Method for qualitatively detecting lavender component in honey by using real-time fluorescent PCR (Polymerase Chain Reaction)

Abstract

The invention provides a method for qualitatively detecting a lavender component in honey by utilizing real-time fluorescent PCR (Polymerase Chain Reaction). The method comprises the following steps: extracting DNA (Deoxyribose Nucleic Acid) in a honey sample; designing and synthesizing a primer and a probe sequence of a lavender specific gene; and carrying out real-time fluorescence PCR reaction, and reading and analyzing a fluorescence signal so as to judge whether the honey sample contains the lavender component or not. According to the method, the lavender specific gene segment in the honey sample can be effectively detected by utilizing a real-time fluorescent PCR method, the specificity is good, the detection limit is 0.01%, and the method is suitable for qualitative detection of the lavender component in the honey.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological detection, and in particular relates to a method for qualitatively detecting lavender components in honey by using real-time fluorescent PCR. Background Art

[0002] Lavender (Lavandula angustifolia Mill.) is a plant of the genus Lavandula in the family Lamiaceae. It is native to the Mediterranean coast, Europe and the Oceania Islands. It has been cultivated in the Xinjiang Uygur Autonomous Region of my country as an ornamental and aromatic oil plant. The northern foothills of the Tianshan Mountains in the Xinjiang Uygur Autonomous Region are located in the same latitude as Provence in France, and the climate and soil conditions are similar. It is a lavender planting base and the hometown of lavender in China. The lavender in the Xinjiang Uygur Autonomous Region has been listed as one of the eight famous varieties in the world.

[0003] Due to the short flowering period of lavender and the limited source of flowers, the yield of lavender honey is low, making it a treasure among honeys. Natural and pure lavender honey is rich in various nutrients such as minerals, organic acids, proteins, vitamins, etc. It has excellent antibacterial, anti-inflammatory, antioxidant, and cell activity regeneration functions. It can lower blood lipids, blood sugar, and blood pressure, clear away heat and detoxify, and improve the natural healing ability of organisms. Lavender honey can regulate the gastrointestinal tract, liver, respiratory system, and nervous system, and has a good effect on improving human immunity and beauty and skin care. It is an ideal green and natural food for the elderly, children, women, and the weak.

[0004] Consumers' pursuit of lavender honey has stimulated illegal counterfeiting. It is difficult to distinguish the authenticity of lavender honey products on the market, which not only seriously interferes with the fair trade of honey products and damages the healthy development of the honey industry, but also poses a safety hazard to consumers. my country's current industry standard "SN / T 4848-2017 Detection method of common nectar plant components in exported honey - real-time fluorescence PCR method" does not have a detection method for lavender honey.

[0005] In order to ensure the quality and safety of Western Region specialty honey and maintain fair trade in imported honey in the economic zone, a real-time fluorescence PCR qualitative detection method for lavender components in honey was established. It can be used to qualitatively detect whether honey contains lavender components, providing an accurate and reliable technical basis for the authenticity identification of lavender honey. Summary of the invention

[0006] The purpose of the present invention is to provide a method with high specificity and capable of effectively utilizing real-time fluorescent PCR to qualitatively detect lavender components in honey in view of the above shortcomings and deficiencies to be solved.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A method for qualitatively detecting lavender components in honey using real-time fluorescence PCR, comprising the following steps:

[0009] (1) Extract DNA from honey samples;

[0010] (2) Design and synthesize primers and probe sequences for lavender-specific genes;

[0011] (3) Perform real-time fluorescence PCR reaction, read and analyze the fluorescence signal, and thus determine whether the honey sample contains lavender ingredients.

[0012] Preferably, the lavender-specific gene is a maturase K gene.

[0013] Preferably, the upstream primer of the lavender-specific gene has a nucleotide sequence as shown in SEQ ID NO.8, the downstream primer has a nucleotide sequence as shown in SEQ ID NO.9, and the probe has a nucleotide sequence as shown in SEQ ID NO.10.

[0014] Preferably, the PCR reaction system is 25 μL, including: 12.5 μL of 2× real-time fluorescence PCR premix, 1 μL of upstream and downstream primers and probes at a concentration of 12.5 pmol / μL, 5 μL of DNA template, and ddH2O to make up the volume.

[0015] Preferably, the real-time fluorescence PCR reaction conditions are: 50°C for 2 min; pre-denaturation at 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, and 45 cycles.

[0016] Preferably, the detection limit of the method for lavender components in honey is 0.01%.

