Method for detecting canine parvovirus based on SHELOCK method

Abstract

The invention relates to a method for detecting canine parvovirus based on an SHELOCK method, and the method uses any RPA primer group comprising RPAF1, RPAR1, RPAF2-1, RPAR2-1, RPAF2-2 and RPAR2-2, crRNA of crRNAs IVT-1templates and crRNAs IVT-2 templates, or uses a reagent prepared based on any RPA primer group or crRNA, so that the method for detecting canine parvovirus based on the SHELOCK method disclosed by the invention has the advantages of good specificity and high sensitivity, and can be used for detecting canine parvovirus. Visual detection of the canine parvovirus can be achieved, conventional PCR detection and SHELOCK detection are conducted on a clinical sample from a treated sample, and the accuracy of detection results of the two methods is consistent.

Description

Technical Field

[0001] The invention belongs to the technical field of virus detection, and relates to an RPA primer, crRNA, a reagent and applications thereof for detecting canine parvovirus, and in particular to a method for detecting canine parvovirus based on the SHELOCK method. Background Art

[0002] Canine Parvovirus (CPV) belongs to the Parvoviridae family, Parvovirus genus. SHELOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing) is a CRISPR detection technology. Currently, there is no report on the visual detection of canine parvovirus based on SHELOCK technology. Summary of the invention

[0003] In order to overcome the defects in the prior art, the present invention provides an RPA primer, crRNA, reagent, a method for detecting canine parvovirus based on the SHELOCK method and its application. After conventional PCR and SHELOCK detection are performed on clinical samples from processed samples, the detection results of the two methods are consistent in accuracy. While having good accuracy, they also have the advantages of good specificity and high sensitivity, and can realize visual detection of canine parvovirus. It is suitable for rapid testing of clinical samples and can work well in the field or grassroots laboratories. This method can get rid of the limitations of detection instruments and complex operations, and is suitable for rapid batch detection on site.

[0004] To achieve the above object, the present invention adopts the following technical solution:

[0005] The first aspect of the present invention is to provide an RPA primer for detecting canine parvovirus, comprising any one of the following groups:

[0006] Group 1:

[0007] Sequence 1RPAF1:

[0008] GAAATTAATACGACTCACTATAGGGCCRTATGTRYATCCTAATAAT

[0009] ACRCTT GCT;

[0010] Sequence 2RPAR1: TGTAGGTAAGATATGCCATCCAGTATTTAT;

[0011] Group 2:

[0012] Sequence 3RPAF2-1:

[0013] GAAATTAATACGACTCACTATAGGGTGCCCRTATGTRYATCCTAAT

[0014] AATAC RCTTG;

[0015] Sequence 4RPA R2-1: ATTGTAGGTAAGATATGCCATCCAGTATTT;

[0016] Group 3:

[0017] Sequence 5RPAF2-2:

[0018] GAAATTAATACGACTCACTATAGGGGCTTACTGGAATAATATGCC

[0019] GTATG TGTATC;

[0020] Sequence 6RPAR2-2: GTAGGTAAGATATGCCATCCCAGTATTTATTG.

[0021] As a further improvement, the RPA primers are the third group:

[0022] Sequence 5RPAF2-2:

[0023] GAAATTAATACGACTCACTATAGGGGCTTACTGGAATAATATGCC

[0024] GTATG TGTATC;

[0025] Sequence 6RPAR2-2: GTAGGTAAGATATGCCATCCCAGTATTTATTG.

[0026] The second aspect of the present invention is to provide a crRNA for detecting canine parvovirus, comprising any one of the following groups:

[0027] Group 1:

[0028] Sequences of 7crRNAs for IVT-1 tempaltes:

[0029] TATTGTTGCTGCTGAAACTGGTGGAAATGTTTTA

[0030] GTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCG TATTAATTTC;

[0031] Group 2:

[0032] Sequences of 8crRNAs for IVT-2 tempaltes:

[0033] TACTATTGTTGCTGCTGAAACTGGTGGAGTTTTA

[0034] GTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCG TATTAATTTC.

[0035] As a further improvement, the crRNA is the second group:

[0036] Sequences of 8crRNAs for IVT-2 tempaltes:

[0037] TACTATTGTTGCTGCTGAAACTGGTGGAGTTTTA

[0038] GTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCG TATTAATTTC.

[0039] The third aspect of the present invention is to provide a reagent for detecting canine parvovirus, wherein the reagent includes the RPA primer of the first aspect, the crRNA of the second aspect, and the Cas13a protein, the concentration of the crRNA is 0.5 to 12 ng / ul, and the concentration of the Cas13a protein is 1 to 12 ng / ul.

