2 genes in reality), the copy numbers of the internal standard gene: SMN2 gene are 2:2. It should be noted that the deletion control refers to SMN1 deletion, and there are no individuals with simultaneous deletion of SMN1 and SMN2 genes in reality.

[0033] In a fourth aspect, the present invention provides a method for detecting SMN1 and SMN2 gene copy number variation using the kit for non-diagnostic purposes, comprising the following steps: S1. extracting sample nucleic acid from a sample; S2. Add the sample nucleic acid to E7 detection solution or E8 detection solution and enzyme mixture to prepare a reaction system for RT-PCR reaction; the E7 detection solution includes any one of SMN1 gene E7 detection solution and SMN2 gene E7 detection solution; the E8 detection solution includes any one of SMN1 gene E8 detection solution and SMN2 gene E8 detection solution.

[0034] S3. Interpretation of results.

[0035] As an embodiment of the present invention, in step S1, the sample nucleic acid is extracted using Qiagen's QIAampDNA Blood Mini Kit (Cat. No.: 51104, 51106) to prepare a sample nucleic acid volume of 70 μL.

[0036] As an embodiment of the present invention, in step S2, the reaction system is prepared to be 25 μL, and the reaction system consists of:

[0037] Among them, different E7 and E8 detection solutions exist for SMN1 gene and SMN2 gene at the same time. That is, E7 exon detection solution contains SMN1 gene exon detection solution or SMN2 gene exon detection solution, which is not specifically specified here, indicating that it is actually configured according to demand.

[0038] In some embodiments, the amount of E7 detection solution or E8 detection solution added is 7.5 μL / person, the amount of enzyme mixture added is 12.5 μL / person, the amount of sample nucleic acid added is 5 μL / person, and the final volume is 25 μL / person.

[0039] As an embodiment of the present invention, in step S3, the normal control, the single copy control, the deletion control and the blank control are configured and detected in the same manner as the sample nucleic acid.

[0040] As an embodiment of the present invention, in step S3, the RT-PCR reaction is amplified according to the following procedure: 97°C for 5 min; 97°C for 10 s, 58°C for 45 s, for a total of 45 cycles, and fluorescence signals are collected during the annealing and extension stage.

[0041] As an embodiment of the present invention, in step S4, the result is interpreted as follows: deletion means 0 copies, carrier means 1 copy, and normal means 2 copies or more.

[0042] Determination of SMN copy number (taking SMN1 as an example, the determination criteria for SMN2 are the same as those for SMN1): 1. The Ct value of the internal standard gene of the sample to be tested is ≤30; 2. The test results of E7 and E8 reactions of the missing control should both be missing; 3. Calculate the △Ct value between the target gene and the internal standard gene in the control substance E7 reaction and E8 reaction, △Ct=CtFAM-CtVIC. Calculate the average △Ct value of the normal control substance in the E7 reaction and E8 reaction, recorded as △Cta; 4. Calculate the △Ct value between the target gene and the internal standard gene in the E7 reaction and E8 reaction of the test sample respectively, △Ct=CtFAM-CtVIC, recorded as △Cts; 5. △△Ct=△Cts-△Cta; 6. Test result judgment: If any of the following items is met in the test sample, it is an SMN gene exon deletion.

[0043] The SMN gene should be considered to be deleted if the following results are met: E7 reaction: △△Ct≥1.5 or no signal in FAM channel; E8 reaction: △△Ct≥1.5 or no signal in VIC channel; The SMN gene should be considered to be single copy if the following results are met: E7 reaction: 0.5﹤△△Ct﹤1.5; E8 reaction: 0.5﹤△△Ct<1.5; The SMN gene should be considered normal (double copy) if the following results are met: E7 reaction: △△Ct≤0.5; E8 reaction:△△Ct≤0.5.