[0017] Preferably, in the method, the judgment rule is: when the Ct value is <37.0, it is judged that lavender components are detected; when the Ct value is ≥37.0, it is judged that lavender components are not detected.

[0018] The present invention can effectively detect lavender-specific gene fragments in honey samples by using real-time fluorescence PCR method, with good specificity and no cross-reaction with other plant components; the detection limit of lavender components is 0.01%, which meets the technical requirements; and is suitable for qualitative detection of lavender components in honey. The method can provide technical support for the authenticity identification of lavender components in honey. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a diagram of the results of the lavender specific primer probe screening experiment. A, B, C, and D are the PCR experimental results of ITS, matK, DXR, and Ycf1 primer probes, respectively.

[0020] Figure 2 The figure is the result of the specificity verification experiment. A, B, and C are the PCR experimental results of ITS, matK, and Ycf1 primer probes, respectively.

[0021] Figure 3 This is a graph showing the optimization experiment results for primer and probe concentrations.

[0022] Figure 4 This is the result of the detection limit verification experiment.

[0023] Figure 5 This is a graph showing the results of a stability verification experiment using 0.1% lavender DNA.

[0024] Figure 6 This is a graph showing the results of a stability verification experiment using 0.05% lavender DNA.

[0025] Figure 7 This is a graph showing the results of a stability verification experiment using 0.01% lavender DNA. DETAILED DESCRIPTION

[0026] The present invention is further described in detail below in conjunction with specific embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0027] 1. Materials

[0028] 1.1 Experimental Materials

[0029] Lavender, litchi kernel, atractylodes, dried longan, atractylodes, julibrissin, honeysuckle, coltsfoot, schizonepeta, gardenia, dandelion, burdock fruit, motherwort, sophora japonica, zedoaria, wild chrysanthemum, lotus seed, chrysanthemum, carrot, artemisia annua, safflower, osmanthus, corn, rose, basil, patchouli, mint, agarwood, salvia miltiorrhiza, perilla, scutellaria baicalensis and lavender honey were purchased from local supermarkets and e-commerce platforms.

[0030] 1.2 Main Reagents

[0031] Reagents: QuickGene DNA tissue kit S (KURABO, Japan), TaqMan TM Fast Advanced Master Mix (Thermo Fisher Scientific, USA), primers and probes (Shanghai Shanjing Molecular Biotechnology Co., Ltd.).

[0032] 1.3 Main instruments and equipment

[0033] ABI 7900HT real-time fluorescence PCR instrument (Thermo Fisher Scientific, USA), Nanospec micro-nucleic acid protein analyzer (Shimadzu, Japan), Centrifuge 5424 small high-speed centrifuge (Eppendorf, Germany), Tube-Mill Control test tube mill (IKA, Germany), MS2 vortex mixer (IKA, Germany), AB204-SMETLER TOLEDO electronic balance (TOLEDO, Switzerland).

[0034] 2. Determination of DNA Extraction Concentration and Purity

[0035] Homogenize the experimental samples with a test tube grinder, and extract the DNA of the experimental samples with the genomic DNA extraction kit QuickGeneDNAtissue kit S. For details on the extraction method, refer to the kit operating instructions. Use a Nanospec micro-nucleic acid protein analyzer to determine the concentration of genomic DNA, dilute to 20 ng / μL, and place at 4°C for later use.

[0036] 3. Real-time fluorescence PCR primer and probe design

[0037] Four lavender-specific gene sequences were selected from NCBI GeneBank, as follows:

[0038] Accession No. EF437225.1 Lavender internal transcribed spacer gene (SEQ ID NO.1)

[0039] GAACATATCAATCTCGTGTCTTGCCGCGTCGTTGAGCCGTCGGACGTGATCTCGTTAACGACCCAACGGTGTGAG

[0040] Accession No. KF997513.1 Lavender maturase K gene (SEQ ID NO. 2)

[0041] ATAGAAGCCGGATTTGGTATTTGGATATGATTTCTATCAATGATCTGGCCAATCTCAGATCAAAATTATGAGATCTTGGAAATAGAATTTTTCTTAAATAAAATGGATGAAGAGCTAAAAAGATCA

[0042] Accession No. JX630151.1 Lavender 1-deoxy-D-xylulose-5-phosphate reductoisomerase gene (SEQ ID NO. 3)

[0043] ACCTTTGCAAGGTCTCTCTAACGTTCAAGGCCCCCGACCGGGTCAAGTACCCGTCAATGGACCTAGCTTATGCTGCCG

[0044] Accession No. JF289028.1 Lavender Ycf1 gene (SEQ ID NO. 4)

[0045] TTTTTGTTCTTTGACAAACCTCTTGTAACTCTTCTTTTCGATTCGAAACGATGGAATC GGCCACTTCGTTACATAAAAAATAATCAATTTGACAAGGTTGTTAGAAACGAAATGTCA

[0046] Four sets of PCR primers and probes were designed according to the above lavender-specific gene sequences, as shown in Table 1.

