Molecular marker related to low-nitrogen tolerance of wheat

Abstract

The invention discloses a molecular marker related to low-nitrogen tolerance of wheat. The molecular marker related to the low-nitrogen tolerance of the wheat, disclosed by the invention, is nucleotide corresponding to the 4097 site of SEQ ID No.1 in a sequence table in a wheat genome, and the nucleotide corresponding to the 4097 site of SEQ ID No.1 in the sequence table in the wheat genome is A or G. Experiments prove that the low-nitrogen tolerance capacity of the homozygous wheat with the wheat low-nitrogen tolerance molecular marker A is remarkably lower than that of the homozygous wheat with the wheat low-nitrogen tolerance molecular marker G, and the homozygous wheat with the wheat low-nitrogen tolerance molecular marker G has higher low-nitrogen tolerance capacity and is an excellent nucleotide type of the wheat low-nitrogen tolerance molecular marker; the wheat low-nitrogen tolerance molecular marker can be used for wheat breeding.

Description

Technical Field

[0001] The invention relates to a molecular marker related to wheat low nitrogen tolerance in the field of biotechnology. Background Art

[0002] Nitrogen is the main mineral nutrient element for plants and one of the important nutrients that determine crop yield and quality. The nitrogen use efficiency (NUE) of wheat in my country is only 33%. Excessive fertilization not only wastes resources but also causes environmental pollution. Improving the nitrogen use efficiency of wheat varieties can not only reduce the amount of nitrogen fertilizer used in wheat production and improve fertilizer use efficiency, but also reduce environmental pollution. Therefore, it is of great significance for wheat production to analyze the genetic basis of crop nitrogen use efficiency, explore crop nitrogen use efficiency genes, clarify the molecular mechanism of wheat nitrogen efficient use, and cultivate nitrogen efficient use varieties. Summary of the invention

[0003] The technical problem to be solved by the present invention is how to detect the low nitrogen tolerance of wheat.

[0004] In order to solve the above technical problems, the present invention first provides the application of a substance for detecting wheat molecular markers in detecting or assisting in detecting wheat low nitrogen tolerance;

[0005] The wheat molecular marker is the nucleotide at position 4097 in the wheat genome corresponding to SEQ ID No. 1 in the sequence list, and the nucleotide at position 4097 in the wheat genome corresponding to SEQ ID No. 1 in the sequence list is A or G.

[0006] In the above application, the substance for detecting wheat molecular markers may contain a primer set consisting of positions 1-23 of SEQ ID No. 2, positions 1-23 of SEQ ID No. 3 and three single-stranded DNAs shown in SEQ ID No. 4 in the sequence list.

[0007] In the above application, the substance for detecting wheat molecular markers contains a primer set consisting of three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 in the sequence table.

[0008] The substance may also include 2×Mastermix (LGC Genomics, Hoddesdon, UK). The substance may be only a primer set consisting of the three single-stranded DNAs shown in positions 1 to 23 of SEQ ID No.2, positions 1 to 23 of SEQ ID No.3 and SEQ ID No.4 in the sequence list, or only a primer set consisting of the three single-stranded DNAs shown in SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 in the sequence list, or a primer set consisting of the three single-stranded DNAs shown in SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 in the sequence list and 2×Mastermix (LGC Genomics, Hoddesdon, UK).

[0009] The single-stranded DNA in each primer set can be packaged independently, and the molar number of each single-stranded DNA can be the same.

[0010] In the above application, the low nitrogen tolerance of the homozygous wheat whose nucleotide at position 4097 corresponding to SEQ ID No.1 in the sequence list is G is higher or has a higher potential to be higher than that of the homozygous wheat whose nucleotide at position 4097 corresponding to SEQ ID No.1 in the sequence list is A.

[0011] The present invention also provides a method for detecting or assisting in detecting the low-nitrogen tolerance of wheat, the method comprising detecting the wheat molecular marker, and determining the low-nitrogen tolerance of wheat according to the following method: the low-nitrogen tolerance of homozygous wheat whose nucleotide at position 4097 corresponding to SEQ ID No.1 in the sequence list is G is higher than or has a candidate higher low-nitrogen tolerance than the homozygous wheat whose nucleotide at position 4097 corresponding to SEQ ID No.1 in the sequence list is A.