[0044] In the prior art, the probe method (MLPA) is usually used to detect the copy number of SMN1 and SMN2 genes in human spinal muscular atrophy by designing common primers for detecting the 7th exon Exon7 of SMN1 and SMN2 genes, primers for detecting the 8th exon Exon8 of SMN1 gene, and probes for detecting the 7th and 8th exons Exon7 of SMN1 gene to form a primer probe combination, and locked nucleotides are set on the probes. However, the probe method usually has strict requirements on PCR reaction conditions, and the probe amplification required by its common primers is extremely unstable and has poor repeatability. The present invention adopts a primer method (combined with amplification retardation mutation system PCR (ARMS-PCR) and competitive primer PCR (COP-PCR)) to solve the problems of extremely unstable probe amplification and poor repeatability, and the kit prepared based on the designed primer probe combination of the present invention has high sensitivity, good specificity, and high stability (precision).

[0045] Compared with the prior art, the present invention has the following beneficial effects: 1. The primer composition for rapid detection of exon 7 deletion site of SMN1 gene of the present invention adopts competitive primer PCR (COP-PCR), and upstream primers are designed according to different target genes, so as to specifically amplify SMN1 gene and avoid interference of SMN2 gene; at the same time, locked nucleotide modification (LNA) is introduced to increase the annealing temperature of COP-PCR primers and improve the specificity of primer binding.

[0046] 2. The primer composition for rapid detection of exon 7 deletion site of SMN1 gene of the present invention adopts mutation amplification blocking system (AMRS-PCR), and downstream primers are designed according to different target genes, which specifically amplifies SMN1 gene while avoiding interference of SMN2 gene; and the primer composition for rapid detection of exon 8 deletion site of SMN1 gene adopts mutation termination modification blocking system (AMRS-PCR), and probes are designed according to different target genes, which specifically amplifies SMN2 gene while avoiding interference of SMN1 gene.

[0047] 3. The probe for rapid detection of the SMN1 gene of the present invention also uses MGB probes, which can specifically bind to the differential sites, accurately distinguish SMN1 from SMN2, and further reduce the impact of the SMN2 copy number.

[0048] 4. The present invention also provides primer probes for detecting the copy number of SMN2 exon 7 and exon 8. At the same time, a fluorescent quantitative PCR technology platform is used, which has the advantages of being simple, convenient, fast and accurate in distinguishing the known mutation sites of the SMN1 gene from the SMN2 gene, and distinguishing the gene deletion of SMN1, and distinguishing between single copies and double copies, and is suitable for auxiliary diagnosis of SMA patients and screening of SMA carriers.

[0049] 5. The present invention sets an internal standard, which can effectively avoid false negative test results and monitor the collection, transportation and extraction process of the test sample. In addition, according to the combination of different gene amplification fragments and fluorescent probes, single-tube simultaneous detection can be achieved quickly and effectively, greatly improving the detection throughput. The selected internal standard is TOP3A, which exists stably in a single copy in the genome.

[0050] 6. The present invention not only detects the deletion of exon 7 of the SMN1 gene, but can also distinguish the deletion of exon 8 of the SMN1 gene, which is beneficial for assisting the diagnosis of exon 7 deletion while ensuring the stability of the system.

[0051] 7. Compared with the probe method in the prior art, the primer method (combined with amplification retardation mutation system PCR (ARMS-PCR) and competitive primer PCR (COP-PCR)) adopted in the present invention can solve the problems of extremely unstable and poor repeatability of the above-mentioned probe amplification, and the kit prepared based on the designed primer-probe combination of the present invention has high sensitivity, good specificity and high stability (precision).