[0040] As a further improvement, the concentration of the crRNA is 2 to 10 ng / ul, and the concentration of the Cas13a protein is 2 to 10 ng / ul.

[0041] As a further improvement, the reagent includes: RPA reaction solution: 1-3ul, T7RNA pol ymerase mix: 0.3-0.8ul, RNase inhibitormurine: 0.5-2ul, NTPbuffermix: 0.5-1ul, 10×PCRstdbuffer: 1-3ul, Cas13a (50μm): 1-2ul, crRNA: 1-2ul, probe-polyU (10μm) 1-2ul, DEPC water: 9-11ul, and the preferred reaction reagent is the primer (10uM) as described in claim 1 or 2: 1-3ul and BufferA40-45ul and BufferB plus 2-3ul. The reaction mixture consists of.

[0042] The fourth aspect of the present invention is to provide a kit for detecting canine parvovirus, comprising the RPA primer of the first aspect, the crRNA of the second aspect, and the reagent of the third aspect.

[0043] The fifth aspect of the present invention is to provide a method for detecting canine parvovirus based on the SHELOCK method, wherein the method uses the RPA primer of the first aspect, the crRNA of the second aspect, or the reagents of the third aspect and the fourth aspect.

[0044] The sixth aspect of the present invention is to provide a primer set of the first aspect and / or the crRNA of the second aspect and / or the reagent of the third aspect and the fourth aspect, and use them in detecting canine parvovirus by the SHELOCK method.

[0045] The above technical scheme of the present invention has the following beneficial effects: the canine parvovirus SHELOCK detection method established in this study has good specificity and high sensitivity, and can realize the visual detection of canine parvovirus. Conventional PCR and SHELOCK detection are performed on clinical samples from processed samples, and the detection results of the two methods have consistent accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 To screen the matching results of three pairs of primers and crRNA through fluorescence kinetic detection;

[0047] Figure 2 To screen the results of three pairs of primers and crRNA through lateral flow strips;

[0048] Figure 3 Optimization and verification results of the fluorescence kinetic detection method based on RPA-CRISPR technology; (A: Exploration of the optimal final concentration of crRNA; B: Exploration of the optimal final concentration of Cas13a protein)

[0049] Figure 4 Validation results for the CPV method using lateral flow test strips;

[0050] Figure 5 The results of the sensitivity test of the RPA-CRISPR-based lateral flow strip;

[0051] Figure 6 Results of a specificity test of RT-RPA-CRISPR based on lateral flow strips. DETAILED DESCRIPTION

[0052] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention all fall within the scope of the present invention.

[0053] The embodiments of the present invention are described in detail below with reference to the accompanying drawings and examples.

[0054] First of all, it needs to be explained that HUDSON in the related field refers to the use of heating and chemical reduction methods to treat clinical samples to eliminate nucleases and lyse viral particles. The treated samples can be directly used as templates for RPA reactions.

[0055] RPA: Recombinase polymerase amplification is a new nucleic acid isothermal amplification technology developed by Piepenburg et al. in 2006 using protein recombination and repair involved in cell DNA synthesis. Unlike PCR, which requires an instrument for cyclic amplification, RPA operates at 37-42°C and requires only a small amount of sample preparation. It can amplify as low as 1-10 DNA copies within 10 minutes. It has the advantages of high sensitivity, selectivity, portability, rapidity, and the ability to perform multiple amplification.

[0056] PCR: Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA fragments.

[0057] LF-polyU: FAM RNA biotin reporter.

[0058] 1. Establishment of the Shelock detection method for canine parvovirus:

[0059] Materials and Methods

[0060] (I) Material preparation

[0061] Canine parvovirus (CPV), CAV-2Manhattan strain, canine parainfluenza virus (CPIV), canine distemper virus (CDV), canine herpes virus (CHV), and canine coronavirus (CCOV) were stored in the laboratory. Virus DNA extraction kits were purchased from OMEGA BioTek, USA; Cas13a (Lwa) was purchased from Guangzhou Bolais Biotechnology Co., Ltd.; HiScribe T7 Quick High Yield RNA Synthesis Kit, RNA Cleanup Kit (500 μg) and RNaseinhibitor Murine were purchased from New England Biolabs; Milenia HybriDetect 1 was purchased from TwistDx; TaKaRa Ex Taq was purchased from TaKaRa; RT-fluorescence nucleic acid amplification kit was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; DEPC sterile water was purchased from Beijing Solebow Technology Co., Ltd. CFX96 Touch real-time fluorescence quantitative PCR instrument was purchased from Bio-Rad, USA.

