Kit for diagnosing alzheimer's disease and pharmaceutical composition for treating alzheimer's disease

Abstract

Disclosed are a kit for diagnosing Alzheimer's disease and a pharmaceutical composition for treating Alzheimer's disease, wherein EDIL3 or a nucleic acid encoding EDIL3 is used as an indicator or target.

Description

Technical Field

[0001] The present disclosure relates to a kit for diagnosing Alzheimer's disease and a pharmaceutical composition for treating Alzheimer's disease. Background Art

[0002] Alzheimer's disease (Alzheimer's dementia) is one of the major dementias and is a neurodegenerative disease characterized by a decrease in neurons in the brain parenchyma and neuropathological lesions such as senile plaques (Non-Patent Document 1).

[0003] It is known that the allele of apolipoprotein E (hereinafter also referred to as "APOE") is one of the genetic risk factors for the onset of Alzheimer's disease. APOE has three major variants, namely ε2, ε3 and ε4, which are distinguished by the amino acids at the 112th and 158th residues (hereinafter referred to as APOE2, APOE3 and APOE4, respectively). APOE2 is a variant in which the 112th residue is cysteine ​​and the 158th residue is cysteine. APOE3 is a variant in which the 112th residue is cysteine ​​and the 158th residue is arginine. APOE4 is a variant in which the 112th residue is arginine and the 158th residue is arginine. It is reported that among these variants, APOE4 is particularly a genetic risk factor for the onset of Alzheimer's disease; and based on human subjects with homozygous APOE3 alleles, the probability of developing Alzheimer's disease in human subjects with heterozygous APOE4 alleles is approximately 3.68 times, and the probability of developing Alzheimer's disease in human subjects with homozygous APOE4 alleles is approximately 12.50 times (Non-Patent Document 2).

[0004] Synaptic dysfunction is widely considered to be one of the earliest important lesions observed before neurodegeneration in Alzheimer's disease (Non-Patent Documents 3 and 4). In fact, in human subjects with APOE4 alleles, immature forms of dendritic spines and abnormal brain activity were observed (Non-Patent Documents 5 and 6). In addition, experiments using rodent models have reported that human APOE4 can adversely affect synaptic function and morphological integrity (Non-Patent Documents 5 and 7 to 10).

[0005] Reference List

[0006] Non-patent literature

[0007] Non-patent document 1: DJ Selkoe and J. Hardy, “The amyloid hypothesis of Alzheimer's disease at 25 years.” EMBO Mol. Med. 8, 595-608 (2016).

[0008] Non-patent document 2: Yu Yamazaki et al., "Apolipoprotein E and Alzheimer disease: pathobiology and targeting strategies." Nat. Rev. Neurol. 15, 501-518 (2019).

[0009] Non-patent document 3: R.D. Terry et al., "Physical basis of cognitive alterations in Alzheimer's disease: synapse loss is the major correlate of cognitive impairment." Ann. Neurol. 30, 572-80 (1991).

[0010] Non-patent document 4: ST DeKosky and SW Scheff, "Synapse loss in frontal cortex biopsies in Alzheimer's disease: correlation with cognitive severity." Ann. Neurol. 27, 457-64 (1990).

[0011] Non-patent document 5: Y. Ji et al., "Apolipoprotein E isoform-specific regulation of dendritic spine morphology in apolipoprotein E transgenic mice and Alzheimer's disease patients." Neuroscience 122, 305-15 (2003).

[0012] Non-patent document 6: N. Filippini et al., "Distinct patterns of brain activity in young carriers of the APOE-epsilon4 allele." Proc. Natl. Acad. Sci. USA 106, 7209-14 (2009).

[0013] Non-patent document 7: BL Trommer et al., "ApoE isoform affects LTP in human targeted replacement mice." Neuroreport 15, 2655-8 (2004).

[0014] Non-patent document 8: KM Korwek et al., "ApoE isoform-dependent changes in hippocampal synaptic function." Mol. Neurodegener., 4, 21 (2009).

[0015] Non-patent document 9: SB Dumanis et al., "ApoE4 decreases spine density and dendritic complexity in cortical neurons in vivo.", J. Neurosci. 29, 15317-22 (2009).

[0016] Non-patent document 10: Y. Tensaouti et al., "ApoE Regulates the Development of Adult Newborn Hippocampal Neurons.", eNeuro5(4), ENEURO.0155-18.2018, (2018).

[0017] Non-patent document 11: N. Ichiyanagi et al., "Establishment of In Vitro FUS-Associated Familial Amyotrophic Lateral Sclerosis Model Using Human Induced Pluripotent Stem Cells." Stem cell reports 6, 496-510 (2016).

[0018] Non-patent literature 12: Alexandra Grubman et al., “A single-cell atlas of entorhinal cortex from individuals with Alzheimer's disease reveals cell-type-specific gene expression regulation”, Nature Neuroscience, 22(12): 2087-2097 (2019).

[0019] Non-patent literature 13: Tetsuya Akiyama et al., "Aberrant axon branching via Fos-B dysregulation in FUS-ALS motor neurons.", eBioMedicine 45, 362-378 (2019). Summary of the invention

[0020] Technical issues

[0021] The purpose of the present disclosure is to provide a kit for diagnosing Alzheimer's disease and a pharmaceutical composition for treating Alzheimer's disease.

[0022] Solution to the problem

[0023] The present inventors have found that human astrocytes obtained by differentiating induced pluripotent stem cells (iPSCs) having an APOE4 allele (hereinafter also referred to as "iPast") highly express EDIL3 (also referred to as EGF-like discoidin-like repeat I-like domain protein 3, DEL-1 or developmental endothelial locus-1) protein, which is one of the proteins contained in the extracellular matrix. The present inventors also found that when primary neurons were cultured under the condition of the presence of EDIL3 in the cell culture medium, morphological abnormalities as a phenotype of Alzheimer's disease were observed.

[0024] For example, this disclosure relates to the following.

[0025] [1] A kit for diagnosing or assisting in the diagnosis of Alzheimer's disease, the kit comprising:

[0026] Nucleic acid primers or nucleic acid probes for detecting mRNA encoding EDIL3;

[0027] Nucleic acid primers or nucleic acid probes for detecting cDNA complementary to the mRNA; or

[0028] An anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

[0029] [2] The kit according to [1], which comprises instructions for use.

[0030] [3] A diagnostic agent or diagnostic aid for Alzheimer's disease, comprising:

[0031] Nucleic acid primers or nucleic acid probes for detecting mRNA encoding EDIL3;

[0032] Nucleic acid primers or nucleic acid probes for detecting cDNA complementary to the mRNA; or

[0033] An anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

[0034] [4] A nucleic acid primer or a nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or a nucleic acid probe for detecting cDNA complementary to the mRNA; or

[0035] an anti-EDIL3 antibody or an EDIL3 binding fragment thereof,

[0036] Used in diagnosing Alzheimer's disease or assisting in the diagnosis of Alzheimer's disease.

[0037] [5] Nucleic acid primers or nucleic acid probes for detecting mRNA encoding EDIL3;

[0038] Nucleic acid primers or nucleic acid probes for detecting cDNA complementary to the mRNA; or

[0039] an anti-EDIL3 antibody or an EDIL3 binding fragment thereof,

[0040] Use in preparing a kit for diagnosing or assisting in the diagnosis of Alzheimer's disease, or a diagnostic agent or diagnostic aid for Alzheimer's disease.

[0041] [6] The kit as described in [1] or [2], the diagnostic agent or diagnostic aid as described in [3]; the nucleic acid primer, nucleic acid probe, antibody or EDIL3 binding fragment as described in [4]; or the use as described in [5], wherein the subject to be diagnosed is a subject with an APOE4 genotype.

[0042] [7] A method for assisting the diagnosis of Alzheimer's disease, the method comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

[0043] [8] A method for assisting the diagnosis of Alzheimer's disease, the method comprising: detecting whether the APOE4 genotype exists in a subject; and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject.

[0044] [9] A method for collecting data for diagnosing Alzheimer's disease, the method comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

[0045]

[10] A method for collecting data for diagnosing Alzheimer's disease, the method comprising: detecting whether an APOE4 genotype is present in a subject; and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject.

[0046]

[11] A method for diagnosing Alzheimer's disease, the method comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

[0047]

[12] A method for diagnosing Alzheimer's disease, the method comprising: detecting whether the APOE4 genotype is present in a subject; and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject.

[0048]

[13] A method for assisting the diagnosis of Alzheimer's disease, the method comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from a subject.

[0049]

[14] A method for assisting in the diagnosis of Alzheimer's disease, the method comprising: detecting whether the APOE4 genotype exists in a subject; and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from the subject.

[0050]

[15] A method for collecting data for diagnosing Alzheimer's disease, the method comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from a subject.

[0051]

[16] A method for collecting data for diagnosing Alzheimer's disease, the method comprising: detecting whether an APOE4 genotype is present in a subject; and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from the subject.

[0052]

[17] A method for diagnosing Alzheimer's disease, the method comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from a subject.

[0053]

[18] A method for diagnosing Alzheimer's disease, the method comprising: detecting whether APOE4 genotype is present in a subject; and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from the subject.

[0054]

[19] The method of any one of

[13] to

[18] , wherein quantifying EDIL3 comprises contacting an anti-EDIL3 antibody or an EDIL3-binding fragment thereof with a biological sample obtained from the subject.

[0055]

[20] The method of any one of

[13] to

[19] , wherein the biological sample is cerebrospinal fluid, plasma, serum, whole blood, saliva, sputum, nipple discharge, urine, sweat, tissue, cells (optionally glial cells) or pancreatic juice.

[0056]

[21] The method of any one of [7] to

[20] , wherein a higher quantitative level of EDIL3 compared to a control indicates that the subject has or is likely to have Alzheimer's disease.

[0057]

[22] A method for treating Alzheimer's disease, comprising administering a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease to a subject determined to have a higher quantitative level of EDIL3 compared to a control in the method of any one of [7] to

[21] .

[0058]

[23] The method of

[22] , wherein the pharmaceutical composition or therapeutic agent comprises a therapeutically effective amount of a substance that inhibits EDIL3.

[0059]

[24] The method according to

[23] , wherein the substance that inhibits EDIL3 is a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

[0060]

[25] The method of any one of [7] to

[24] , wherein the subject is a subject having an APOE4 genotype.

[0061]

[26] A pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising a substance that inhibits EDIL3.

