RPA (recombinase polymerase amplification) specific primer and detection method for identifying potato virus Y

Abstract

The invention provides an RPA (recombinase polymerase amplification) specific primer and a detection method for identifying potato Y virus, and belongs to the technical field of plant virus detection. The RPA specific primer for identifying the potato Y virus, disclosed by the invention, is as shown in SEQ ID No. 1 and SEQ ID No. 2. The potato sampler is used for sampling, the sampling amount is small, a detected sample is not damaged, and plants can continue to grow; according to the invention, the problem that temperature control on melting, annealing, extension and other processes must be carried out depending on a thermal cycler (such as a PCR instrument) in the PCR process is solved, and the amplification reaction only needs to be carried out at a constant temperature (37-42 DEG C); according to the method, the experimental operation steps are simple, and the amplification time is short and only needs 20 minutes; according to the method for rapidly and accurately identifying the potato virus Y, a new thought and a new method are provided for rapid and on-site identification of potato virus detection.

Description

Technical Field

[0001] The invention relates to the technical field of plant virus detection, and in particular to RPA specific primers and a detection method for potato virus Y identification. Background Art

[0002] Potato is the most planted and consumed crop in the world, and is the fourth largest food crop in the global economy after rice, wheat and corn. In recent years, my country's potato industry has developed rapidly, and potatoes account for an important proportion of national economic growth. Potato virus Y (PVY) is a representative species of the Potyviridae family and Potyvirus genus, and is distributed in all potato-growing areas. Potato virus Y is the most harmful to potatoes, which can cause potato degeneration and reduce potato yields. Severe yield reductions can reach more than 80%, or even total failure.

[0003] Recombinase polymerase amplification (RPA) technology is a new method developed in the past 10 years that can rapidly amplify nucleic acids at a constant temperature. Under constant temperature, the technology uses recombinase to bind tightly to primer DNA to form a complex of enzyme and primer. When the primer searches for a completely complementary sequence on the template DNA, the template DNA is unzipped with the help of single-stranded DNA binding protein (SSB), and a new DNA complementary chain is formed under the action of DNA polymerase. The reaction product grows exponentially, and amplification is usually completed within 15 minutes. The entire reaction process does not require special auxiliary instruments (such as nucleic acid amplification instruments), and the requirements for operators are not high. It has the characteristics of simplicity, energy saving, and rapidity. Because it does not require high-temperature cycles, it is particularly suitable for rapid detection of large quantities of potato samples. At present, RPA technology has been widely used in the detection of various viruses, bacteria, genetically modified species, etc., but there are no detection primers and detection methods for recombinase polymerase amplification of potato virus Y. Summary of the invention

[0004] The object of the present invention is to provide RPA specific primers and a detection method for potato virus Y identification, so as to fill the gap in the recombinase polymerase amplification detection of potato virus Y.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides RPA specific primers for potato virus Y identification, comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.2.

[0007] The invention also provides application of the RPA specific primer in detecting potato virus Y.

[0008] The present invention also provides the use of the RPA specific primer in preparing a kit for detecting potato virus Y.

[0009] The present invention also provides a kit for detecting and identifying potato virus Y, comprising the primers according to claim 1.

[0010] The present invention also provides a method for detecting potato virus Y, comprising the following steps:

[0011] (1) extracting DNA from potato samples to be tested;

[0012] (2) Recombinase polymerase amplification is performed using the RPA specific primers. If positive amplification occurs, it indicates that the potato sample contains potato virus Y.

[0013] Preferably, the temperature of the recombinase polymerase amplification is 37-42°C.

[0014] Preferably, the time for the recombinase polymerase amplification is 19 to 21 minutes.

[0015] Preferably, the recombinase polymerase amplification system is 50 μL, including 2.4 μL of upstream and downstream primers, 29.5 μL of Rehydration Buffer, 2 μL of DNA template, 2.5 μL of magnesium acetate, and ultrapure water to 50 μL.

[0016] Preferably, the initial concentration of magnesium acetate is 280 mM.

[0017] Preferably, the initial concentration of the upstream and downstream primers is 10 μM.

[0018] By adopting the above technical solution, the present invention has the following beneficial effects:

[0019] (1) The present invention uses a potato sampler for sampling, the sampling amount is small, the sample being tested is not damaged, and the plant can continue to grow.

[0020] (2) The traditional method requires RNA extraction, reverse transcription and then PCR detection, which takes a long time. The present invention improves the sampling method and can perform monitoring without RNA extraction and reverse transcription, shortening the detection time and completing the detection within 20 minutes.

[0021] (3) The present invention solves the problem that the PCR process must rely on a thermal cycler (such as a PCR instrument) to control the temperature of the processes such as melting, annealing, and extension. The amplification reaction only needs to be carried out at a constant temperature (37-42° C.); the experimental operation steps of the present invention are simple and the amplification time is short, only 20 minutes; the method of the present invention for rapid and accurate identification of potato virus Y provides a new idea and new method for rapid and on-site identification of potato virus detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the electrophoresis diagram of the detection of potato virus Y by combining recombinase polymerase amplification technology. Note: M, DNA Marker; Lane 1 PVY-ERA(F) / (R)-1 target fragment length 184bp; Lane 2 PVY-ERA(F) / (R)-4 target fragment length 186bp; Lane 3 PVY-ERA(F) / (R)-5 target fragment length 200bp.

[0023] Figure 2 Schematic diagram of acupuncture sampling.

[0024] Figure 3 Electrophoresis diagram of RPA amplification products at different acupuncture times; M Marker; Lane 110min; Lane 25min; Lane 34min; Lane 43min; Lane 52min; Lane 61min; Lane 730s; Lane 820s; Lane 910s; Lane 105s.