[0012] In the above method, the wheat molecular marker is detected using the substance for detecting wheat molecular marker.

[0013] The substance for detecting wheat molecular markers also falls within the protection scope of the present invention.

[0014] The wheat molecular markers also fall within the protection scope of the present invention.

[0015] The present invention also provides any of the following applications:

[0016] X1) Application of the wheat molecular marker in wheat breeding;

[0017] X2) Use of the wheat molecular marker in detecting or assisting in detecting wheat low nitrogen tolerance;

[0018] X3) Application of the substance for detecting wheat molecular markers in wheat breeding;

[0019] X4) Use of the substance for detecting wheat molecular markers in preparing wheat breeding products;

[0020] X5) Use of the substance for detecting wheat molecular markers in the preparation of a product for detecting or assisting in detecting wheat low nitrogen tolerance;

[0021] X6) Application of the method for detecting or assisting in detecting wheat low nitrogen tolerance in wheat breeding;

[0022] X7) Use of detecting a substance corresponding to the 4097th nucleotide of SEQ ID No. 1 in the sequence list in the wheat genome in breeding wheat with low nitrogen tolerance;

[0023] X8) Use of a substance corresponding to the 4097th nucleotide of SEQ ID No. 1 in the sequence list in the wheat genome for preparing a product for breeding wheat with excellent low nitrogen tolerance.

[0024] The present invention also provides a wheat breeding method, which comprises: detecting the 4097th nucleotide in the wheat genome corresponding to SEQ ID No.1 in the sequence list, and selecting wheat whose 4097th nucleotide in the wheat genome corresponding to SEQ ID No.1 in the sequence list is G as a parent for breeding.

[0025] In one embodiment of the present invention, the low nitrogen tolerance is reflected in the wheat low nitrogen tolerance index TKWR (relative thousand-grain weight = thousand-grain weight under low nitrogen / thousand-grain weight under high nitrogen).

[0026] In the present invention, the low nitrogen refers to the nitrogen content in the wheat growth environment being lower than the nitrogen content required for the normal growth of common wheat. The high nitrogen refers to the nitrogen content in the wheat growth environment meeting the nitrogen content required for the normal growth of common wheat.

[0027] Experiments have shown that the low nitrogen tolerance of the homozygous wheat with the wheat low nitrogen tolerance molecular marker A is significantly lower than that of the homozygous wheat with the wheat low nitrogen tolerance molecular marker G. The homozygous wheat with the wheat low nitrogen tolerance molecular marker G has a stronger tolerance to low nitrogen and is an excellent nucleotide type of the wheat low nitrogen tolerance molecular marker. This shows that the wheat low nitrogen tolerance molecular marker of the present invention is related to the low nitrogen tolerance of wheat.

[0028] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Comparison of low nitrogen tolerance index of wheat. Hap4 represents the low nitrogen tolerance index of homozygous wheat with low nitrogen tolerance molecular marker G; other haplotypes represent the low nitrogen tolerance index of homozygous wheat with low nitrogen tolerance molecular marker A. DETAILED DESCRIPTION

[0030] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The quantitative tests in the following examples were all repeated at least three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0031] Example 1: Molecular markers associated with low nitrogen tolerance in wheat

[0032] This example found that there is a molecular marker related to low nitrogen tolerance in the wheat genome, which is recorded as the wheat low nitrogen tolerance molecular marker, which is the nucleotide at position 4097 of SEQ ID No. 1 in the sequence table. In the wheat genome, the wheat low nitrogen tolerance molecular marker is A or G.

[0033] 1. Wheat material

[0034] The 223 wheat materials used are shown in Table 2.

[0035] 2. Detection of molecular markers for low nitrogen tolerance in wheat

[0036] The genomic DNA of each wheat material was extracted using the CTAB method;

[0037] KASP primers were designed for the molecular marker of wheat low nitrogen tolerance, including two SNP-specific primers (F1 / F2) and a universal primer (R). The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The sequences of the primers are as follows:

[0038] SNP-F1: 5′-GCCCCTCTCTGTTTTATTTTGAGT AAGGTGACCAAAGTTCATGCT -3′ (SEQ ID No. 2, the non-underlined part is a wheat-specific primer, and the underlined part is used to bind FAM);

[0039] SNP-F2: 5′-GCCCCTCCTGTTTATTTTGAGC AAGGTCGGAGTCAACGGATT-3′ (SEQ ID No. 3, the non-underlined part is a wheat-specific primer, and the underlined part is used to bind HEX);

[0040] SNP-R: 5′-GTGACTCTGTTAGTGTGGTCTG-3′ (SEQ ID No. 4).