[0062]

[27] A substance that inhibits EDIL3, for use in treating Alzheimer's disease.

[0063]

[28] Use of a substance that inhibits EDIL3 in the manufacture of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease.

[0064]

[29] A method for treating Alzheimer's disease, comprising administering a substance that inhibits EDIL3 to a patient in need thereof.

[0065]

[30] The pharmaceutical composition or therapeutic agent as described in

[26] , the substance as described in

[27] , the use as described in

[28] or the treatment method as described in

[29] , wherein the substance that inhibits EDIL3 is a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

[0066]

[31] The pharmaceutical composition or therapeutic agent of

[26] or

[30] , the substance of

[27] or

[30] , the use of

[28] or

[30] , or the treatment method of

[29] or

[30] , wherein the substance that inhibits EDIL3 is a nucleic acid that inhibits the expression of EDIL3.

[0067]

[32] The pharmaceutical composition or therapeutic agent of

[26] or

[30] , the substance of

[27] or

[30] , the use of

[28] or

[30] , or the treatment method of

[29] or

[30] , wherein the substance that inhibits EDIL3 is an anti-EDIL3 antibody or an antigen-binding fragment thereof.

[0068]

[33] The pharmaceutical composition or therapeutic agent of

[26] or

[30] , the substance of

[27] or

[30] , the use of

[28] or

[30] , or the method of treatment of

[29] or

[30] , wherein the substance that inhibits EDIL3 is a compound targeting EDIL3.

[0069]

[34] The pharmaceutical composition, therapeutic agent, substance, use or method of treatment as described in

[33] , wherein the compound targeting EDIL3 is a small molecule compound.

[0070]

[35] The pharmaceutical composition or therapeutic agent of any one of

[26] and

[30] to

[34] , or the use of any one of

[28] and

[30] to

[34] , wherein the pharmaceutical composition or therapeutic agent is a pharmaceutical composition or therapeutic agent for treating a human subject having an APOE4 genotype.

[0071]

[36] The substance as described in any one of

[27] and

[30] to

[34] , or the treatment method as described in any one of

[29] to

[34] , wherein the subject to be treated is a human subject having an APOE4 genotype.

[0072]

[37] A method for screening a substance that inhibits EDIL3, the method comprising:

[0073] culturing neurons in a medium containing EDIL3 and a test substance; and

[0074] The neurons were used to detect Alzheimer's disease phenotypes.

[0075]

[38] A method for screening a substance that inhibits EDIL3, the method comprising:

[0076] introducing a nucleic acid for expressing EDIL3 into a cell or microorganism;

[0077] culturing the cell or microorganism;

[0078] recovering a culture supernatant obtained by culturing the cell or microorganism;

[0079] culturing neurons in a medium containing the recovered culture supernatant and a test substance; and

[0080] The neurons were used to assess the Alzheimer's disease phenotype.

[0081]

[39] A method for screening a substance that inhibits EDIL3, the method comprising:

[0082] culturing cells and neurons expressing EDIL3 in a medium containing a test substance; and

[0083] The neurons were used to detect Alzheimer's disease phenotypes.

[0084]

[40] The screening method as described in any one of

[37] to

[39] , wherein the neuron is a neuron with an APOE4 genotype.

[0085]

[41] The screening method as described in any one of

[37] to

[40] , wherein the substance that inhibits EDIL3 is a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

[0086]

[42] The screening method according to any one of

[37] to

[41] , wherein the substance that inhibits EDIL3 is a substance for treating Alzheimer's disease.

[0087]

[43] The screening method of any one of

[37] to

[42] , wherein the substance that inhibits EDIL3 is administered to a human subject with an APOE4 genotype who suffers from Alzheimer's disease.

[0088]

[44] A method for screening an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, the method comprising:

[0089] culturing neurons in a medium containing EDIL3 and a test substance; and

[0090] The neurons were used to detect Alzheimer's disease phenotypes.

[0091]

[45] A method for screening an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, the method comprising:

[0092] introducing a nucleic acid for expressing EDIL3 into a cell or microorganism;

[0093] culturing the cell or microorganism;

[0094] recovering a culture supernatant obtained by culturing the cell or microorganism;

[0095] culturing neurons in a medium containing the recovered culture supernatant and a test substance; and

[0096] The neurons were used to assess the Alzheimer's disease phenotype.

[0097]

[46] A method for screening an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, the method comprising:

[0098] culturing cells and neurons expressing EDIL3 in a medium containing a test substance; and

[0099] The neurons were used to detect Alzheimer's disease phenotypes.

[0100]

[47] The screening method as described in any one of

[44] to

[46] , wherein the neuron is a neuron with an APOE4 genotype.

[0101]

[48] ​​The screening method of any one of

[44] to

[47] , wherein assessing the phenotype of Alzheimer's disease from the neuron comprises assessing the morphology of the neuron.

[0102]

[49] The screening method of any one of

[44] to

[48] , wherein assessing the phenotype of Alzheimer's disease from the neuron comprises detecting changes in the number of spines of the neuron.

[0103]

[50] The screening method as described in any one of

[44] to

[49] , wherein the pharmaceutical composition or therapeutic agent is administered to a human subject having an APOE4 genotype.

[0104]

[51] A method for screening a substance that inhibits EDIL3, the method comprising:

[0105] culturing cells expressing EDIL3 in a medium containing a test substance; and

[0106] The expression or secretion of EDIL3 was assessed.

[0107]

[52] The screening method as described in

[51] , wherein the evaluation of EDIL3 expression or secretion is to quantify mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3.

[0108]

[53] The screening method of

[51] or

[52] , wherein evaluating the expression or secretion of EDIL3 is quantifying EDIL3 in the culture medium.

[0109]

[54] The screening method of

[52] or

[53] , wherein EDIL3 is quantified using an anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

[0110]

[55] The screening method as described in any one of

[51] to

[54] , wherein the substance that inhibits EDIL3 is a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

[0111]

[56] The screening method according to any one of

[51] to

[55] , wherein the substance that inhibits EDIL3 is a substance for treating Alzheimer's disease.

[0112]

[57] The screening method as described in any one of

[51] to

[56] , wherein the substance that inhibits EDIL3 is administered to a human subject with APOE4 genotype who suffers from Alzheimer's disease.

[0113]

[58] The screening method as described in any one of

[37] to

[57] , wherein the substance that inhibits EDIL3 is a nucleic acid that inhibits the expression of EDIL3, an anti-EDIL3 antibody or an antigen-binding fragment thereof, or a compound targeting EDIL3.

[0114]

[59] The screening method as described in

[58] , wherein the compound targeting EDIL3 is a small molecule compound.

[0115] Advantageous Effects of the Invention

[0116] According to an embodiment of the present disclosure, a kit for diagnosing or assisting in the diagnosis of Alzheimer's disease may be provided. According to an embodiment of the present disclosure, a diagnostic agent or diagnostic aid for Alzheimer's disease may be provided. According to an embodiment of the present disclosure, a method for diagnosing Alzheimer's disease or a method for assisting in the diagnosis of Alzheimer's disease may be provided. According to an embodiment of the present disclosure, a method for collecting data for diagnosing Alzheimer's disease may be provided.

[0117] According to an embodiment of the present disclosure, a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease may be provided. According to an embodiment of the present disclosure, a method for treating Alzheimer's disease may be provided.

[0118] According to an embodiment of the present disclosure, a method for screening a substance that inhibits EDIL3 may be provided. According to an embodiment of the present disclosure, a method for screening an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease may be provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0119] Figure 1An overview of the method for generating alleles in Example 1 is shown, in which the gene encoding APOE4 is knocked into the APOE3 allele (wild-type allele).

[0120] Figure 2 The results of gel electrophoresis analysis after gene amplification of five iPSC clones (#86 to #90) into which the generated alleles were introduced by PCR in Example 1 are shown.

[0121] Figure 3 The gene sequencing results of five iPSC clones into which the generated alleles were introduced in Example 1 are shown.

[0122] Figure 4 An overview of the method for inducing iPSCs into astrocytes in Example 1 is shown.

[0123] Figure 5 Representative morphologies of astrocytes derived from iPSCs having an APOE4 / 4 genotype (E4 / E4 (#87-5)) and astrocytes derived from 201B7, which is iPSCs having an APOE3 / 3 genotype, (E3 / E3 (201B7)) in Example 1 are shown.

[0124] Figure 6 The fluorescent image of iPast in Example 1 is shown when the astrocyte markers S100β, GFAP, and CD44 were immunofluorescently stained and the cell nuclei were stained with Hoechst.

[0125] Figure 7 Example 1 shows Figure 6 The proportions of positive cells in the fluorescent images of S100β, GFAP, and CD44 are shown.

[0126] Figure 8 The results of measuring the expression levels of mRNA encoding APOE protein (APOE), astrocyte marker S100β, and β-actin (ACTB) in Example 2 are shown.

[0127] Fig. 9 The results of quantifying the expression levels of APOE protein and β-actin expressed by each iPast by Western blotting in Example 2 are shown.

[0128] Fig.10 The results of studying the amount of APOE in the culture medium in which each iPast was cultured by the ELISA method in Example 2 are shown.

[0129] Fig.11The results of mass spectrometry analysis of fragments obtained by treating APOE with trypsin in the exoculture fluid of iPast having the APOE3 / 3 genotype and the exoculture fluid of iPast having the APOE4 / 4 genotype in Example 2 are shown.

[0130] Fig.12 : is a diagram showing the overview of co-culture of iPast having an APOE4 / 4 genotype or iPast having an APOE3 / 3 genotype with mouse primary neurons in Example 3.

[0131] Fig.13 Representative fluorescent images of mouse primary neurons transfected with actin-GFP in Example 3 are shown.

[0132] Fig.14 Fluorescent images of dendrites of mouse primary neurons co-cultured with iPast having an APOE4 / 4 genotype or iPast having an APOE3 / 3 genotype in Example 3 are shown.

[0133] Fig.15 Example 3 shows that Fig.14 The number of dendritic spines observed per μm of dendrites in the fluorescent images was obtained in a similar manner.

[0134] Fig.16 For each dendritic spine shape, Fig.14 The number of dendritic spines observed per μm of dendrites in the fluorescent images was obtained in a similar manner.

[0135] Fig.17 The clustering analysis results of genes having different expression levels between iPast with APOE4 / 4 genotype and iPast with APOE3 / 3 genotype in Example 4 are shown as a heat map of z scores of logFC of iPast with APOE4 / 4 genotype relative to iPast with APOE3 / 3 genotype.

