Molecular marker for identifying low temperature resistance of cotton, KASP primer group and application of molecular marker and KASP primer group

Abstract

The invention discloses a molecular marker for identifying low-temperature resistance of cotton, a KASP primer group and application of the molecular marker and the KASP primer group, and relates to the technical field of crop breeding and biology. A nucleotide sequence of the molecular marker for identifying the low-temperature resistance of the cotton is shown as SEQ ID NO.1, the 51bp position of the nucleotide sequence is an SNP site, and T / C mutation exists; and the genotypes of the SNP sites comprise TT and CC genotypes. By utilizing the molecular marker or the KASP primer group, individuals carrying low-temperature-resistant functional genes can be quickly identified and screened in early generations or primarily selected populations of cotton breeding, unnecessary strains are eliminated, the scale of breeding populations is reduced, the breeding cost can be greatly reduced, and the breeding efficiency can be improved.

Description

Technical Field

[0001] The invention relates to the field of crop breeding and biotechnology, and more particularly to molecular markers for identifying cotton low-temperature resistance, a KASP primer set and applications thereof. Background Art

[0002] Cotton is an important economic crop. It is generally suitable for growing in warm areas and is sensitive to low temperatures. Low temperatures during the sowing period will affect the elongation rate of the hypocotyl during cotton germination, and in severe cases will cause cotton seeds and buds to rot. When cotton is exposed to low temperatures during the boll opening period, its quality and yield will be severely reduced.

[0003] Functional markers are a new type of molecular markers developed based on polymorphic motifs within functional genes that cause phenotypic trait variation.

[0004] At present, commonly used SNP detection methods include direct sequencing, gene chip technology, mass spectrometry detection and KASP technology (competitive allele-specific PCR). KASP is an endpoint fluorescent genotyping technology based on known SNPs, which can accurately detect SNPs and InDels at specific sites in DNA samples. KASP genotyping technology can be used for the fine positioning of candidate genes, as well as for the rapid identification and screening of individuals carrying target functional genes in early breeding generations or primary selection groups, eliminating unnecessary strains, and reducing the size of breeding groups, which can significantly reduce breeding costs and improve breeding efficiency.

[0005] Therefore, exploring SNP loci related to cotton cold tolerance and developing KASP molecular markers for identifying SNP loci genotypes not only provide an effective detection method for breeding cold-tolerant cotton varieties and screening cold-tolerant germplasm resources, but also have important significance for improving cotton breeding efficiency, ensuring people's quality of life and sustainable agricultural development. Summary of the invention

[0006] In view of this, the present invention provides a molecular marker for identifying low temperature resistance of cotton, a KASP primer set and application thereof.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A molecular marker for identifying low temperature tolerance of cotton, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, the 51 bp position of the nucleotide sequence is a SNP site, and there is a T / C mutation; and the genotype of the SNP site includes TT and CC genotypes.

[0009] Preferably, when the genotype of the SNP site is CC, the low temperature resistance is strong, and when the genotype of the SNP site is TT, the low temperature resistance is poor.

[0010] Another object of the present invention is to provide a KASP primer set for identifying cotton cold tolerance, the primer set comprising SNP-specific primers with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3, and a universal primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0011] Another object of the present invention is to provide a detection kit for identifying the low temperature resistance of cotton, wherein the kit comprises the above-mentioned KASP primer set.

[0012] Another object of the present invention is to provide an application of the above-mentioned KASP primer set or the above-mentioned detection kit, wherein the application is any one of the following:

[0013] A. Identify the low temperature resistance of cotton;

[0014] B. Prepare testing products for identifying cotton's ability to withstand low temperatures;

[0015] C. Assisted cotton breeding.

[0016] Another object of the present invention is to provide a method for identifying low temperature resistance of cotton, comprising the following steps:

[0017] S1. Extract genomic DNA of the sample to be tested;

[0018] S2. amplifying genomic DNA using the above-mentioned KASP primer set or the above-mentioned detection kit;

[0019] S3. Analyze the results obtained in S2, identify the genotype, and determine the low temperature resistance of the sample to be tested based on the genotype. If the genotype is CC, the sample to be tested is a germplasm with strong low temperature resistance.

[0020] Preferably, the total amplification system in step S2 is 5 μL, including 2×KASP Master Mix 2.5 μL, KASP Assay Mix 0.07 μL, and template DNA 2.43 μL at a concentration of 20 ng / μL; wherein each 100 μL KASP Assay Mix includes 12 μL (100 μM) of each SNP-specific primer, 30 μL of universal primer (100 μM), and 46 μL of ultrapure water.

[0021] Preferably, the reaction procedure for the amplification in step S2 is: first step: 95°C, 10 min; second step: 95°C, 15 s, 61-55°C, 1 min, reducing 0.6°C in each cycle, for a total of 10 cycles; third step: 95°C, 20 s, 55°C, 1 min, for a total of 28 cycles, fluorescence scanning, 25-37°C, 30 s.