[0025] Figure 4 The results of the specificity and sensitivity of the RPA reaction of potato virus Y; M Marker; Lane 1 stock solution; Lane 210 -1 ; Lane 310 -2 ; Lane 410 -3 ; Lane 510 -4 ; Lane 610 -5 ; Lane 710 -6 . DETAILED DESCRIPTION

[0026] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0027] Example 1. Design and synthesis of RPA-specific primers

[0028] According to the RPA primer design principle, three pairs of specific primers were designed for the conserved region of the potato virus Y coat protein gene, as shown in Table 1. The primers were synthesized by Nanjing Sipujin Biotechnology Co., Ltd.:

[0029] Table 1 Primer sequences

[0030]

[0031] Example 2. Detection of potato samples containing potato virus Y

[0032] Place the sampling needle ( Figure 2 The potato tuber sample carrying potato virus Y was pierced with a probe (as shown) and then taken out after being left for a certain period of time, and then placed in ddH2O to obtain potato RNA; the supernatant was used for RPA reaction.

[0033] The experiment was divided into three groups, and RPA PCR amplification was performed using the three pairs of primers designed in Example 1. The amplification reaction used the TwistAmp Basic kit produced by the British company TwistDX, and the RPA reaction solution was prepared according to Table 2 according to the TwistDx manual:

[0034] Table 2 RPA reaction solution

[0035] Reagents Volume (μL) Upstream primer 2.5 Downstream primer 2.5 RehydrationBuffer 28.5 Samples to be tested 2.0 <![CDATA[ddH2O]]> 11.2 Total volume 47.5

[0036] Add the above reagents to the reaction tube and mix well. Then add 2.5 μL magnesium acetate (280 nM) and mix well. Start the recombinase polymerase amplification reaction at 38°C for 20 min. Add 10 μg / mL proteinase K and incubate at 56°C for 5 min to terminate the reaction. After the reaction is completed, perform agarose (1.5%) electrophoresis detection. The results are as follows Figure 1 The results show that the primers of the present invention amplify a bright, single and stable band at 184 bp, and the amplification efficiency is better than that of the other two sets of primers, indicating that the present invention can be used for the detection of potato virus Y. The amplified fragment of the primers is shown in SEQ ID No.7:

[0037] GAGAAACTGAGATGCCAACTGTGATGAATGGGCTTATGGTTTGGTGCATTGAAAATGGAACCTCGCCAAATGTCAACGGAGTTTGGGTTATGATGGATGGGAATGAACAAGTCGAGTACCCGTTGAAACCAATCGTTGAGAATGCAAAACCAACCCTTAGGCAAATCATGGCACATTTCTCAGA (SEQ ID No. 7).

[0038] Example 3

[0039] Since the sampling method used is the micro-acupuncture method, this embodiment tests whether different acupuncture times have an impact on the test results. The specific method is to insert the sampling needle into the potato tuber and then take it out after a certain period of time. A total of 10 time periods are set, namely 10min, 5min, 4min, 3min, 2min, 1min, 30s, 20s, 10s, and 5s, and then put it into ddH2O and use it as the RNA stock solution for detection. The detection system and detection procedure are the same as in Example 1. The detection results are shown in FIG. Figure 3 As shown. Figure 3 It can be seen that brighter bands appear when the sampling needle penetrates the sample for 10 min, 5 min, 4 min, 3 min, 2 min, 1 min, and 30 s. In order to shorten the detection time, a 30 s puncture time is used.

[0040] Example 4

[0041] This example verifies the sensitivity of the detection. The specific method is: the sampling needle is inserted into the potato tuber and left for 30 seconds before being taken out. The inserted sampling needle is placed in ddH2O and used as the RNA stock solution for gradient dilution. The RNA concentration at this time is 43.7ng / The dilution factor between each gradient was 10 times, and a total of 7 concentration gradients were set. The RPA detection was performed using the above 7 samples of different concentrations as templates. The detection method was the same as in Example 1. The detection results were as follows: Figure 4 As shown. Figure 4 It can be seen that the present invention has a good 6 In the case of multiples, there are still bright stripes.

[0042] It can be seen from the above examples that the present invention provides RPA-specific primers and a detection method for potato virus Y identification, which can achieve rapid detection of potato virus Y.

[0043] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. RPA specific primers for potato virus Y identification, characterized in that, It comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.

2.

2. Use of the RPA specific primer according to claim 1 in detecting potato virus Y.

3. Use of the RPA specific primers according to claim 1 in preparing a kit for detecting potato virus Y.

4. A kit for detecting potato virus Y, characterized in that: Comprising the primer according to claim 1.

5. A method for detecting potato virus Y, characterized in that: The following steps are involved: (1) extracting RNA from potato samples to be tested; (2) Recombinase polymerase amplification is performed using the RPA specific primers described in claim 1. If positive amplification occurs, it indicates that the potato sample contains potato virus Y.

6. The detection method according to claim 5, characterized in that: The temperature of the recombinase polymerase amplification is 37-42°C.

7. The detection method according to claim 6, characterized in that: The time for the recombinase polymerase amplification is 19 to 21 minutes.

8. The detection method according to claim 5, characterized in that: The recombinase polymerase amplification system is 50 μL, including 2.5 μL of upstream and downstream primers, 28.5 μL of Rehydration Buffer, 2 μL of DNA template, 2.5 μL of magnesium acetate, and ultrapure water to 50 μL.

9. The detection method according to claim 8, characterized in that: The initial concentration of magnesium acetate was 280 mM.

10. The detection method according to claim 8, characterized in that: The initial concentration of the upstream and downstream primers was 10 μM.

Images