[0136] Fig.18 The results of principal component analysis (PCA) of the transcriptomes of iPast having an APOE3 / 3 genotype and iPast having an APOE4 / 4 genotype in Example 4 are shown.

[0137] Fig.19 In Example 4, Fig.17 The results are shown as a two-dimensional graph.

[0138] Fig. 20The results of quantification of CDKN1A and EDIL3 and β-actin as an indicator of cell number by quantitative reverse transcription-PCR in Example 4 are shown, wherein the expression levels of CDKN1A and EDIL3 were increased in iPast having the APOE4 / 4 genotype.

[0139] Fig.21 The results of measuring the expression levels of genes known to be specifically expressed in pan-reactive, A1-like reactive (A1-specific), and A2-like reactive (A2-specific) astrocytes in Example 5 by the same method as in Example 4 are shown.

[0140] Fig. 22 The results of measuring the expression levels of genes known to be specifically expressed in pan-reactive, A1-like reactive (A1-specific), and A2-like reactive (A2-specific) astrocytes in Example 5 by the same method as in Example 4 are shown.

[0141] Fig.23 is a diagram showing the Venn diagram in Example 6, which Venn diagram shows the overlap of 119 mRNAs found in Example 4 and 491 genes found in the genome-wide association analysis in Non-Patent Document 12, wherein the RNA amount in these 119 mRNAs is increased in iPast with APOE4 / 4 genotype compared to that in iPast with APOE3 / 3 genotype, and these 491 genes are genes that may be associated with Alzheimer's disease as single nucleotide polymorphisms.

[0142] Fig.24 The results of evaluating the amount of EDIL3 protein in cleaved iPast and culture medium (CM) in which iPast was cultured by fragment analysis in Example 6 are shown.

[0143] Fig.25 The results of evaluating the expression level of EDIL3 by Western blotting on cleaved iPast in Example 6 are shown.

[0144] Fig.26 The results of evaluating the amount of EDIL3 secreted into the medium in which iPast was cultured by Western blotting in Example 6 are shown.

[0145] Fig. 27 The results of Western blotting in Example 7 for evaluating the amount of EDIL3 in HEK293 cells transduced with EDIL3 and their culture medium are shown.

[0146] Fig.28The protocol in Example 7 is shown, in which mouse primary neurons were cultured in a medium in which HEK293 cells transduced with EDIL3 were cultured during day 16 to day 21 of culture (DIV 16 to 21), and the effects of exposure to EDIL3 on the mouse primary neurons were evaluated.

[0147] Fig.29 Shown are fluorescent images of actin-GFP in dendrites of mouse primary neurons after culture in a medium in which EDIL3-transduced HEK293 cells were cultured in Example 7, and the results of quantifying the number of dendritic spines per μm.

[0148] Fig.30 Shown are the results of quantifying the number of dendritic spines per μm for each dendritic spine shape in dendrites of mouse primary neurons after culturing in a medium in which EDIL3-transduced HEK293 cells were cultured in Example 7.

[0149] Fig.31 is a graph showing the expression level of EDIL3 in iPast having an APOE4 / 4 genotype into which shEDIL3 or shcontrol was introduced in Example 8.

[0150] Fig.32 Shown in Example 8 are fluorescent images of actin-GFP in dendrites of mouse primary neurons after culturing in a medium into which iPast, into which shEDIL3 or shcontrol was introduced, and the results of quantifying the number of dendritic spines per μm.

[0151] Fig.33 : is a diagram showing a fluorescent image of immunofluorescence staining of a parietal lobe section of a postmortem brain of an Alzheimer's disease patient or a person who does not show symptoms of Alzheimer's disease in Example 9.

[0152] Fig.34 is a graph showing the area of ​​amyloid plaques in the brains of Alzheimer's disease patients in Example 9.

[0153] Fig.35 : is a graph showing the change in the ratio of GFAP-positive cells in the brain of an Alzheimer's disease patient according to the distance from the amyloid plaque in Example 9.

[0154] Fig.36 : is a graph showing the change in fluorescence intensity derived from the labeled anti-EDIL3 antibody in the brain of an Alzheimer's disease patient in Example 9 depending on the distance from the amyloid plaque. DETAILED DESCRIPTION

[0155] Hereinafter, embodiments for implementing the present disclosure will be described, but the present disclosure is not limited to the following embodiments.

[0156] The terms “a,” “an,” “the,” and similar terms used in the context of the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0157] <First aspect>

[0158] The first aspect of the present disclosure is a kit for diagnosing or assisting in the diagnosis of Alzheimer's disease, the kit comprising: a nucleic acid primer or a nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or a nucleic acid probe for detecting cDNA complementary to the mRNA; or an anti-EDIL3 antibody or an EDIL3 binding fragment thereof. In an embodiment, the first aspect of the present disclosure may also be a diagnostic agent or a diagnostic aid for Alzheimer's disease, the diagnostic agent comprising: a nucleic acid primer or a nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or a nucleic acid probe for detecting cDNA complementary to the mRNA; or an anti-EDIL3 antibody or an EDIL3 binding fragment thereof.

[0159] EDIL3 (EGF-like repeat discoidin domain 3) is a protein that constitutes the extracellular matrix, also known as DEL1 (developmental endothelial locus-1). It is known that EDIL3 secreted outside the cell has the effect of controlling epithelial-mesenchymal transition (EMT), etc. EDIL3 is biosynthesized and secreted by various cells in the human body, and among them, a large amount of mRNA is expressed in brain cells in particular, and it is known that secreted EDIL3 is also distributed in blood, etc. It is known that human EDIL3 has two isoforms, namely isoform 1 represented by SEQ ID NO: 1 and isoform 2 represented by SEQ ID NO: 2. According to the present disclosure, EDIL3 is preferably mammalian EDIL3, and more preferably human EDIL3, and human EDIL3 can be isoform 1 or isoform 2.

[0160] The inventors have found that neurons exposed to EDIL3 in a culture environment exhibit a phenotype of Alzheimer's disease. More specifically, the inventors have found that a decrease in the density of the number of dendritic spines was observed in neurons exposed to EDIL3 in a culture environment. Therefore, without wishing to be bound by any theory, by measuring the content of EDIL3 or nucleic acids encoding EDIL3 that have the effect of causing abnormal neuronal morphology associated with Alzheimer's disease due to being present in an environment where neurons exist, it is possible, for example, to predict the possibility of a subject suffering from Alzheimer's disease based on a high content of EDIL3 or nucleic acids encoding EDIL3 in a sample collected from a subject. That is, in an embodiment, the first aspect of the present disclosure can also be a method for assisting in the diagnosis of Alzheimer's disease, a method for collecting data for diagnosing Alzheimer's disease, or a method for diagnosing Alzheimer's disease, comprising quantifying mRNA encoding EDIL3 in a subject, cDNA complementary to the mRNA, or EDIL3. In these cases, quantifying EDIL3 may include contacting an anti-EDIL3 antibody or its EDIL3 binding fragment with a biological sample obtained from a subject.

[0161] The mRNA encoding EDIL3 in the nucleic acid primer or nucleic acid probe for detecting the mRNA encoding EDIL3 is not limited as long as it is a nucleic acid that produces EDIL3 by translation, and may be, for example, an mRNA encoding a protein having an amino acid sequence identity of 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% with EDIL3 represented by SEQ ID NO: 1 or SEQ ID NO: 2, and in another embodiment, may be an mRNA encoding a protein having an amino acid sequence identity of 95% or more with EDIL3 represented by SEQ ID NO: 1 or SEQ ID NO: 2, and in yet another embodiment, may be an mRNA encoding EDIL3 represented by SEQ ID NO: 1 or SEQ ID NO: 2. In these cases, EDIL3 encoded by such a nucleic acid may have its physiological function (e.g., binding property to integrin). In addition, the detection of mRNA encoding EDIL3 by detecting a nucleic acid primer or a nucleic acid probe encoding mRNA encoding EDIL3 may be direct or indirect detection of mRNA encoding EDIL3 (i.e., detection of mRNA encoding EDIL3 itself), but in other embodiments, it may be direct detection. Indirect detection of mRNA encoding EDIL3 may be detection of a nucleic acid spliced ​​to produce mRNA encoding EDIL3, i.e., an mRNA precursor encoding mRNA encoding EDIL3. Examples of mRNA precursors encoding mRNA encoding EDIL3 include nucleic acids shown in SEQ ID NO:3 or SEQ ID NO:4. Examples of mRNA encoding EDIL3 obtained by splicing mRNA precursors represented by SEQ ID NO:3 or SEQ ID NO:4 include nucleic acids shown in SEQ ID NO:5 as mRNA encoding isoform 1 of EDIL3 (SEQ ID NO:1), or nucleic acids shown in SEQ ID NO:6 as mRNA encoding isoform 2 of EDIL3 (SEQ ID NO:2).Therefore, in an embodiment of the first aspect of the present disclosure, the nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3 may be a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% or more homology to the nucleic acid shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. In another embodiment, it may be a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 90% or more homology to the nucleic acid shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. In yet another embodiment, it may be a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 90% or more homology to the nucleic acid shown in SEQ ID NO:5 or SEQ ID NO:6. In yet another embodiment, it may be a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 90% or more homology to the nucleic acid shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. In another embodiment, the nucleic acid primer or nucleic acid probe may be a nucleic acid primer or nucleic acid probe for detecting the nucleic acid shown in SEQ ID NO: 6. In another embodiment, the nucleic acid primer or nucleic acid probe may be a nucleic acid primer or nucleic acid probe for detecting the nucleic acid shown in SEQ ID NO: 5 or SEQ ID NO: 6. In these cases, the EDIL3 encoded by the nucleic acid may have its physiological function (e.g., properties with integrin).