[0041] Using the genomic DNA of each wheat material as a template, PCR amplification was performed using primers at each site. The reaction system was as follows:

[0042] The KASP reaction system included: 2×Mastermix (LGC Genomics, Hoddesdon, UK) 2.5 μL, KASP primers (SNP-F1, SNP-F2, SNP-R) 0.056 μL, DNA template 80 ng, and a total reaction volume of 5 μL.

[0043] The KASP reaction program was as follows: denaturation for 15 min (95°C); denaturation for 20 s (95°C), annealing for 60 s (65°C), decreasing 0.8°C each cycle, for a total of 10 cycles; denaturation for 20 s (94°C), annealing for 60 s (55°C), for a total of 32 cycles.

[0044] The reaction system was amplified by PCR on an ABI Veriti 384PCR instrument (Thermo Fisher), and the PCR amplification product was scanned and read with an Omega FSNP typing detector (LGC Genomics Ltd, KBS-0024-002) after the reaction. KlusterCallerTM (KBioscience) was used for genotyping, and the nucleotides of the molecular marker sites of each wheat were determined based on the analysis results.

[0045] The test results of 223 wheat materials are shown in Table 1. There are 165 homozygous wheat plants with the wheat low nitrogen tolerance molecule marker A, and there are 58 homozygous wheat plants with the wheat low nitrogen tolerance molecule marker G.

[0046] 3. Analysis of different wheat phenotypes

[0047] The GWAS analysis population was planted at the Shenfeng Experimental Base of Shanxi Agricultural University, Taigu District, Jinzhong City, Shanxi Province (37.25°N, 112.25°E) during the wheat growing season in 2017-2018, 2018-2019 and 2019-2020, and at the Shijiazhuang Northern Agricultural Science Park, Zhao County, Hebei Province (37.84°N, 114.85°E) Experimental Station in 2018-2019 and 2019-2020. Field trials were conducted on 223 wheat materials, and relevant agronomic traits and yield traits were investigated and counted.

[0048] The soil in the test site is sandy soil. In the Shenfeng test field in 2017-2018, the 0-20cm soil layer before sowing contained 13.51g / kg organic matter, 1.21g / kg total nitrogen, 60.22mg / kg alkaline nitrogen, 10.51mg / kg available phosphorus, and 98.1mg / kg available potassium. In Zhao County, Hebei Province, the 0-20cm soil layer before sowing in 2018-2019 contained 20.60g / kg organic matter, 1.97g / kg total nitrogen, 90.34mg / kg alkaline nitrogen, 18.72mg / kg available phosphorus, and 115.24mg / kg available potassium.

[0049] The experiment used a randomized block design and was repeated three times at two nitrogen levels. The first was a low nitrogen treatment (LN), where only a small amount of nitrogen was present in the soil (no nitrogen fertilizer was applied); the second was a high nitrogen treatment (HN), where nitrogen fertilizer was added to the original soil in the form of urea (Beijing Coolbo Technology Co., Ltd.), with a total of 18 kg / 667 m 2 , apply 5.4kg / 667m before sowing 2 , 7.2kg / 667m for long-term stem extension 2 , 5.4kg / 667m3 was applied at heading stage 2 The entire experiment included two environments: 2019 Hebei Low Nitrogen (2019HB(LN)) and 2019 Hebei High Nitrogen (2019HB(HN)). Single row planting, row length 2m, row width 25cm, plant spacing 5cm. Field management was the same as field production.

[0050] Field tests were conducted on 223 wheat materials at two wheat experimental bases, and the relevant agronomic traits and yield traits were investigated and statistically analyzed in combination with two nitrogen fertilizer level factors. The thousand-grain weight (TKW) of seven representative plants was investigated in each sample group.