[0062] (II) Preparation of Standards

[0063] Using CPV strain DNA as a template, PCR amplification was performed using primers RPAZL F1 (5'-CAGAGTCAGAAATGGTGGTGTT-3') / R1 (5'-CGTCAACAGTTGTTGCGTTATG-3'). The reaction system was 2xTag PCR StarMix 10ul, Upstream primer (10um) 1ul, Downstream primer (10um) 1ul, Template 1ul, ddH207ul; PCR reaction was performed at an annealing temperature of 52℃. The pMD-19T vector clone was connected and the plasmid was named pMD-19T-RPAZL after correct identification and stored at -80℃ for future use. The concentration of pMD-19T-RPAZL was determined and a 10-fold gradient dilution was performed, which was used as a standard for sensitivity experiments in the CRISPR–Cas13a visualization detection method.

[0064] (III) One-step recombinase polymerase nucleic acid preamplification (RPA)

[0065] According to the instructions of the RT-RAA domestic kit, add 40.9 ul of Buffer A, 2 ul of upstream and downstream primers RPAF1 / R1 (10uM), 2 ul of viral genome template, and 2.5 ul of Buffer B to each tube of reaction dry powder to form a 50 ul reaction mixture. After adding, cover the tube, turn it upside down and mix it thoroughly 5-6 times, centrifuge it at low speed for 10 seconds, and react at 42℃ for 30 minutes to perform viral nucleic acid pre-amplification.

[0066] (IV) Optimization of CRISPR-Cas13a detection reaction system

[0067] Using the RPA pre-amplification product obtained in (three) as a template, 2ul is taken and added to a total of 20ul reaction systems. The crRNA obtained by T7 transcription and the lwCas13a protein purchased by the reagent company are respectively diluted twice in RNase-free water to obtain a final concentration of 0.625ng / ul, 1.25ng / ul, 2.5ng / ul, 5ng / ul, 10ng / ul crRNA and a final concentration of 2ng / ul, 4ng / ul, 8ng / ul, 10ng / ul, Cas13a protein. Using the chessboard method, under the conditions of 2ul LF-polyU, the crRNA and Cas13a proteins of different final concentrations are sequentially subjected to fluorescence kinetic detection, and its optimum working concentration is explored. The amount of LF-polyU and the reaction time are explored using the optimized reaction system to obtain the best working conditions.

[0068] (V) Color reaction

[0069] In order to perform the lateral flow chromatography test strip detection reaction of CRISPR-lwCas13a, FAM was labeled at the 5' end of poly U and biotin was labeled at the 3' end of poly U. The poly U was added to the reaction system as a reporter gene, and the other components remained unchanged. After half an hour of constant temperature reaction at 37°C, 20μL of the reaction product was transferred to a nuclease-free 2 ml EP tube and mixed thoroughly with 80μL HybriDetect 1 analysis buffer. The diluted reaction solution was added dropwise to the sample pad of the Milenia HybriDetect 1 test strip, and the color development was observed after 5 minutes.

[0070] NTC indicates (no template negative control);

[0071] RFU (Relative Fluorescence Unit) indicates relative fluorescence unit;

[0072] T7 RNA polymerase (T7 RNA Polymerase) is an RNA polymerase with a molecular weight of approximately 99 kDa.

[0073] Example 1, about the design and synthesis of primers

[0074] DNASTAR was used to align the CPV reference sequence, and a conserved region was selected and RPA primers were designed ( Table 1 ), which were synthesized by Jilin Kumei Biotechnology Co., Ltd.

[0075] Table 1 RPA primers and CRISPR RNA sequences of CPV

[0076]

[0077]

[0078] Example 2 Synthesis of CRISPR RNA

[0079] The DNA template of crRNA was annealed into double-stranded DNA using the TaKaRa Ex Taq kit. The annealing system: crRNAsIVT tempaltes (100uM) 1ul, T7-3G IVT (100uM) 1ul, 10×PCR stdbuffer 1ul, dNTP (2.5mM) 0.8ul, Ex Taq 0.05ul, and DEPC H2O was added to the total system of 10ul. Annealing reaction was performed. The annealing program was: 95℃5min; 94℃ to 4℃ (0.5℃ / s); 72℃1min. According to the instructions of the HiScribe T7Quick HighYield RNA Synthesis Kit, 10ul NTP buffer mix, 2ul T7 RNA polymerasemix and 18ul DEPC H2O were added to the annealing product obtained in the previous step. The double-stranded DNA was transcribed into crRNA by incubation at 37℃ overnight. According to the manufacturer's instructions, use The crRNA was purified using RNA Cleanup Kit and the concentration was adjusted to 10 ng / ul using DEPC H2O (20 ul per tube, stored at -80°C) (SHMAKOV et al., 2017; YANG et al., 2017).