[0162] The nucleic acid primer or nucleic acid probe for detecting cDNA complementary to mRNA according to the first aspect of the present disclosure is a cDNA complementary to the mRNA of interest by the above-mentioned nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3. Examples of such cDNA include the nucleic acid shown in SEQ ID NO:7 as a cDNA complementary to SEQ ID NO:5, and the nucleic acid shown in SEQ ID NO:8 as a cDNA complementary to SEQ ID NO:6. Therefore, in an embodiment of the first aspect of the present disclosure, a nucleic acid primer or a nucleic acid probe for detecting a cDNA complementary to an mRNA encoding EDIL3 may be a nucleic acid primer or a nucleic acid probe for detecting a nucleic acid having 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% homology to a nucleic acid shown in SEQ ID NO: 7 or SEQ ID NO: 8, in another embodiment, it may be a nucleic acid primer or a nucleic acid probe for detecting a nucleic acid having 90% or more homology to a nucleic acid shown in SEQ ID NO: 7 or SEQ ID NO: 8, and in yet another embodiment, it may be a nucleic acid primer or a nucleic acid probe for detecting a nucleic acid shown in SEQ ID NO: 7 or SEQ ID NO: 8. In these cases, EDIL3 encoded by an mRNA complementary to such a cDNA may have its physiological function (e.g., properties with integrin).

[0163] According to the present disclosure, the nucleic acid primer can be any nucleic acid primer that can bind to DNA or RNA to promote the replication reaction of nucleic acid by DNA polymerase or RNA polymerase. The DNA or RNA to be detected present in the amplification solution is amplified by such nucleic acid primers, and then the nucleic acid concentration in the solution is measured by absorbance measurement, etc., thereby the DNA or RNA to be detected can be evaluated (detected and / or quantified). The base length of the nucleic acid primer according to the present disclosure is not particularly limited, and can be, for example, 5 bases or more, 8 bases or more, 10 bases or more, 12 bases or more, 13 bases or more, 14 bases or more, 15 bases or more, 16 bases or more, 17 bases or more, or 18 bases or more, and can be 100 bases or less, 50 bases or less, 40 bases or less, 35 bases or less, 30 bases or less, 27 bases or less, 25 bases or less, 24 bases or less, 23 bases or less, or 22 bases or less. Examples of base length ranges may be 5 to 100 bases, 8 to 50 bases, 10 to 40 bases, 12 to 35 bases, 13 to 30 bases, 14 to 27 bases, 15 to 25 bases, 16 to 24 bases, 17 to 23 bases, or 18 to 22 bases. In addition, the nucleic acid primer according to the first aspect of the present disclosure has a region complementary to the mRNA or cDNA to be detected (complementary region), and the ratio of the sequence of the complementary region to the sequence of the nucleic acid primer binding site of the mRNA or cDNA to be detected may be 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% of the base sequence (number of bases) belonging to the complementary region, and in another embodiment may be 90% or more, and in yet another embodiment may be 100%. The base length of the complementary region in the nucleic acid primer according to the first aspect of the present disclosure is not particularly limited, and can be, for example, 5 to 100 bases, 8 to 50 bases, 10 to 40 bases, 12 to 35 bases, 13 to 30 bases, 14 to 27 bases, 15 to 25 bases, 16 to 24 bases, 17 to 23 bases or 18 to 22 bases. In addition, the nucleic acid primer according to the first aspect of the present disclosure may also have a region (additional region) that is not complementary to the sequence of the complementary region in addition to the complementary region. The additional region may be arranged at the 5' end and / or 3' end of the primer, and the base length of the additional region may be, for example, 1 base, 2 bases, 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases or 10 bases.

[0164] Specific examples of the nucleic acid primers according to the first aspect of the present disclosure may include nucleic acid primers having a complementary region to the nucleic acid set forth in at least one of SEQ ID NOs: 3 to 8. The nucleic acid primers according to the first aspect of the present disclosure may be, in another embodiment, a nucleic acid comprising a base sequence having 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% homology to the nucleic acid set forth in SEQ ID NO: 9 or SEQ ID NO: 10, and in yet another embodiment, may be a nucleic acid comprising a base sequence having 90% or more homology to the nucleic acid set forth in SEQ ID NO: 9 or SEQ ID NO: 10, or a nucleic acid consisting of a base sequence having 90% or more homology to the nucleic acid set forth in SEQ ID NO: 9 or SEQ ID NO: 10.

[0165] SEQ ID NO:9:AGCATACCGAGGGGATACATT

[0166] SEQ ID NO:10:CAAGGCTCAACTTCGCATTCA

[0167] The nucleic acid probe according to the present disclosure is not particularly limited as long as it can bind to DNA or RNA and evaluate (detect and / or quantify) the bound DNA or RNA by a signal emitted by the nucleic acid probe, and specific examples thereof include nucleic acid probes in a fluorescent in situ hybridization (FISH) method or an invasion assay method that can be used to detect the presence of DNA or RNA by a fluorescent signal, and nucleic acid probes in a rapid amplification of cDNA ends (RACE) method that can be used to detect the presence of nucleic acid by amplifying a portion of DNA or RNA by reverse transcription polymerase chain reaction (RT-PCR). The nucleic acid probe according to an embodiment of the first aspect of the present disclosure has a region complementary to the mRNA or cDNA to be detected (complementary region), and the ratio of the sequence of the complementary region to the sequence of the nucleic acid probe binding site of the mRNA or cDNA to be detected can be 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more or 100% of the base sequence (number of bases) belonging to the complementary region, and in another embodiment it can be 90% or more, and in yet another embodiment it can be 100%. The base length of the complementary region in the nucleic acid probe according to the first aspect of the present disclosure is not particularly limited, and can be, for example, 5 to 100 bases, 8 to 50 bases, 10 to 40 bases, 12 to 35 bases, 13 to 30 bases, 14 to 27 bases, 15 to 25 bases, 16 to 24 bases, 17 to 23 bases or 18 to 22 bases. Specific examples of the nucleic acid probe according to the first aspect of the present disclosure can include a nucleic acid probe having a complementary region to a nucleic acid set forth in at least one of SEQ ID NOs: 3 to 8.

[0168] The anti-EDIL3 antibody according to the present disclosure is not particularly limited as long as it is an antibody capable of binding to EDIL3. As the anti-EDIL3 antibody, commercially available products can be used, and such anti-EDIL3 antibodies can be purchased from Abcam (ab190692) and Thermo Fisher Scientific (Invitrogen, PA5-27994), for example.

[0169] The EDIL3-binding fragment according to the present disclosure is not particularly limited as long as it is an antigen-binding fragment capable of binding to EDIL3, and may be, for example, F(ab') 2 fragment, Fab' fragment, Fab fragment or Fv fragment.

[0170] In an embodiment, the anti-EDIL3 antibody or EDIL3 binding fragment thereof can be labeled to detect a signal. Examples of such labeling include labeling with a fluorescent dye and labeling with a protein tag such as a FLAG tag.

[0171] According to a first aspect of the present disclosure, by quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject, it is possible to assist in the diagnosis of Alzheimer's disease, collect data for the diagnosis of Alzheimer's disease, or diagnose Alzheimer's disease, and specifically, it is possible to assist in the diagnosis of Alzheimer's disease, collect data for the diagnosis of Alzheimer's disease, or diagnose the effects, onset, or progression of Alzheimer's disease. Hereinafter, embodiments will be described.

[0172] According to the subject disclosed herein, it can be a human subject suffering from Alzheimer's disease (AD, Alzheimer's dementia) or a human subject with the possibility of suffering from Alzheimer's disease. In these cases, it can be determined by the method commonly performed by those skilled in the art whether the human subject suffers from Alzheimer's disease or has the possibility of suffering from Alzheimer's disease. The human subject suffering from Alzheimer's disease or having the possibility of suffering from Alzheimer's disease can be, for example, a human subject whose cognitive function is reduced or has the possibility of cognitive function reduction as indicated by a cognitive function test such as a Mini-Mental State Examination (MMSE), a human subject in which proteins such as amyloid beta and tau proteins known to be accumulated in Alzheimer's disease patients are observed to be deposited in the brain or abnormal concentrations of these proteins in cerebrospinal fluid, or a human subject in which a reduction in brain metabolic function or atrophy of brain tissue is observed. Alzheimer's disease can be sporadic or familial Alzheimer's disease in these cases, and can be sporadic Alzheimer's disease in another embodiment. Furthermore, Alzheimer's disease in these cases may be late onset Alzheimer's disease (LOAD) with onset at an age of 65 years or older or early onset Alzheimer's disease (EOAD) with onset at an age of less than 65 years, and in another embodiment may be late onset Alzheimer's disease. In other words, the subject may be 65 years or older or younger than 65 years in an embodiment of the first aspect of the disclosure, and may be 65 years or older in another embodiment.

[0173] In an embodiment, the subject according to the present disclosure can be a subject with an APOE4 genotype (APOE4 positive subject). Apolipoprotein E (hereinafter also referred to as "APOE") is a lipid-binding protein with low-density lipoprotein receptor binding properties, and is one of the proteins involved in lipid metabolism. It is known that the APOE allele is one of the genetic risk factors for the onset of Alzheimer's disease. APOE has three major variants, namely ε2, ε3 and ε4, which are distinguished by the amino acids at the 112th and 158th residues (hereinafter referred to as APOE2, APOE3 and APOE4, respectively). APOE2 is a variant in which the 112th residue is cysteine ​​and the 158th residue is cysteine. APOE3 is a variant in which the 112th residue is cysteine ​​and the 158th residue is arginine. APOE4 is a variant in which the 112th residue is arginine and the 158th residue is arginine. It is reported that among these variants, APOE4 is particularly a genetic risk factor for the onset of Alzheimer's disease; and based on human subjects with homozygous APOE3 alleles, the probability of onset of Alzheimer's disease in human subjects with heterozygous APOE4 alleles is about 3.68 times, and the probability of onset of Alzheimer's disease in human subjects with homozygous APOE4 alleles is about 12.50 times (non-patent literature 2). The inventors have found that EDIL3 is particularly secreted in large quantities in cells of subjects with APOE4 genotypes, and when cultured in a culture medium in the presence of EDIL3, neurons exhibit a phenotype of Alzheimer's disease. In the present disclosure, a subject with an APOE4 genotype may be a subject with a homozygous or heterozygous APOE4 genotype, and in another embodiment may be a subject with a homozygous APOE4 genotype. In other words, in the present disclosure, a subject having an APOE4 genotype may be a subject having an APOE4 / 4, APOE3 / 4 or APOE2 / 4 genotype, may be a subject having an APOE4 / 4 or APOE3 / 4 genotype, and in a preferred embodiment may be a subject having an APOE4 / 4 genotype.