[0051] The results (Table 1) show that the low nitrogen tolerance index TKWR (relative thousand-grain weight = thousand-grain weight under low nitrogen / thousand-grain weight under high nitrogen) of the homozygous wheat with the low nitrogen tolerance molecular marker A is 0.936 on average, which is significantly lower than the TKWR (average 0.949) of the homozygous wheat with the low nitrogen tolerance molecular marker G. The homozygous wheat with the low nitrogen tolerance molecular marker G has a stronger tolerance to low nitrogen and is an excellent nucleotide type of the low nitrogen tolerance molecular marker of wheat. It shows that the wheat low nitrogen tolerance molecular marker of the present invention is related to the low nitrogen tolerance of wheat.

[0052] Table 1. Nucleotide and phenotype of molecular markers for low nitrogen tolerance in wheat

[0053]

[0054]

[0055]

[0056] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of wheat molecular markers in detecting or assisting in detecting wheat's tolerance to low nitrogen; The wheat molecular marker is the nucleotide at position 4097 in the wheat genome corresponding to SEQ ID No. 1 in the sequence list, and the nucleotide at position 4097 in the wheat genome corresponding to SEQ ID No. 1 in the sequence list is A or G.

2. The use according to claim 1, characterized in that: The substance for detecting wheat molecular markers contains a primer set consisting of positions 1 to 23 of SEQ ID No. 2, positions 1 to 23 of SEQ ID No. 3 and three single-stranded DNAs shown in SEQ ID No. 4 in the sequence list.

3. The use according to claim 1, characterized in that: The substance for detecting wheat molecular markers contains a primer set consisting of three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 in the sequence table.

4. The use according to any one of claims 1 to 3, characterized in that: The low nitrogen tolerance of the homozygous wheat whose nucleotide at position 4097 corresponding to SEQ ID No. 1 in the sequence list is G is higher or has a potential higher tolerance than the homozygous wheat whose nucleotide at position 4097 corresponding to SEQ ID No. 1 in the sequence list is A.

5. A method for detecting or assisting in detecting wheat low nitrogen tolerance, characterized in that: The method comprises detecting the wheat molecular markers described in claim 1, and determining the low nitrogen tolerance of wheat according to the following method: the low nitrogen tolerance of the homozygous wheat whose nucleotide at the 4097th position corresponding to SEQ ID No.1 in the sequence list is G is higher than or has a higher potential to be higher than the homozygous wheat whose nucleotide at the 4097th position corresponding to SEQ ID No.1 in the sequence list is A.

6. The method according to claim 5, characterized in that: The detection of the wheat molecular markers described in claim 1 is carried out using the substance for detecting wheat molecular markers described in any one of claims 1-3.

7. The substance for detecting wheat molecular markers according to any one of claims 1 to 3.

8. The wheat molecular marker according to claim 1.

9. Any of the following applications: X1) Use of the wheat molecular marker described in claim 1 in wheat breeding; X2) Use of the wheat molecular marker described in claim 1 in detecting or assisting in detecting wheat low nitrogen tolerance; X3) Use of the substance for detecting wheat molecular markers according to any one of claims 1 to 3 in wheat breeding; X4) Use of a substance for detecting wheat molecular markers according to any one of claims 1 to 3 in the preparation of wheat breeding products; X5) Use of the substance for detecting wheat molecular markers according to any one of claims 1 to 3 in the preparation of a product for detecting or assisting in detecting wheat low nitrogen tolerance; X6) Use of the method according to claim 5 or 6 in wheat breeding; X7) Use of detecting a substance corresponding to the 4097th nucleotide of SEQ ID No. 1 in the sequence list in the wheat genome in breeding wheat with low nitrogen tolerance; X8) Use of a substance corresponding to the 4097th nucleotide of SEQ ID No. 1 in the sequence list in the wheat genome for preparing a product for breeding wheat with excellent low nitrogen tolerance.

10. A wheat breeding method comprising: The 4097th nucleotide corresponding to SEQ ID No. 1 in the sequence list in the wheat genome is detected, and the wheat whose 4097th nucleotide corresponding to SEQ ID No. 1 in the sequence list is G is selected as a parent for breeding.

Images