[0080] Experimental Example 1 Screening test of RPA primers and CRISPR RNA

[0081] The visual effect of the color reaction of the lateral flow test strip was detected by fluorescence kinetics by combining each pair of RPA primers with their respective crRNA. Figure 1 and Figure 2 As shown in Figure , the best pre-amplification primers and corresponding crRNA were screened. Figure 1 as well as Figure 2 As shown, primer F2-2 / R2-2 (amplified fragment length is 109bp, Tm=64.7°C) is used in combination with crRNA-2 to collect the highest fluorescence intensity and the best color development effect, which is used as the commonly used primers and sequences for subsequent experiments. The sequences of the CPV primers, crRNA and reporter RNA with the best color development effect are shown in Table 2.

[0082] Table 2 Sequences of primers, crRNA and reporter RNA of CPV

[0083]

[0084] Experimental Example 2 Optimization test of reaction system, i.e. reagents

[0085] The RPA experiment was performed using genomic DNA extracted from the CPV strain as a template. 2 μL of the amplified product was used as the input for CRISPR-Cas13a fluorescence kinetic detection to perform system optimization experiments. The results are shown in Figure 3 As shown (A: exploration of the optimal final concentration of crRNA; B: exploration of the optimal final concentration of Cas13a protein), the optimal working concentrations of crRNA (10ng / ul) and Cas13a protein (10ng / ul) were finally determined. The optimized fluorescence kinetic detection reaction system: RPA product 2ul, T7RNA polymerase mix 0.5ul, Rnase inhibitor murine 1ul, NTP buffermix 0.8ul, 10×PCR stdbuffer 2ul, Cas13a (50μm) 1ul, crRNA 1ul, probe-polyU (10μm) 2ul, DEPC water 10.7ul. It can be seen that the reagents include RPA reaction solution: 1~3ul, T7 RNApol ymerase mix: 0.3~0.8ul, Rnase inhibitormurine: 0.5~2ul, NTP buffermix: 0.5~1ul, 10×PCR stdbuffer: 1~3ul, Cas13a (50μm): 1~2ul, crRNA: 1~2ul, probe-polyU (10μm) 1~2ul, DEPC water: 9~11ul. The RPA product in this test example is the RPA reaction solution of the present application. Preferably, the reaction reagent is a reaction mixture consisting of the primer (10uM) as described in claim 1 or 2: 1~3ul, BufferA40~45ul, and BufferB plus 2~3ul.

[0086] Experimental Example 3 Lateral flow test strip detection test combined with CRISPRCas13a

[0087] For lateral flow detection, biotin-labeled LF polyU (5'FAM / UUUUUUUUUUUUUUUU / Bio 3') was added to the CRISPR-Cas13a reaction system as a reporter gene to replace probe-polyU. Four CPV strains were selected as reference strains for verification. The verification results are shown in Figure 2. Figure 4 shown.

[0088] Test Example 4: Sensitivity test of lateral flow test strips

[0089] In the sensitivity test, the lowest copy number with no visible bands along the T line was considered the detection limit. Figure 5 The results showed that the sensitivity was as low as 10 2 copies / μL.

[0090] Test Example 5 Specificity test of lateral flow test strip detection

[0091] In the specific test, six viral genomes including CPV, CAV-2, CPIV, CDV, CHV, and CCOV were used as templates for RPA-CRISPR lateral flow test strip detection. The test results are as follows Figure 6 As shown, only the test strip for CPV has an obvious positive band. The test strips for other viruses are judged to be negative.

[0092] Test Example 6: Clinical sample testing test

[0093] SHERLOCK combined with HUDSON and common PCR methods were used to test 20 suspected cases collected from Heilongjiang Provincial Pet Hospital to detect the positive rate of canine parvovirus:

[0094] 2 μL of each of the 20 suspected clinical samples collected from the Heilongjiang Provincial Pet Hospital was taken from the processed samples for conventional PCR and SHELOCK tests;

[0095] The first group was treated with SHERLOCK combined with HUDSON. According to the HUDSON method, TCEP and EDTA were added to 20 tissue homogenates at final concentrations of 100mM and 1mM, respectively. The cells were incubated at 42°C for 20 minutes in a water bath, and then incubated at 64°C for 5 minutes to inactivate them. 2μL of the treated product was directly added as a template to the CRISPR-Cas13a lateral flow test strip established in the reaction system, and the results were collected.

[0096] The second group served as a control, and the same 20 clinical samples were tested using conventional PCR methods, and the test results were compared.