[0174] According to the method for assisting in the diagnosis of Alzheimer's disease, the method for collecting data for diagnosing Alzheimer's disease, or the method for diagnosing Alzheimer's disease according to the embodiment of the first aspect of the present disclosure may include detecting whether there is an APOE4 allele in the subject (assessing whether the subject has an APOE4 genotype). Detecting whether there is an APOE4 allele in the subject can be performed, for example, by collecting a biological sample from the subject and assessing whether there is an APOE4 allele in the biological sample. The biological sample is not particularly limited in this case, as long as it can assess whether there is an APOE4 allele, and can be, for example, cerebrospinal fluid, plasma, serum, whole blood, saliva, sputum, nipple discharge, urine, sweat, tissue, cells (including glial cells) or pancreatic juice, and in another embodiment can be plasma, serum or whole blood. The biological sample can be obtained from a region of the brain or central nervous system including cerebrospinal fluid of the subject. In addition, the method for detecting the presence or absence of the APOE4 allele in a subject can be a method commonly used by those skilled in the art, and can be, for example, a method using a sequencer (e.g., a next-generation sequencer (NGS)), an invasion assay method, a fluorescence in situ hybridization (FISH) method, an immunostaining method, a restriction fragment length polymorphism (PCR-RFLP) method, a single-stranded conformation polymorphism (PCR-SSCP) method, a TaqMan method, or a multiplex ligation-dependent probe amplification (MLPA) method.

[0175] In the first aspect of the present disclosure, the quantification of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject is generally performed by quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample collected from the subject. That is, in another embodiment, the first aspect of the present disclosure may also be a method for assisting in the diagnosis of Alzheimer's disease, a method for collecting data for diagnosing Alzheimer's disease, or a method for diagnosing Alzheimer's disease, which includes quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from a subject. In these cases, quantifying EDIL3 may include contacting an anti-EDIL3 antibody or an EDIL3-binding fragment thereof with a biological sample obtained from a subject. The biological sample to be collected from the subject is not particularly limited, and may be, for example, cerebrospinal fluid, plasma, serum, whole blood, saliva, sputum, nipple discharge, urine, sweat, tissue, cells (including glial cells), or pancreatic juice, in another embodiment may be cerebrospinal fluid, plasma, serum or whole blood, and in yet another embodiment may be cerebrospinal fluid. The biological sample may be obtained from a region of the brain or central nervous system of the subject, including cerebrospinal fluid.

[0176] The quantification of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample can be performed by methods commonly used by those skilled in the art, and for example, can be performed according to protocols commonly used by those skilled in the art by using a quantitative PCR (qPCR) method or a quantitative reverse transcription PCR (RT-qPCR) method using nucleic acid primers according to the embodiments of the first aspect of the present disclosure, a FISH method, an invasion assay method or a RACE method using a nucleic acid probe according to the embodiments of the first aspect of the present disclosure, or an ELISA method or a protein blotting method using an anti-EDIL3 antibody or an EDIL3 binding fragment thereof according to the embodiments of the first aspect of the present disclosure.

[0177] In the first aspect of the present disclosure, when the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject obtained by quantification is high (high concentration), it is possible to assist in diagnosing Alzheimer's disease in the subject, collect data for diagnosing Alzheimer's disease in the subject, or diagnose the impact, onset or progression of Alzheimer's disease in the subject, or the possibility or high possibility of Alzheimer's disease in the subject. More specifically, when the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject is higher than a predetermined value (control), the subject can be assisted in diagnosis or data for diagnosing that the subject has Alzheimer's disease or has the possibility of suffering from Alzheimer's disease can be collected. The predetermined value can be, for example, the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a control subject, and the control subject can be a subject not suffering from Alzheimer's disease, an APOE4-negative subject (e.g., a subject with an APOE3 / 3 genotype) or an APOE4-negative subject not suffering from Alzheimer's disease (e.g., a subject with an APOE3 / 3 genotype). In an embodiment, when the distribution of the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the control subject is fitted to a normal distribution, the predetermined value can be the upper limit of the 68% or 95% confidence interval, and can be 1.1 times, 1.2 times, 1.3 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, 5 times, 7 times, 10 times, 15 times, or 20 times the mean or median value of the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the control subject. In an embodiment, the quantification of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject can be performed based on the measurement value (e.g., absorbance or fluorescence intensity) obtained by the above method instead of the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3, or can be performed based on comparison with a predetermined value of the measurement value obtained by the same method as above.

[0178] Another aspect of the present disclosure may be a method for treating Alzheimer's disease, the method comprising administering a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease to a subject determined to have a higher quantitative EDIL3 compared to a control in a method for assisting in the diagnosis of Alzheimer's disease, a method for collecting data for diagnosing Alzheimer's disease, or a method for diagnosing Alzheimer's disease according to an embodiment of the first aspect of the present disclosure. In an embodiment, the pharmaceutical composition or therapeutic agent in these cases may include a therapeutically effective amount of a substance that inhibits EDIL3 according to the second aspect of the present disclosure described later, and the substance that inhibits EDIL3 may be, for example, a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3. In addition, the pharmaceutical composition or therapeutic agent in these cases may include, for example, an anti-amyloid β antibody (e.g., an anti-amyloid β fibril antibody) or an agent that inhibits the production or accumulation of amyloid β in the brain.

[0179] The kit according to the first aspect of the present disclosure may further include instructions for use (package instructions), and the instructions for use may be in paper form or may be digitized. In an embodiment, the instructions for use may describe content corresponding to an embodiment of a method for assisting in the diagnosis of Alzheimer's disease, a method for collecting data for diagnosing Alzheimer's disease, or a method for diagnosing Alzheimer's disease according to the first aspect of the present disclosure.

[0180] <Second Aspect>

[0181] The second aspect of the present disclosure is a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, the pharmaceutical composition or therapeutic agent comprising a substance that inhibits EDIL3. An embodiment of the second aspect of the present disclosure is a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, wherein the substance that inhibits EDIL3 is a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3. A specific embodiment of the second aspect of the present disclosure is a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, the pharmaceutical composition or therapeutic agent comprising a therapeutically effective amount of a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

[0182] A "pharmaceutical composition" or "therapeutic agent" in this disclosure is understood to mean a substance that produces a desired effect in a tissue, animal, mammal, human or another subject.

[0183] In this disclosure, "treat" and its derivatives refer to therapeutic treatment. With respect to a particular condition, treatment means (1) ameliorating the condition or one or more biological signs of the condition, (2) interfering with (a) one or more points in the biological cascade that leads to or causes the condition or (b) one or more biological signs of the condition, (3) alleviating one or more symptoms, effects, or side effects associated with the condition, or one or more symptoms, effects, or side effects associated with the condition or its treatment, or (4) delaying the progression of the condition or one or more biological signs of the condition. As used herein, "delaying" the progression of Alzheimer's disease means delaying, preventing, decelerating, slowing, stabilizing, and / or prolonging the progression of the disease, and / or slowing its progression, or if the disease once develops, altering the underlying course and / or process. Depending on the history of the disease and / or the individual being treated, the delay can be for varying lengths of time. It will be apparent to one skilled in the art that sufficient or significant delay can include prevention so that the individual does not actually develop the disease. The method of "delaying" the progress of Alzheimer's disease is a method of reducing the probability of disease onset and / or reducing the degree of disease in a given time period, which includes stabilizing one or more symptoms caused by the disease (e.g., memory, problem solving, language, calculation, visual spatial perception, judgment and / or abnormal behavior, inability to take care of oneself) compared to not using the method. This comparison can be based on a clinical trial using a sufficient number of subjects to generally obtain statistically significant results. The progress of Alzheimer's disease can be detected using, for example, the following standard clinical techniques: standard neurological examinations, patient interviews, neuroimaging, changes in specific protein levels (e.g., amyloid peptides and / or tau) in serum or cerebrospinal fluid, computed tomography (CT), magnetic resonance imaging (MRI) and / or positron emission tomography (PET) brain imaging of amyloid or tau. "Progress" as used herein may also refer to the progress of a disease that may not be detected initially, and may include occurrence, recurrence, deterioration and / or onset.

[0184] In the present disclosure, "therapeutically effective amount" refers to an amount that effectively induces a desired biological or drug response in a tissue system, animal or human. In an embodiment, a therapeutically effective amount refers to an amount that effectively achieves a desired therapeutic outcome (e.g., improving or preventing symptoms or prolonging survival) at a necessary dose within a necessary time period. In an embodiment, a therapeutically effective amount is an amount that does not exceed the maximum tolerated dose.

[0185] The "pharmaceutical composition" or "therapeutic agent" disclosed herein can be administered by injection, oral administration, nasal administration, transdermal administration, pulmonary administration and eye drops, etc. Examples of injections include intravenous injection, subcutaneous injection, intradermal injection, intraarterial injection, and injections such as local injections to target cells or organs, and can be, for example, spinal injections. In the case of oral administration, examples of dosage forms of pharmaceutical compositions or therapeutic agents include tablets, powders, granules, syrups, capsules, and internal liquid preparations. In the case of parenteral administration, examples of dosage forms of pharmaceutical compositions or therapeutic agents include injections, drops, eye drops, ointments, suppositories, suspensions, pastes, lotions, aerosols, and plasters, and in an embodiment, the dosage form is an injection or drops. According to the pharmaceutical composition or therapeutic agent disclosed herein, it can be prepared by the method described in, for example, Japanese Pharmacopoeia 18 (JP), United States Pharmacopoeia (USP), or European Pharmacopoeia (EP).

[0186] The inventors have found that neurons exposed to EDIL3 in the cell surrounding environment show the phenotype of Alzheimer's disease. More specifically, the inventors have found that the density of the number of dendritic spines is observed to decrease in neurons exposed to EDIL3 in the cell surrounding environment. Therefore, without wishing to be bound by any theory, it is believed that if the amount of EDIL3 in the environment of neurons in a subject suffering from Alzheimer's disease can be reduced by a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3, then Alzheimer's disease can be treated by inhibiting a neurological dysfunction (e.g., abnormal neuronal morphology) that is a phenotype of Alzheimer's disease. That is, in an embodiment, the second aspect of the present disclosure can be a method for treating Alzheimer's disease, the method comprising applying a substance that inhibits EDIL3 to a patient in need, and in another embodiment, it can also be a method for treating Alzheimer's disease, the method comprising applying a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3 to a patient in need.