[0022] Beneficial effects: The molecular markers and KASP primer sets for identifying the low temperature resistance of cotton provided by the present invention are closely related to the low temperature resistance of cotton. By using the molecular markers or KASP primer sets, individuals carrying low temperature resistance functional genes can be quickly identified and screened in the early breeding generations or primary selection groups, unnecessary strains can be eliminated, and the size of the breeding group can be reduced, which can greatly reduce the breeding cost and improve the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0024] Figure 1 These are the control loci of cotton cold tolerance related genes obtained by GWAS analysis.

[0025] Figure 2 This is the genotyping map of 226 cotton germplasm resources detected by KASP_LT molecular marker. DETAILED DESCRIPTION

[0026] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Example 1

[0028] The collected 226 cotton samples were used as materials to identify the low temperature resistance phenotype of cotton: cotton seeds were planted in seedling boxes, 60 seeds were placed in each box, and the cotton cotyledons were expanded after about 7 days of cultivation at 25℃ to make the seedlings uniform. The slow-growing cotton seedlings were removed and placed in a 0℃ culture room for 48h. After being taken out, they were placed in a 25℃ culture room for recovery cultivation. After 7 days of recovery cultivation, low temperature resistance was identified and the samples were divided into 0, 1 and 2 levels for statistics according to normal growth without frostbite, slow growth with frostbite on cotyledons and death. The experiment was repeated 3 times for each material, and the phenotypic data were preliminarily statistically processed using WPS EXCEL (see Table 1).

[0029] In the 2023-2024 growing season, 226 cotton materials were planted at the experimental base of the Cotton Research Institute of Hebei Academy of Agricultural and Forestry Sciences in single-row plots, with 60 seeds per row, 7m long, and 0.30m row spacing, under conventional cultivation and management.

[0030] The genomic DNA of 226 cotton leaves was extracted by CTAB method and sent to Annoroad Gene Technology (Beijing) Co., Ltd. for DNA library construction. The sequencing platform used was DNBSEQ-T7, with Q30 ≥ 85%.

[0031] Genome-wide association study (GWAS) was performed on 226 materials. SNP detection was mainly achieved using the GATK software toolkit. The reference genome was upland cotton TM-1 (https: / / phytozome-next.jgi.doe.gov / info / Ghirsutum_v3_1). The filtering conditions for SNPs were MAF (Minor allelefrequency)>0.05 and Missing ratio<10%. Tassel v5.2.22 software was used to perform linkage disequilibrium analysis on 226 cotton materials. The r value of any two markers was used to determine the SNPs. 2 The genetic distance difference between the corresponding sites was calculated, and the LD decay diagram of the whole genome and each chromosome was drawn and the best regression curve was fitted. The decay distance was taken as the time when the LD value dropped to half of the maximum value. Based on the SNP data obtained by resequencing, SNP sites with MAF>0.05 and Missing ratio<10% were selected for population structure analysis. Structure v2.3.3 software was used to analyze 226 cotton germplasm materials, and SPAGeDi software was used to evaluate the kinship of 226 cotton materials, and the matrix of kinship values ​​(K matrix) was calculated. In order to reduce the influence of population structure and kinship between individuals on the results of association analysis, this study used the mixed linear model (mixed linear model, MLM, Q+K) of TASSEL software to conduct association analysis between the screened SNP markers and the low temperature resistance-related phenotypic traits of 226 cotton materials in the cotton germplasm resource population.

[0032] A low temperature tolerance control locus was detected on chromosome D13 of the reference genome of upland cotton TM-1 (https: / / phytozome-next.jgi.doe.gov / info / Ghirsutum_v3_1) by genome-wide association analysis, located in the physical interval 1343562-1343662 (see Appendix Figure 1), the sequence is: AATTCTACATAAAAATATGAAGAAACAAAAAAAAATTTCTCATAA TAATAYAATTTTGTGCAAATTGAATCTTAGCATAATTGGCATCGTT CATGTTGCAA (SEQID NO.1), which is named KASP_LT. The 53rd bp of KASP_LT is a SNP site, with a T / C mutation (Y represents T or C), and the genotype of the SNP site includes TT and CC genotypes. The genotypes of the 226 cotton germplasms at the SNP site in this example are shown in Table 1, wherein the CC genotype is a type with strong low temperature resistance, and the TT genotype is a type with poor low temperature resistance.

[0033] Table 1 GWAS analysis of genotypes related to low temperature tolerance in 226 cotton germplasm resources

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040] Example 2

[0041] PCR amplification primers were designed according to the SNP sites and flanking sequences obtained in Example 1 to develop KASP detection primers for the molecular marker. Two SNP-specific primers (KASP_F1 / KASP_F2) and one universal primer (R) were designed for each marker, and a specific sequence (underlined portion) capable of binding to FAM fluorescence was added to the tail of F1, and a specific sequence (underlined portion) capable of binding to VIC fluorescence was added to the tail of F2.