[0047] Table 1. Primer and probe sequences

[0048]

[0049] 4. Real-time fluorescence PCR reaction

[0050] Using 100% lavender DNA as a positive control, two PCRs were set up in parallel to screen the primers and probes.

[0051] Real-time fluorescence PCR reaction system (25 μL): 2× real-time fluorescence PCR premix 12.5 μL, upstream and downstream primers (10 pmol / μL) and probe (10 pmol / μL) 1 μL each, DNA template 5 μL (50 ng-500 ng), ddH2O to make up the volume. PCR reaction conditions are: 50℃2min; pre-denaturation 95℃10min; 95℃15s, 60℃1min, 45 cycles.

[0052] 5. Primer-probe specificity experiment

[0053] To evaluate the specificity of this method, genomic DNA was extracted from 30 samples of common nectar plants and medicinal plants of the Lamiaceae and Compositae families, and real-time fluorescence PCR was performed using primers and probes optimized through preliminary experiments, with two PCR runs set up in parallel.

[0054] 6. Optimization of Primer Probe Concentration

[0055] In order to optimize the PCR reaction system, the final concentrations of primers and probes in the reaction system were set to F / R / P (upstream primer / downstream primer / probe) (nmol / L): 100 / 100 / 100, 100 / 100 / 50, 200 / 200 / 200, 200 / 200 / 100, 300 / 300 / 300, 300 / 300 / 150, 400 / 400 / 400, 400 / 400 / 200, 500 / 500 / 500, 500 / 500 / 250, 600 / 600 / 600, 600 / 600 / 300, a total of 12 combinations, and PCR detection of lavender DNA was performed, with 2 PCR runs in parallel.

[0056] 7. Evaluation of the lower limit of real-time fluorescence PCR detection

[0057] 100% lavender genomic DNA was gradiently diluted with corn DNA (laboratory extraction), and the concentrations of lavender genomic DNA were 100%, 10%, 5%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, and 0.005%, respectively. Amplification was carried out using the optimized real-time fluorescence PCR amplification conditions, and two parallel real-time fluorescence PCR reactions were performed for each concentration of DNA to evaluate the detection limit of the lavender real-time fluorescence PCR method.

[0058] 8. Stability Assessment

[0059] In order to evaluate the stability of this method, 10 parallel PCR tests were performed on lavender DNA with DNA concentrations of 0.1%, 0.05% and 0.01%.

[0060] 9. Actual sample verification experiment

[0061] A total of 15 commercial samples of lavender honey were collected by this method, and their origins included many places in Xinjiang Uygur Autonomous Region, Jiangsu, Beijing, and Czech Republic. Nine samples of other varieties of honey were also collected from Jiangsu, Russia, Kyrgyzstan, and Australia. Genomic DNA was extracted from commercial honey samples, and real-time fluorescence PCR reactions were performed using optimized lavender-specific primer probes and higher plant chloroplast tRNALeu primer probes to evaluate the practical application ability of this method. The tRNALeu primer probe information is shown in Table 2, and the real-time fluorescence PCR system is shown in Table 3.

[0062] Table 2. Primer probe sequence information

[0063]

[0064] Table 3. Fluorescence PCR reaction system

[0065]

[0066] 10. Results of real-time fluorescence PCR detection of lavender components in plant powder

[0067] 10.1 Primer and probe selection and specificity experimental results

[0068] The real-time fluorescence PCR results of the four sets of primers and probes in Table 1 are as follows Figure 1 As shown, amplification occurred in all four sets of primer probes, and the average Ct values ​​were 15, 19, 29 and 18, respectively. Therefore, ITS, matK and Ycf1 primer probes were preferred for the next specificity verification.