[0187] In the present disclosure, a substance that inhibits EDIL3 refers to a substance that can inhibit the effect of EDIL3 on neurons in an administered subject, and may be, for example, a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

[0188] The substance that inhibits the expression of EDIL3 is not particularly limited as long as it is a substance that can inhibit the expression of EDIL3 in the subject. In an embodiment, it can be a nucleic acid that inhibits the expression of EDIL3. Examples of nucleic acids that inhibit the expression of EDIL3 include antisense nucleic acids (ASO) or small interfering RNA (siRNA) targeting EDIL3. The base length of the nucleic acid contained in the antisense nucleic acid or siRNA is not particularly limited as long as it can inhibit the expression of EDIL3, and may be, for example, 5 bases or more, 8 bases or more, 10 bases or more, 13 bases or more, 15 bases or more, 17 bases or more, 18 bases or more, 19 bases or more, 20 bases or more, or 21 bases or more, and may be 100 bases or less, 70 bases or less, 50 bases or less, 40 bases or less, 35 bases or less, 30 bases or less, 27 bases or less, 25 bases or less, 24 bases or less, or 23 bases or less. Examples of base length ranges can be 5 to 100 bases, 8 to 70 bases, 10 to 50 bases, 13 to 40 bases, 15 to 35 bases, 17 to 30 bases, 18 to 27 bases, 19 to 25 bases, 20 to 24 bases, or 21 to 23 bases. In addition, the nucleic acid that inhibits the expression of EDIL3 according to the second aspect of the present disclosure (for example, antisense nucleic acid or siRNA) has a region complementary to the mRNA or cDNA encoding EDIL3 (complementary region), and the ratio of the sequence of the complementary region to the sequence of the binding site of the nucleic acid that inhibits the expression of EDIL3 of the mRNA or cDNA encoding EDIL3 can be 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more or 100% of the base sequence (number of bases) belonging to the complementary region, and in another embodiment it can be 90% or more, and in yet another embodiment it can be 100%. The base length of the complementary region in the nucleic acid for inhibiting the expression of EDIL3 according to the second aspect of the present disclosure is not particularly limited, and can be, for example, 5 to 100 bases, 8 to 50 bases, 10 to 40 bases, 12 to 35 bases, 13 to 30 bases, 14 to 27 bases, 15 to 25 bases, 16 to 24 bases, 17 to 23 bases or 18 to 22 bases. In addition, the nucleic acid for inhibiting the expression of EDIL3 according to the second aspect of the present disclosure may also have a region (additional region) that is not complementary to the sequence of the complementary region in addition to the complementary region. The additional region may be arranged at the 5' end and / or the 3' end of the nucleic acid, and the base length of the additional region may be, for example, 1 base, 2 bases, 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases or 10 bases.In these cases, the mRNA or cDNA encoding EDIL3 targeted by the antisense nucleic acid or siRNA is similar to that described in the first aspect of the disclosure.

[0189] The substance that promotes the degradation of EDIL3 is not particularly limited, as long as it is a substance that can promote the degradation of EDIL3 in the subject. In an embodiment, the substance that promotes the degradation of EDIL3 can be an anti-EDIL3 antibody or an antigen-binding fragment thereof. As such an anti-EDIL3 antibody or an antigen-binding fragment thereof, the anti-EDIL3 antibody and its antigen-binding fragment described in the first aspect of the present disclosure can be used.

[0190] In the present disclosure, inhibiting the function of EDIL3 refers to inhibiting the dysfunction of neurons caused by EDIL3. In the present disclosure, a substance that inhibits the function of EDIL3 refers to a substance that inhibits the dysfunction of neurons caused by EDIL3. The substance that inhibits the function of EDIL3 can be, for example, a compound that inhibits the function of EDIL3 (a compound targeting EDIL3), and the compound targeting EDIL3 can be a small molecule compound (e.g., a compound with a molecular weight of 1000 or less). In addition, the substance that inhibits the function of EDIL3 can be, for example, a small molecule compound, a nucleic acid, a peptide, or an anti-EDIL3 antibody or an antigen-binding fragment thereof that inhibits the dysfunction of neurons caused by EDIL3, and these substances can have binding properties with EDIL3 or EDIL3 binding sites in neurons or their related proteins.

[0191] The substance inhibiting EDIL3 according to the second aspect of the present disclosure may be, in an embodiment, a nucleic acid that inhibits the expression of EDIL3, an anti-EDIL3 antibody or an antigen-binding fragment thereof, or a compound against EDIL3, and in another embodiment may be a nucleic acid that inhibits the expression of EDIL3, or an anti-EDIL3 antibody or an antigen-binding fragment thereof.

[0192] According to a second aspect of the present disclosure, Alzheimer's disease can be treated by administering a substance that inhibits EDIL3 to a subject (e.g., a patient in need thereof). The subject according to the second aspect of the present disclosure is similar to the subject described in the first aspect of the present disclosure. The pharmaceutical composition or therapeutic agent according to an embodiment of the second aspect of the present disclosure can be used to treat a subject with an APOE4 genotype. The subject to be treated in the treatment method according to an embodiment of the second aspect of the present disclosure can be a human subject with an APOE4 genotype. In addition, the Alzheimer's disease according to the second aspect of the present disclosure is similar to the Alzheimer's disease described in the first aspect of the present disclosure.

[0193] As for the dosage of the substance inhibiting EDIL3 in the embodiment of the second aspect of the present disclosure, when the substance is administered to, for example, an adult human male (body weight: 60 kg), the daily dosage may be 0.0001 μg to 10000 mg / day / person in terms of the amount of the active ingredient.

[0194] The pharmaceutical composition or therapeutic agent according to the embodiment of the second aspect of the present disclosure may further comprise additional components in addition to the substance that inhibits EDIL3, and examples of such additional components include additives commonly used in the field of formulation technology, such as excipients, buffers, stabilizers, antioxidants, binders, disintegrants, fillers, emulsifiers and fluidizers.

[0195] <Third Aspect>

[0196] The third aspect of the present disclosure is a method for screening substances that inhibit EDIL3, the method comprising culturing neurons in a culture medium containing a test substance (i.e., contacting the test substance with the neurons and exposing the neurons to the test substance). According to the screening method according to the third aspect of the present disclosure, substances that inhibit EDIL3 are sorted out from the test substance. The substances that inhibit EDIL3 sorted out by the screening method according to the third aspect of the present disclosure may be substances that inhibit the expression of EDIL3, substances that promote the degradation of EDIL3, or substances that inhibit the function of EDIL3. The substances that inhibit EDIL3 sorted out by the screening method according to the third aspect of the present disclosure may be nucleic acids that inhibit the expression of EDIL3, anti-EDIL3 antibodies or their antigen-binding fragments, or compounds against EDIL3 in an embodiment. The compound against EDIL3 may be a small molecule compound. In addition, the neurons in the screening method according to the third aspect of the present disclosure may be neurons with an APOE4 genotype.

[0197] The inventors have found that when EDIL3 is present in an environment where neurons are present, a phenotype of Alzheimer's disease will occur, which is considered to be the cause of neuronal dysfunction. Therefore, without wishing to be bound by any theory, the substance that inhibits EDIL3 can exert a therapeutic effect on Alzheimer's disease by inhibiting EDIL3 in the subject to which the substance is applied. That is, in the third aspect of the present disclosure, the substance that inhibits EDIL3 can be a substance for treating Alzheimer's disease (a substance used as an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease), or it can be a substance that will be applied to a human subject with an APOE4 genotype and suffering from Alzheimer's disease. In these cases, "inhibiting EDIL3" and "substances that inhibit EDIL3" are defined in the same manner as described in the second aspect of the present disclosure.

[0198] The first embodiment of the third aspect of the present disclosure is a method for screening a substance that inhibits EDIL3, the method comprising: culturing neurons in a culture medium containing EDIL3 and a test substance; and detecting the phenotype of Alzheimer's disease from the neurons. In addition, the first embodiment of the third aspect of the present disclosure can be a method for screening an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, the method comprising: culturing neurons in a culture medium containing EDIL3 and a test substance; and detecting the phenotype of Alzheimer's disease from the neurons, and the pharmaceutical composition or therapeutic agent can be used for administration to a human subject having an APOE4 genotype.

[0199] In an embodiment, the screening method according to the first embodiment of the third aspect of the present disclosure comprises: culturing neurons in a culture medium containing EDIL3 and a test substance (exposure step); and detecting a phenotype of Alzheimer's disease from the neurons (detection step).

[0200] In the exposure step, neurons are exposed to EDIL3 in the presence of a test substance. Neurons are not particularly limited, but are preferably primary neurons or neurons derived from iPSC. Primary neurons are preferably primary neurons derived from mammals (e.g., humans, mice or rats). Neurons derived from iPSC are preferably neurons derived from iPSC prepared from cells of mammals (e.g., humans, mice or rats). The exposure step can be performed by culturing neurons in a culture medium in which EDIL3 and a test substance are added to a culture medium commonly used by those skilled in the art for culturing neurons. The concentration of EDIL3 and the test substance in the culture medium is not particularly limited, and a variety of culture media containing EDIL3 and a test substance at different concentrations (e.g., 0.01 μM, 0.1 μM, 1 μM, 10 μM and / or 100 μM) can be tested, and screening can be performed based on concentration dependence. The exposure time in the exposure step is not particularly limited as long as it is an exposure time that can detect the phenotype of Alzheimer's disease when exposed to the same concentration of EDIL3 in the absence of a test substance, and can be, for example, 1 day to 30 days, 2 days to 15 days, or 3 days to 10 days, and the culture conditions can be conditions commonly used by those skilled in the art (e.g., 37° C., 5% CO 2, and 100% humidity). The number of days in culture (DIV) of primary neurons as primary neurons used in screening is not particularly limited, and can be, for example, 1 to 50, 3 to 40, 6 to 30, 9 to 27, 11 to 25, 14 to 23, or 16 to 21.

[0201] The test substance in the screening method according to the third aspect of the present disclosure is not particularly limited, but can be a substance with low cell membrane permeability and can persist in the extracellular environment when applied to a human subject, because EDIL3 is a protein present in the extracellular matrix. The test substance in the screening method according to the third aspect of the present disclosure can be, for example, a test substance contained in a library composed of substances expected to have certain physiological activity (constructed). Examples of such libraries include a compound library containing small molecule compounds (e.g., a molecular weight of greater than or equal to 50 and less than or equal to 10000, or greater than or equal to 100 and less than or equal to 2000), a nucleic acid library (aptamer library) containing nucleic acids (e.g., 10bp to 100bp or 20bp to 50bp), a peptide library containing peptides (e.g., 4 residues to 50 residues or 6 residues to 20 residues), or an antibody library containing anti-EDIL3 antibodies or antigen-binding fragments thereof. All candidate substances contained in such a library can be used as test substances, and only some candidate substances preselected for cell membrane permeability, in vivo stability, in vivo kinetics, etc. can be used as test substances.