[0052] 8. The determination method of the present invention introduces a relative quantitative method (△△Ct=△Cts-△Cta), which can eliminate the influence of different reagents, instruments, and well positions, and further improve the ability to distinguish single copies from double copies. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings: Figure 1 is the amplification curve of SMN1 sample 2 in Example 4; Figure 2 is the amplification curve of SMN1 sample 3 in Example 4; Figure 3 is the amplification curve of SMN1 sample 9 in Example 4; Figure 4 is the amplification curve of SMN2 sample 9 in Example 4; Figure 5 This is the amplification curve of SMN2 sample 1 in Example 4. DETAILED DESCRIPTION

[0054] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. The following examples are implemented on the premise of the technical solution of the present invention, provide detailed implementation methods and specific operation processes, and will help those skilled in the art to further understand the present invention. It should be pointed out that the protection scope of the present invention is not limited to the following embodiments, and several adjustments and improvements made under the premise of the concept of the present invention all belong to the protection scope of the present invention.

[0055] Example 1 Design and optimization of specific primers and probes 1. Design of specific primers and probes The SMN1 gene, SMN2 gene, and TOP3A gene were downloaded through NCBI search, and specific amplification primers and molecular beacons or Taqman probes for the above sequence sites were designed using Beacon Designer or Primer 3 software, respectively, and synthesized by Shanghai Shuoying Biotechnology Co., Ltd.

[0056] The reference sequence of SMN1 gene in NCBI is: NC_000005.10,REGION:70924941..70966375; The reference sequence of SMN2 gene in NCBI is: NC_000005.10,REGION:70049523..70090528; The reference sequence of TOP3A gene on NCBI is: NC_000017 REGION: complement(18271428..18314994); The designed primer sequences are shown in Table 1: Table 1

[0057] The specific sequence is: SEQ ID No.1: GCTAT+CTATGT+CTATATAG*; SEQ ID No.2: ATATATAGCTATCTATATCTATATAGCTATTTTT; SEQ ID No.3: ACCTTCCTTCTTTTTGATTTTGTCTG; SEQ ID No.4: TAACTTCCTTTATTTTCCTTACAGGG; SEQ ID No.5: GCTAT+CTATAT+CTATATAG*; SEQ ID No.6: ATATATAGCTATCTATGTCTATATAGCTATTTTT; SEQ ID No.7: ACCTTCCTTCTTTTTGATTTTGTCTA; SEQ ID No.8:GAAAAACCATCTGTAAAAGACTGG; SEQ ID No.9:TCTGTAAAAGACTGAGGTGGG; SEQ ID No.10: CACATTCAAATTTTCTCAACT; SEQ ID No.11: GGAGGCCAGCACGGTGGTGAGG; SEQ ID No.12:GAAAAACCATCTGTAAAAGACTGA; SEQ ID No.13:TCTGTAAAAGACTGGGGTGGG; SEQ ID No.14: GAACAGCGACTGTACGAGTTTATTG; SEQ ID No.15: CCTGCCCCTGAGCATCCT; SEQ ID No.16: TCGCCATTCCTGGCTTGCTGC; Among them, * indicates that the primer is a locked nucleotide modified probe, +C indicates that the base position is modified (i.e., the methylene bridge connecting the 2'-O atom and the 4'-C atom on the ribose ring of the base is "locked"), and other bases are not modified; The blocking oligonucleotide was terminated with a C3 Spacer.

[0058] 2. Optimization of specific primers and probes 2.1. Screening of specific primers and probes In Table 1, SMN1-EXON7-R1, SMN2-EXON7-R1, SMN1-EXON8-F1, and SMN2-EXON8-F1 are the primers after screening. The primers designed for ARMS primer screening are shown in Table 2. The screening process is as follows: Table 2

[0059] The primers with m at the end (m1m2m3) used for screening introduce terminal non-matching into the second to last base at the 3' end.

[0060] Results: Table 3

[0061] The results are shown in Table 3: The three screening primers (m1m2m3) of the ARMS primer SMN1-EXON7-R1 that introduced mutation points can better distinguish SMN2 from SMN1 (see SMN2 is not amplified), but their own amplification ability is poor, and the Ct value is delayed by 3-10 compared with R1. After comprehensive consideration, SMN1-EXON7-R1 is still selected, and its Ct value is 11 cycles different from that of SMN2, with an amplification efficiency difference of nearly 2000 times. The primers used to amplify SMN2 are similar, so SMN2-EXON7-R1 is also selected.