[0069] The specificity validation results are shown in Table 4 and Figure 2 As shown in the chart, the three primer probes ITS, matK and Ycf1 can amplify lavender genes, with average Ct values ​​of 15, 19 and 18. ITS and Ycf1 have obvious amplification on Albizzia julibrissin, Coltsfoot, Gardenia jasminoides, Sophora japonica, Carthamus tinctorius and Osmanthus fragrans, while matK has weak amplification on Albizzia julibrissin, Coltsfoot, Gardenia jasminoides, Sophora japonica and Carthamus tinctorius, with Ct values ​​≥ 37.0, and has no cross-reaction to other 25 nectar plants and medicinal plants of Lamiaceae and Compositae, with the strongest specificity among the three primer probes. Therefore, the primer probe of matK gene was selected for subsequent research, and the judgment basis of this method was set as follows: when Ct value <37.0, it was judged that lavender components were detected; when Ct value ≥37.0, it was judged that lavender components were not detected, so as to exclude the interference of non-specific amplification of other flowering plants.

[0070] Table 4. Specificity verification experiment results

[0071]

[0072]

[0073] 10.2 Optimization results of primer and probe concentrations

[0074] The optimization results of primer and probe concentrations are shown in Figure 3 .

[0075] Depend on Figure 3 It can be seen that when the final concentrations of primers and probes in the PCR reaction system are both 500nmol / L, the average Ct value is 19, the Ct value is the smallest and the fluorescence signal value is the highest. Therefore, it is determined that the final concentrations of primers and probes in the PCR reaction system of this method are both 500nmol / L.

[0076] 10.3 Detection limit verification test results

[0077] The results of the detection limit verification are shown in Figure 4In the figure, curves 1 to 8 are amplification curves of lavender genomic DNA concentration percentages of 100%, 10%, 5%, 1%, 0.5%, 0.1%, 0.05% and 0.01%, respectively.

[0078] With Ct value <37.0 as the judgment condition of "detection", this method can detect lavender DNA with DNA concentration percentages of 100%, 10%, 5%, 1%, 0.5%, 0.1%, 0.05% and 0.01%, but cannot detect lavender DNA with 0.005%. Therefore, the detection limit of this method for lavender DNA is specified to be 0.01% (DNA concentration percentage).

[0079] 10.4 Stability Verification Experiment Results

[0080] The experimental results are shown in Figure 5 , Figure 6 and Figure 7 .

[0081] The results showed that this method could stably detect lavender DNA at DNA concentrations of 0.1%, 0.05% and 0.01%.

[0082] 10.5 Actual Sample Verification Results

[0083] The actual sample test results are shown in Tables 5 and 6.

[0084] The experimental results showed that tRNALeu could be detected in 15 lavender honeys and 9 other commercial honey samples, indicating that this method can effectively extract plant genomic DNA in honey. Lavender components were detected in all 15 lavender honey samples, with Ct values ​​between 26 and 35, indicating that the judgment criteria set by this method are suitable for the detection of lavender components in honey samples; lavender components were not detected in 9 other honeys. This shows that this method can effectively identify lavender components in honey and provide a technical basis for the authenticity identification of lavender honey.

[0085] Table 5. Results of the lavender honey actual sample verification experiment

[0086]

[0087]

[0088] Table 6. Results of actual sample verification experiments (commercial samples of other types of honey)

[0089]

Claims

1. A method for qualitatively detecting lavender components in honey using real-time fluorescence PCR, characterized in that The following steps are involved: (1) Extract DNA from honey samples; (2) Design and synthesize primers and probe sequences for lavender-specific genes; (3) Perform real-time fluorescence PCR reaction, read and analyze the fluorescence signal, and thus determine whether the honey sample contains lavender ingredients.

2. The method according to claim 1, characterized in that The lavender specific gene is a maturase K gene.

3. The method according to claim 1, characterized in that The upstream primer of the lavender-specific gene has a nucleotide sequence as shown in SEQ ID NO.8, the downstream primer has a nucleotide sequence as shown in SEQ ID NO.9, and the probe has a nucleotide sequence as shown in SEQ ID NO.

10.

4. The method according to claim 1, characterized in that The PCR reaction system was 25 μL, including: 12.5 μL of 2× real-time fluorescence PCR premix, 1 μL of upstream and downstream primers and probes at a concentration of 12.5 pmol / μL, 5 μL of DNA template, and ddH2O to make up the volume.

5. The method according to claim 1, characterized in that: The real-time fluorescence PCR reaction conditions are: 50°C for 2 min; pre-denaturation at 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, and 45 cycles.

6. The method according to claim 1, characterized in that The detection limit of the method for lavender components in honey is 0.01%.

7. The method according to claim 1, characterized in that In the method, the judgment rule is: when the Ct value is <37.0, it is judged that the lavender component is detected; when the Ct value is ≥37.0, it is judged that the lavender component is not detected.

Images