[0202] According to the first embodiment of the third aspect of the present disclosure, EDIL3 may be artificially synthesized. In addition, according to the first embodiment of the third aspect of the present disclosure, EDIL3 may be secreted by cells expressing EDIL3. Cells expressing EDIL3 may be cells expressing EDIL3 under physiological conditions, or may be cells overexpressing EDIL3 by transduction. However, from the viewpoint of exposing neurons to high levels of EDIL3 to easily cause morphological changes, thereby improving screening efficiency, cells are preferably cells overexpressing EDIL3 by transduction. That is, the first embodiment of the third aspect of the present disclosure may be a method for screening substances that inhibit EDIL3, the method comprising: introducing a nucleic acid for expressing EDIL3 into a cell or a microorganism; culturing the cell or microorganism; recovering a culture supernatant obtained by culturing the cell or microorganism; culturing neurons in a culture medium containing the recovered culture supernatant and a test substance; and evaluating the phenotype of Alzheimer's disease from the neuron. In this case, introducing a nucleic acid for expressing EDIL3 into a cell or microorganism; culturing the cell or microorganism; and recovering the culture supernatant obtained by culturing the cell or microorganism can be carried out according to methods commonly used by those skilled in the art, using materials and reagents commonly used in cell culture and transduction, as long as an effective amount of EDIL3 is secreted into the recovered culture supernatant.

[0203] In the detection step, the phenotype of Alzheimer's disease is detected and evaluated for the neurons exposed to EDIL3 in the presence of the test substance in the exposure step. As a result of the evaluation in the detection step, the test substance in which the phenotype of Alzheimer's disease in the neurons is not detected or the phenotype of Alzheimer's disease in the neurons is detected but the phenotype is suppressed is classified as a substance that inhibits EDIL3 or an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease.

[0204] The phenotype of Alzheimer's disease in the neuron is assessed in the detection step without particular limitation, as long as it can distinguish whether the phenotype can induce Alzheimer's disease based on the presence or absence of the phenotype or its degree, and can be, for example, the morphology, transcriptome, metabolite or proteome of the neuron, or in another embodiment, the morphology of the neuron can be assessed from a convenient perspective. When the phenotype of Alzheimer's disease in the neuron is assessed in the detection step, the neuron can be fluorescently labeled from a convenient perspective. The fluorescent label can be, for example, a fluorescent protein (e.g., GFP or DsRed) transduced and located on the cytosol or cell membrane, or a fluorescent protein is introduced into a cytoskeletal protein such as actin. The phenotype of Alzheimer's disease in the neuron can include, for example, detecting changes in the number (density) of spines in the neuron. The inventors have found that in primary neurons cultured in the presence of EDIL3, a decrease in the density of neuronal spines was observed.

[0205] As an example of the evaluation in the detection step, for example, a test substance in which the phenotype of Alzheimer's disease in neurons is not detected or the phenotype of Alzheimer's disease in neurons is detected but the phenotype is suppressed is classified as a substance that inhibits EDIL3 or an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease. In this case, the state of "the phenotype of Alzheimer's disease in neurons is not detected" can be determined by a method generally determined by those skilled in the art, and can be, for example, a state in which no qualitative phenotypic difference is found or no statistically significant quantitative phenotypic difference (for example, the density of dendritic spines) is found between the neuron and the neuron not exposed to EDIL3. Furthermore, the state of “the phenotype of Alzheimer's disease is detected in neurons but the phenotype is suppressed” can be determined by a method generally determined by those skilled in the art, and may be, for example, a state in which the phenotype of Alzheimer's disease (e.g., the density of dendritic spines) is statistically significantly detected compared to neurons not exposed to EDIL3, but the p-value between the neuron and the neuron not exposed to EDIL3 is smaller than the p-value between the neuron and the neuron exposed to EDIL3 in the absence of the test substance, or a state in which the phenotype of Alzheimer's disease is significantly suppressed (e.g., the reduction in the density of dendritic spines is significantly suppressed) compared to neurons exposed to EDIL3 in the absence of the test substance.

[0206] The second embodiment of the third aspect of the present disclosure is a method for screening a substance that inhibits EDIL3, the method comprising: culturing cells and neurons expressing EDIL3 in a culture medium containing a test substance (co-culturing cells and neurons expressing EDIL3, co-culturing step); and detecting the phenotype of Alzheimer's disease from the neurons (detection step). The second embodiment of the third aspect of the present disclosure can be a method for screening an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, the method comprising: culturing cells and neurons expressing EDIL3 in a culture medium containing a test substance; and detecting the phenotype of Alzheimer's disease from the neurons.

[0207] Except that the EDIL3 to which the neurons are exposed is EDIL3 secreted by cells expressing EDIL3, the second embodiment of the third aspect of the present disclosure can be performed in the same manner as the first embodiment of the third aspect of the present disclosure. That is, except that EDIL3 or a culture supernatant containing EDIL3 is not added to the culture environment of the neurons but the cells expressing EDIL3 are co-cultured, the co-culture step in the second embodiment of the third aspect of the present disclosure can be performed in the same manner as the exposure step according to the first embodiment of the third aspect of the present disclosure. At this time, the period of co-culturing cells and neurons expressing EDIL3 in the co-culture step is not particularly limited, as long as it is a period in which the phenotype of Alzheimer's disease can be detected when co-culture is performed in the same manner under the condition of the absence of the test substance, and can be, for example, 1 day to 30 days, 2 days to 15 days or 3 days to 10 days, and the culture conditions can be the conditions commonly used by those skilled in the art (e.g., 37°C, 5% CO2 and 100% humidity). Furthermore, the co-culture in the co-culture step can be performed, for example, by adhering each of the EDIL3-expressing cells and neurons to a culture container in a state of being spatially separated in advance using a culture insert, etc., and then culturing the two cells in the same culture medium by removing the culture insert, etc. The detection step in the second embodiment of the third aspect of the present disclosure can be performed similarly to the exposure step in the first embodiment of the third aspect of the present disclosure.

[0208] According to the second embodiment of the third aspect of the present disclosure, the cell expressing EDIL3 can be a cell expressing EDIL3 under physiological conditions or a cell in which EDIL3 is overexpressed by transduction. The cell expressing EDIL3 under physiological conditions can be, for example, a glial cell, and the glial cell can be, for example, an astrocyte. Transduction of EDIL3 in a cell in which EDIL3 is overexpressed by transduction can be performed according to the methods commonly performed by those skilled in the art using materials and reagents commonly used in transduction by those skilled in the art. The cell transduced with EDIL3 as described above is not particularly limited, and can be, for example, a glial cell such as an astrocyte, or can be a cultured cell line (cell line) that is widely and commonly subjected to protein transduction, such as HEK293 cells, HeLa cells (HeLa cell) or NIH3T3 cells.

[0209] A third embodiment of the third aspect of the present disclosure is a method for screening a substance that inhibits EDIL3, the method comprising: culturing cells expressing EDIL3 in a culture medium containing a test substance (contacting step); and evaluating the expression or secretion of EDIL3 (evaluating step).

[0210] As the cell expressing EDIL3 in the third embodiment of the third aspect of the present disclosure, the same cell as the cell expressing EDIL3 according to the second embodiment of the third aspect of the present disclosure can be used. The contacting step in the third embodiment of the third aspect of the present disclosure can be performed in the same manner as the exposing step according to the first embodiment of the third aspect of the present disclosure, except that the cell expressing EDIL3 is used as a cell replacing neurons and the cell expressing EDIL3 is not exposed to EDIL3 that is not derived from the cell expressing EDIL3.

[0211] In the evaluation step according to the third embodiment of the third aspect of the present disclosure, the evaluation of the expression or secretion of EDIL3 can be, for example, quantification of EDIL3 in mRNA encoding EDIL3, cDNA complementary to the mRNA, or in cells expressing EDIL3, cell fragmentation products (lysates) prepared from the cells, or culture supernatants in which the cells are cultured. As a specific example, it can be quantification of EDIL3 in a culture medium (culture supernatant of cells expressing EDIL3). In this case, quantification of EDIL3 can be performed using, for example, an anti-EDIL3 antibody or an EDIL3 binding fragment thereof. According to the third embodiment of the third aspect of the present disclosure, quantification of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 can be performed by the same method as described in the first aspect of the present disclosure.

[0212] In the evaluation step of the third embodiment according to the third aspect of the present disclosure, for example, when the expression or secretion of EDIL3 in the EDIL3-expressing cells (EDIL3-expressing cells to be evaluated) exposed to the test substance is lower than the expression or secretion of EDIL3 in the EDIL3-expressing cells (control) prepared in a similar manner but not in contact with the test substance, the test substance can be classified as a substance that inhibits EDIL3. For example, when the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the EDIL3-expressing cells exposed to the test substance is lower than the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the control, the test substance can be classified as a substance that inhibits EDIL3. As an example, when the average amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in cells expressing EDIL3 exposed to the test substance is 0.9 times or less, 0.8 times or less, 0.7 times or less, 0.6 times or less, 0.5 times or less, 0.4 times or less, 0.3 times or less, 0.2 times or less, or 0.1 times or less of the average amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the control, the test substance can be classified as a substance that inhibits EDIL3.

[0213] As used herein, the terms "comprising" or "including" are intended to be open and inclusive and do not exclude additional, undescribed features unless the context clearly dictates otherwise, and include the closed terms "consisting of" or "consisting essentially of.

[0214] Unless otherwise defined, all terms (technical and scientific terms) used herein have the same meaning as those widely understood by those skilled in the art to which the invention belongs. The terms used herein will be interpreted as having the same meaning as in this specification and the related art, and should not be interpreted in an idealized or overly formal sense unless a different definition is explicitly stated.

[0215] Examples

[0216] Hereinafter, the present disclosure will be described in more detail with reference to examples, but the present disclosure is not limited to the following examples. Hereinafter, induced pluripotent stem cells (iPS cells) are also referred to as iPSCs, and human astrocytes obtained by inducing iPSCs are also referred to as iPasts.

[0217] <Experimental methods>

[0218] Unless otherwise stated, the Examples were conducted according to the following Experimental Methods.