[0062] Results: Table 4

[0063] The results are shown in Table 4: The difference in Ct values ​​of SMN1-EXON8-F1 in amplifying SMN1 and SMN2 is 6, and the difference in amplification efficiency is close to 50-100 times. The primers (m1m2m3) after the introduction of mutations still have no increase in their resolution, but the amplification efficiency is generally reduced, so the primer SMN1-EXON8-F1 without the introduction of mutations is still selected. The results of the primers used to detect SMN2 are similar, so the primer SMN2-EXON8-F1 without the introduction of mutations is still selected.

[0064] Therefore, after ARMS primer screening, SMN1-EXON7-R1, SMN2-EXON7-R1, SMN1-EXON8-F1, and SMN2-EXON8-F1 were finally selected.

[0065] 2.2. Introduction of LNA nucleotides Table 1 shows the introduction of LNA nucleotides in primers, and Table 5 shows the LNA nucleotides used for comparison.

[0066] Table 5

[0067] Results: Table 6

[0068] The results are shown in Table 6: After the introduction of LNA, the amplification efficiency increased, and the Ct value of amplified SMN1 was advanced; and the resolution was also increased, and the difference in Ct values ​​of amplified SMN1 and SMN2 became larger, so it was chosen to introduce LNA nucleotides into the specific primers.

[0069] 2.3. Addition of Blocker The increase of Blocker in the primer probe of Table 1 is shown in Table 7.

[0070] Table 7: Comparison of the differences after adding Blocker

[0071] The results showed that adding a Blocker could slightly improve the resolution, so we chose to add a Blocker to the primer probe.

[0072] In summary, this example screened specific primers and probes, introduced LNA nucleotides, and added blockers to ultimately design and optimize the primer probes shown in Table 1.

[0073] Example 2 Sample nucleic acid extraction (1) Clinical sample collection, storage and transportation: Peripheral venous blood, EDTA anticoagulation method. Samples that can be tested within 24 hours can be stored at 4°C; samples that cannot be tested within 24 hours should be stored at -70°C or below (if -70°C storage conditions are not available, temporarily store in a -20°C refrigerator). Samples should not be frozen and thawed more than 5 times, otherwise the test results will be affected.

[0074] (2) Nucleic acid extraction: The sample nucleic acid was extracted using the Qiagen QIAamp DNA Blood Mini Kit according to the instructions. The ratio of OD260nm / OD280nm of human genomic DNA after extraction was required to be between 1.7 and 2.0. The DNA concentration was between 1ng / uL and 100ng / uL. If the concentration exceeded the range, it should be re-extracted, diluted or discarded.

[0075] The sample information and nucleic acid concentration information are shown in Table 8 below: Table 8

[0077] Example 3 Detection of the extracted sample nucleic acid 1. Prepare the amplification reaction system shown in Table 11 using the detection solution in Table 9 or 10: Table 9 Test solution configuration table (exon 7 / 8 test solution)

[0078] Take the SMN1 gene as an example Table 10 Test solution configuration table (exon 7 / 8 test solution)

[0079] Taking the SMN2 gene as an example Table 11 Amplification reaction system preparation table

[0080] Take the SMN1 gene as an example RT-PCR amplification was performed according to the following program: 97°C for 5 min; 97°C for 10 s, 58°C for 45 s, for a total of 45 cycles.

[0081] 2. The kit also includes normal control, single copy control, and deletion control, all of which are plasmids purchased from Qingke Biotechnology. They can be used after diluting to 10 to the 7th power with TE buffer. Normal control, single copy control, and deletion control are all prepared by mixing three different plasmids, SMN1 plasmid (SEQ ID No.30), SMN2 plasmid (SEQ ID No.31), and TOP3A plasmid (SEQ ID No.32), in the following proportions. In the normal control, the copy number of internal standard gene: SMN1 gene: SMN2 gene is 2:2:2; in the single copy control, the copy number of internal standard gene: SMN1 gene: SMN2 gene is 2:1:1; in the deletion control, the copy number of internal standard gene: SMN2 gene is 2:2. The blank control is pure water.