[0097] Among them, conventional PCR detected 8 positives and 12 negatives (positive rate 40%). SHELOCK detected 8 positives and 12 negatives (positive rate 40%). The positive coincidence rate was 100%, which shows that the accuracy of the test results of conventional PCR and SHELOCK tests is consistent.

[0098] Based on the above test results, the canine parvovirus SHELOCK detection method established in this study has good specificity and high sensitivity. The detection results of conventional PCR and SHELOCK tests are consistent in accuracy, which can achieve visual detection of canine parvovirus. The entire RPA-CRISPR reaction can be completed within two hours, which is suitable for rapid testing of clinical samples and can work well in the field or grassroots laboratories. This method can get rid of the limitations of detection instruments and complex operations, and is suitable for rapid batch detection on site.

[0099] The above-described embodiments are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An RPA primer for detecting canine parvovirus, characterized in that: Includes any of the following groups: Group 1: Sequence 1RPAF1: GAAATTAATACGACTCACTATAGGGCCRTATGTRYATCCTAATAAT ACRCTT GCT; Sequence 2RPAR1: TGTAGGTAAGATATGCCATCCAGTATTTAT; Group 2: Sequence 3RPAF2-1: GAAATTAATACGACTCACTATAGGGTGCCCRTATGTRYATCCTAAT AATAC RCTTG; Sequence 4RPAR2-1:ATTGTAGGTAAGATATGCCATCCCAGTATTT; Group 3: Sequence 5RPAF2-2: GAAATTAATACGACTCACTATAGGGGCTTACTGGAATAATATGCC GTATG TGTATC; Sequence 6RPAR2-2: GTAGGTAAGATATGCCATCCAGTATTTATTG.

2. The RPA primer for detecting canine parvovirus according to claim 1, characterized in that: Including the third group: Sequence 5RPAF2-2: GAAATTAATACGACTCACTATAGGGGCTTACTGGAATAATATGCC GTATG TGTATC; Sequence 6RPAR2-2: GTAGGTAAGATATGCCATCCAGTATTTATTG.

3. A crRNA for detecting canine parvovirus, characterized in that: Includes any of the following groups: Group 1: Sequences of 7crRNAs for IVT-1 tempaltes: TATTGTTGCTGCTGAAACTGGTGGAAATGTTTTA GTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCG TATTAATTTC; Group 2: Sequences of 8crRNAs for IVT-2 tempaltes: TACTATTGTTGCTGCTGAAACTGGTGGAGTTTTA GTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCG TATTAATTTC.

4. The RPA primer for detecting canine parvovirus according to claim 3, characterized in that: The second group includes: Sequences of 8crRNAs for IVT-2 tempaltes: TACTATTGTTGCTGCTGAAACTGGTGGAGTTTTA GTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCG TATTAATTTC.

5. A reagent for detecting canine parvovirus, comprising the RPA primer according to claim 1 or 2, and the crRNA according to claim 3 or 4, characterized in that: It also includes Cas13a protein, the concentration of the crRNA is 0.5-12 ng / ul, and the concentration of the Cas13a protein is 1-12 ng / ul.

6. The reagent for detecting canine parvovirus according to claim 5, characterized in that: The concentration of the crRNA is 2-10 ng / ul, and the concentration of the Cas13a protein is 2-10 ng / ul.

7. The reagent for detecting canine parvovirus according to claim 5, comprising: RPA reaction solution: 1-3ul, T7 RNApol ymerase mix: 0.3-0.8ul, RNase inhibitor murine: 0.5-2ul, NTPbuffermix: 0.5-1ul, 10×PCR stdbuffer: 1-3ul, Cas13a (50μm): 1-2ul, crRNA: 1-2ul, probe-polyU (10μm) 1-2ul, DEPC water: 9-11ul. The preferred reaction reagent is a reaction mixture consisting of the primer (10uM) as described in claim 1 or 2: 1-3ul, BufferA40-45ul, and BufferB plus 2-3ul.

8. A kit for detecting canine parvovirus, characterized in that: It comprises the RPA primer according to claim 1 or 2, the crRNA according to claim 3 or 4, and the reagent according to any one of claims 5 to 7.

9. A method for detecting canine parvovirus based on the SHELOCK method, characterized in that: The method uses the RPA primer described in claim 1 or 2, the crRNA described in claim 3 or 4, or the reagent described in any one of claims 5 to 8.

10. Use of the primer according to claim 1 or 2, the crRNA according to claim 3 or 4, and the reagent according to any one of claims 5 to 8 in detecting canine parvovirus by the SHELOCK method.

Images