[0042] KASP_F1: 5'- GAAGGTGACCAAGTTCATGCT AAAATTTCTCAT AATAATAT-3', SEQ ID NO.2;

[0043] KASP_F2: 5'- GAAGGTCGGAGTCAACGGATT AAAATTTCTCAT AATAATAC-3', SEQ ID NO.3;

[0044] Universal primer R: 5'-TTGCAACATGAACGATGCCAA-3', SEQ ID NO.4.

[0045] The total KASP reaction system is 5 μL, including 2×KASP MasterMix 2.5 μL, KASP Assay Mix (primer mixed working solution) 0.07 μL, and 2.43 μL of template DNA with a concentration of 20 ng / μL. Among them, every 100 μL of KASP Assay Mix (primer mixed working solution) includes: 12 μL of each SNP-specific primer (100 μM), 30 μL of universal primer (100 μM), and 46 μL of ultrapure water.

[0046] KASP reaction procedure: Step 1: 95°C, 10 min; Step 2: 95°C, 15 s, 61-55°C, 1 min, 0.6°C lowered for each cycle, 10 cycles in total; Step 3: 95°C, 20 s, 55°C, 1 min, 28 cycles in total, fluorescence scanning, 25-37°C, 30 s. PCR amplification reaction was carried out in a water bath PCR instrument model Hydrocycler 16 (LGC). PCR results were scanned and analyzed by KASP fluorescence analyzer (LGC model PHERAstarplus) (see Appendix). Figure 2 ).

[0047] Example 3

[0048] 46 samples were selected from the 226 materials for amplification verification, and the KASP typing results were compared with the GWAS analysis results. The results showed that the KASP typing results were completely consistent with the GWAS analysis results (see Table 2), proving that the KASP primers KASP_F1 and KASP_F2 had good amplification effects, and Kasp_F1 and Kasp_F2 could be used in the breeding selection of KASP_LT.

[0049] Table 2 KASP primer typing validation results of GWAS analysis of 46 cotton germplasm resources

[0050]

[0051]

[0052] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0053] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A molecular marker for identifying low temperature resistance of cotton, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the 51 bp of the nucleotide sequence is a SNP site with a T / C mutation; and the genotype of the SNP site includes TT and CC genotypes.

2. The molecular marker for identifying low temperature tolerance of cotton according to claim 1, characterized in that: When the genotype of the SNP site is CC, the low temperature resistance is strong, and when the genotype of the SNP site is TT, the low temperature resistance is poor.

3. A KASP primer set for identifying low temperature tolerance of cotton, characterized in that: The primer set includes SNP-specific primers whose nucleotide sequences are shown as SEQ ID NO.2 and SEQ ID NO.3, and a universal primer whose nucleotide sequence is shown as SEQ ID NO.

4.

4. A detection kit for identifying the low temperature resistance of cotton, characterized in that: The kit comprises the KASP primer set according to claim 2.

5. Use of the KASP primer set according to claim 3 or the detection kit according to claim 4, characterized in that: The application is any of the following: A. Identify the low temperature resistance of cotton; B. Prepare testing products for identifying cotton's ability to withstand low temperatures; C. Assisted cotton breeding.

6. A method for identifying the low temperature resistance of cotton, characterized in that: The following steps are involved: S1. Extract genomic DNA of the sample to be tested; S2. Amplifying genomic DNA using the KASP primer set according to claim 3 or the detection kit according to claim 4; S3. Analyze the results obtained in S2, identify the genotype, and determine the low temperature resistance of the sample to be tested based on the genotype. If the genotype is CC, the sample to be tested is a germplasm with strong low temperature resistance.

7. The method for identifying low temperature resistance of cotton according to claim 6, characterized in that: The total amplification system in step S2 is 5 μL, including 2×KASP MasterMix 2.5 μL, KASP Assay Mix 0.07 μL, and template DNA 2.43 μL at a concentration of 20 ng / μL; wherein each 100 μL KASP Assay Mix includes 12 μL (100 μM) of each SNP-specific primer, 30 μL of universal primer (100 μM), and 46 μL of ultrapure water.

8. The method for identifying low temperature resistance of cotton according to claim 6, characterized in that: The amplification reaction procedure in step S2 is as follows: step 1: 95°C, 10 min; The second step: 95°C, 15s, 61-55°C, 1min, decreasing by 0.6°C each cycle, for a total of 10 cycles; the third step: 95°C, 20s, 55°C, 1min, for a total of 28 cycles, fluorescence scanning, 25-37°C, 30s.

Images