[0082] Normal controls, single copy controls, deletion controls, and blank controls were configured and tested in the same manner as the sample nucleic acid.

[0083] Example 4 Result Analysis According to the ΔCt values ​​and ΔΔCt calculations of different targets, the results are shown in Table 12: Table 12 Results interpretation

[0084] Take the SMN1 gene as an example Tube A is exon 7 of the SMN1 gene; tube B is exon 8 of the SMN1 gene.

[0085] △△Ct=△Cts-△Cta The amplification curves corresponding to sample 2, sample 3, and sample 9 are as follows: Figure 1-3 As shown; among them, Figure 1 The SMN1 in the ovary is the exon 1 copy of EXON7 (i.e. SMN1 carrier, the spouse needs to be screened), Figure 2 The SMN1 in the test is EXON7 exon 2 or more (i.e. SMN1 is normal, no need to screen the spouse), Figure 3 In the case of SMN1, there is 0 copy of exon 7 (i.e., SMN1 is deleted, and the patient needs to detect SMN2 copy).

[0086] SMA patients (SMN10 copy samples) were selected for SMN2 copy number testing, and the samples were 6 cases in total, namely samples 1, 5, 9, 10, 17, and 20. The results are shown in Table 13.

[0087] Table 13

[0088] The C tube is exon 7 of the SMN2 gene; the D tube is exon 8 of the SMN2 gene.

[0089] The amplification curves corresponding to sample 9 and sample 1 are as follows: Figure 4-5 As shown, Figure 4 SMN2 is the first copy of exon 1 of EXON7 (if SMN1 is missing, the disease may be very serious). Figure 5 SMN2 is EXON7 exon 2 or more copies (if SMN1 is normal, the disease may be milder).

[0090] Example 5 Specificity Analysis The method of the present invention is used to detect the four cases where the copies of SMN2 (when detecting SMN1 gene) and SMN1 (when detecting SMN2 gene) are 3, 4, 5, and 6, and there is no crossover.

[0091] The method of the present invention has no cross-talk with common pathogens such as HBV virus, HCV virus, cytomegalovirus, and herpes simplex virus type 1 (HSV1).

[0092] The details are shown in Table 14.

[0093] Table 14

[0095] Example 6 Sensitivity Analysis Detection limit exploration (taking the copy number of exon 7 of SMN1 gene as an example) The samples containing human nucleic acid were diluted to 10, 5, 2, 1, and 0.5 ng / uL, and 3 replicates were tested for each concentration. The lowest concentration of 100% (3 / 3) was used as the set detection limit for verification, and the results are shown in Table 15.

[0096] Table 15: Detection limit exploration

[0097] When sample 1 was diluted to 0.5 ng / uL, there was an error in interpretation. Therefore, the detection limit was set to 1 ng / uL for verification.

[0098] The sample containing human nucleic acid sample was diluted and amplified by multiplex fluorescence quantitative PCR to the lowest detection limit of 1ng / uL. 20 replicates were performed and the result was considered passed if the positive rate was greater than 95% (19 / 20).

[0099] L1: Take 20uL of 1 copy of SMN1 nucleic acid and add it to TE solution to obtain 1ng / uL; L2: Take 20uL of 2 copies of SMN1 nucleic acid and add it to TE solution to obtain 1ng / uL; L3: Take 20uL of SMN1 0-copy nucleic acid and add it to TE solution to obtain 1ng / uL; Exon 7 of SMN1; As shown in Table 16: Table 16: Detection Limit Verification

[0101] L4: Take 20uL of 2 copies of SMN2 nucleic acid and add it to TE solution to obtain 1ng / uL; L5: Take 20uL of 1 copy of SMN2 nucleic acid and add it to TE solution to obtain 1ng / uL; Exon 7 of SMN2; As shown in Table 17: Table 17

[0103] Example 7 Precision Analysis Precision (taking exon 7 and exon 8 of SMN1 gene as an example), 2ng / uL was repeated 10 times. The CV value was less than 5% and the results are shown in Table 18.

[0104] Table 18

[0106] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A primer and probe combination for detecting SMN1 and SMN2 gene copy number variation, characterized in that: The primer and probe combination includes the following sequences: The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON7 site of the SMN1 gene are shown in SEQ ID No. 1-3, respectively; the nucleotide sequence of the probe for detecting the EXON7 site of the SMN1 gene is shown in SEQ ID No. 4; The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON7 site of the SMN2 gene are shown in SEQ ID No. 5-7, respectively; the nucleotide sequence of the probe for detecting the EXON7 site of the SMN2 gene is shown in SEQ ID No. 4; The nucleotide sequences of the upstream primer, blocker, and downstream primer used to detect the EXON8 site of the SMN1 gene are shown in SEQ ID No. 8-10, respectively; The nucleotide sequence of the probe used to detect the EXON8 site of the SMN1 gene is shown in SEQ ID No. 11; The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON8 site of the SMN2 gene are shown in SEQ ID No. 12, SEQ ID No. 13, and SEQ ID No. 10, respectively; the nucleotide sequence of the probe for detecting the EXON8 site of the SMN2 gene is shown in SEQ ID No. 11; The nucleotide sequences of the primers used to detect the internal standard gene TOP3A are shown in SEQ ID No.14-15 respectively; the nucleotide sequence of the probe used to detect the internal standard gene TOP3A is shown in SEQ ID No.

16.

2. The primer and probe combination according to claim 1, characterized in that: The 5' and 3' ends of the probe carry a fluorescent group and a quenching group, respectively, wherein the fluorescent group is selected from any one or more of FAM, HEX, VIC, TET, TAMRA, ROX, CY3.5, and CY5; the quenching group is selected from any one or more of BHQ1, BHQ2, BHQ3, DABCYL, and MGB.

3. Use of the primer and probe combination as claimed in claim 1 or 2 in the preparation of a kit for detecting SMN1 and SMN2 gene copy number variation.

4. A kit for detecting SMN1 and SMN2 gene copy number variation, characterized in that: The kit comprises a detection solution and an enzyme mixture; the detection solution comprises the primer and probe combination as claimed in claim 1 or 2, and the concentration of each primer or probe in the primer and probe combination is 0.2-0.4 μM.

5. The kit according to claim 4, characterized in that The detection liquid includes SMN1 gene E7 detection liquid, SMN1 gene E8 detection liquid, SMN2 gene E7 detection liquid, and SMN2 gene E7 detection liquid; In the SMN1 gene E7 detection solution, the concentration of the primers or probes shown in SEQ ID No.1, SEQ ID No.3, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No.2, SEQ ID No.4, and SEQ ID No.16 is 0.2 μM; In the SMN2 gene E7 detection solution, the concentration of the primers or probes shown in SEQ ID No.5, SEQ ID No.7, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No.6, SEQ ID No.4, and SEQ ID No.16 is 0.2 μM; In the SMN1 gene E8 detection solution, the concentration of the primers or probes shown in SEQ ID No.8, SEQ ID No.10, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No.9, SEQ ID No.11, and SEQ ID No.16 is 0.2 μM; In the SMN2 gene E8 detection solution, the concentration of the primers or probes shown in SEQ ID No.12, SEQ ID No.10, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No.13, SEQ ID No.11, and SEQ ID No.16 is 0.2 μM.

6. The kit according to claim 4, characterized in that The detection solution also includes PCR buffer, 3.2-3.4 mM MgCl2, and 0.1-0.4 mM dNTPs; the dNTPs include one or more of dATP, dTTP, dCTP, dGTP, and dUTP.

7. The kit according to claim 4, characterized in that The enzyme mixture includes DNA polymerase.

Images