[0219] <Test Design>

[0220] The purpose is to elucidate the detailed molecular mechanisms of synaptic pathophysiology mediated by astrocyte APOE4 in Alzheimer's disease (AD). The inventors first generated a human astrocyte model (iPast) induced from isogenic iPSC expressing APOE3 or APOE4. After confirming that APOE3 / 3 and APOE4 / 4iPast showed overall astrocyte characteristics that were unrelated to genotype differences, a co-culture system of human iPast and mouse primary hippocampal neurons was established using a culture plug-in to study the effects of astrocyte factors on synaptic integrity. The hypothesis that APOE4 astrocyte toxic factors induce dendritic spine degeneration was confirmed. Two independent clones (#87 and #89) were used entirely for isogenic iPSCs carrying the APOE4 / 4 genotype. The sample size was selected based on the previous rich experience of iPast culture. For molecular / biochemical results, at least n=3 culture batches were used in each experimental genotype. Three batches of parental APOE3 / 3 iPast cultures and one batch of isogenic iPast cultures carrying each APOE4 / 4 genotype (#87-5, #87-8, #89-1, and #89-8) were used for transcriptome analysis. All animal experiments were performed in accordance with the National Institute of Health and Pharmaceutical Science and the Experimental Animal Guidelines of the Ministry of Education, Culture, Sports, Science and Technology and approved by the Keio University Institutional Animal Care and Use Committee in accordance with the same guidelines (approval number: 15093). Human ethics approval was obtained by the Keio University School of Medicine Ethics Committee (approval number: 20080016).

[0221] <Cultivation of Undifferentiated iPSCs>

[0222] Healthy control human iPSC line 201B7 (female Caucasian, 36 years old) was cultured in StemFit / AK02N (Ajinomoto) as feeder-free cultures. iPSCs were passaged every 7 days with 0.5×TrypLE select (Thermo Fisher Scientific) and cultured at 1.5×10 4Cells / wells were seeded in 6-well plates coated with 1.5 μg / ml iMatrix-511 silk (laminin-511E8, Nippi). The medium was changed every two days. For iPSC cultures on feeder cells, cells were maintained on SNL mouse fibroblast feeder cells treated with mitomycin C in human ESC culture medium in an atmosphere containing 3% CO2. The culture medium was: Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM / F12, Sigma), containing 20% ​​knockout serum replacement (KSR, Life Technologies), 0.1 mM non-essential amino acids (NEAA, Sigma), 0.1 mM 2-mercaptoethanol (Sigma) and 4 ng / ml fibroblast growth factor 2 (FGF-2, PeproTech).

[0223] <Statistical Analysis>

[0224] Data are expressed as mean ± standard error of the mean (mean ± SE). Statistical significance was defined as p < 0.05. Data were analyzed using R version 4.0.0 (The R Foundation) or Prism software (GraphPad Software, version 8.2.0).

[0225] <Construction of APOE targeting vector for gene editing>

[0226] In order to construct the targeting vector of the APOE allele, the genomic DNA of ax7111iPSC carrying APOE4 / 4 was first used as a template, and the primer pair 5'-GGGCTGCGTTGCTGGTCACATT-3' (SEQ ID NO: 27) and 5'-ACCCCATCTCCACACACACCAC-3' (SEQ ID NO: 28) was used to amplify the 3.36kb genomic DNA containing exons 3-4 by PCR and subcloned into the pCR-Blunt II-TOPO vector (Invitrogen). After sequence confirmation, the above plasmid was used as a template to amplify the 1.10kb left arm fragment (L1), 1.23kb right arm fragment (R1) and 0.47kb right arm fragment (R2) containing the third exon of the APOE gene by PCR, wherein the combined right arm contains the fourth exon of the APOE gene. For the left arm L1, the PCR primers used were 5'-CAACTTTGTATAATAAAGTTGAGTGCAGTGGCGGGA TCTCG-3' (SEQ ID NO: 11) and 5'-ATGATTATCTTTCTAGGGTTAA CGACAGGGGCAGAATGAAACC-3' (SEQ ID NO: 12), for the right arm R1, the PCR primers used were 5'-CAGACTATCTTTCTAGGGTTAACTGG GTCTCTGCTGGTTCTAGC-3' (SEQ ID NO: 13) and 5'-CGTGGGATCCCATGGCTGCAGGCTTCGGCGTTC-3' (SEQ ID NO: 14), and for the right arm R2, the PCR primers used were 5'-CCATGGGATCCCACGCCACCCCGTGCCTCCTG-3' (SEQ ID NO: 15) and 5'-CAACTTTGTATAGAAAAGTTGAGGAGTTTGAGACCTGCCTGG-3' (SEQ ID NO:16). These genomic fragments were used as 5'-(L1) and 3'-(R1 and R2) homology regions in the APOE target vector. The L1 fragment was subcloned into the HpaI site in the pENTR2-L3-HpaI-PBL-R1 plasmid (#403) using the In-Fusion HD Cloning Kit (Takara Bio). Both the R1 and R2 fragments were subcloned into the HpaI site in the pENTR2-R2-PBR-HpaI-L4 plasmid (#404) using the In-Fusion HD Cloning Kit.According to non-patent literature 11, a targeting plasmid was constructed by a modified multisite Gateway-based method. These plasmids carrying 5'- or 3'-targeting arms were confirmed by Sanger sequencing, and the Gateway LRClonase II enzyme mixture (Thermo Fisher Scientific) was used to assemble it with a selection marker cassette plasmid (#0102, pENTR-L1-PGK-puroΔTK-L2) into a backbone vector (#0042, pUC-DEST-R3R4). In order to select iPSC clones carrying the target allele, the selection marker cassette plasmid contains a puroΔTK (a fusion protein of puromycin N-acetyltransferase and a truncated form of herpes simplex virus type 1 thymidine kinase) cassette, which is flanked by two reverse terminal repeat (ITR) sequences to allow the puroΔTK gene to be removed by the piggyBac transposase.

[0227] To generate a plasmid expressing a single guide RNA (sgRNA) for APOE genome editing, the following oligonucleotides were annealed and inserted into the BbsI site of pSpCas9(BB)-2A-GFP (Addgene, PX458). This site can simultaneously express Streptococcus pyogenes Cas9 (SpCas9) and GFP. 5'-CACCGGCCCCCCAAGACTTAGCGAC-3' (SEQ ID NO: 17) and 5'-AAACGTCGCTAAGTCTTGGGGGGCC-3' (SEQ ID NO: 18) were used as oligonucleotides for APOE sgRNA1, and 5'-CACCGCGGGGTGGCGTGGGGTCGCA-3' (SEQ ID NO: 19) and 5'-AAACTGCGACCCCACGCCACCCCGC-3' (SEQ ID NO: 20) were used as oligonucleotides for APOE sgRNA2.

[0228] <Generation of isogenic iPSCs expressing APOE4 / 4>

[0229] To generate iPSCs carrying the targeted APOE4 / E4 allele, 201B7 iPSCs were electroporated with a targeting vector and two plasmids expressing sgRNAs. Puromycin was added to the culture at 1.0 μg / ml 48 h later, and surviving iPSC clones were picked after puromycin selection. Genomic DNA around the targeted region of a total of 36 iPSC clones was amplified by PCR using the primer pairs for APOE genomic cloning as shown above, which primer pairs included two homologous recombination arms. Next, nested PCR was performed using the primer pair 5'-AAGAAGCATTTGTGGAGCACC-3' (SEQ ID NO:21) and 5'-TGAATCTTTATTAAACTAGG-3' (SEQ ID NO:22), which primer pair included two sgRNA target sequences. Nine iPSC clones had undergone correct homologous recombination in both alleles, generating a 4795-bp band representing the target allele. These homozygous clones were further analyzed by digestion with the de novo BamHI site on the sgRNA2 sequence. Three of the 9 iPSC clones were confirmed to carry the de novo BamHI site on both alleles. In addition, APOE4 / 4 was verified by sequencing the target allele in 2 clones (#87 and #89). To generate iPSCs carrying the authentic APOE4 / 4 allele, the selection cassette was removed by introducing a plasmid expressing only the piggyBac transposase (PBx) into the established target clones, and selection was performed by treatment with 10 μM ganciclovir for 10 days. Finally, two successful APOE4 / 4 clones were obtained from each target clone (#87-5, #87-8, #89-1, #89-8).

[0230] <iPSC-derived astrocytes (iPast) induction>

[0231] iPSC colonies were cultured overnight in suspension in the absence of FGF-2 but containing 10 μM Y-27632 (Nacalai, San Diego, CA, USA) to form embryoid bodies (EBs) in a humidified atmosphere of 3% CO2. Starting from the next day, the EBs were suspended in EB medium (DMEM / F12 supplemented with 5% KSR, 1% L-glutamine, 0.8% NEAA, 0.1 mM 2-mercaptoethanol, and penicillin / streptomycin) to enhance differentiation into the neural lineage. The medium contained: Days 1 to 3: 3 μM SB431542 (Sigma) and 3 μM CHIR99021 (Focus Biomolecules); Days 4 to 7: 1 μM retinoic acid (Sigma); and Days 7 to 16: 1 μM retinoic acid and 1 μM purmorphamine (Cayman, Tokyo, Japan). On Day 16, the EBs were dissociated for suspension culture in neural sphere medium at a density of 1 to 4 × 10 5 cells / mL in a humidified atmosphere of 5% CO2. The neural sphere medium consisted of a medium hormone mixture (MHM) supplemented with 2% B-27 (Nacalai), 0.8% NEAA, 1 μM purmorphamine, 20 ng / mL FGF-2, and 10 ng / mL epidermal growth factor (EGF, PepTech). The medium was changed every 4 to 6 days to form primary neural spheres. On Day 32, the primary neural spheres were dissociated and cultured at a density of 1 to 4 × 10 5 cells / mL in neural sphere medium without purmorphamine. On Day 48, the secondary neural spheres were dissociated and cultured at a density of 4 × 10 5 to 1 × 10 6 cells / well in a 6-well plate coated with Matrigel (Corning) in iPast differentiation medium, which consisted of MHM supplemented with 2% B-27, 0.8% NEAA, 10 ng / mL brain-derived neurotrophic factor (BDNF, R&D), and 10 ng / mL glial cell line-derived neurotrophic factor (GDNF, Alamone). The medium was changed every 7 days. In almost confluent cultures, the iPast were dissociated into single cells using cell dissociation solution (accutase) (Nacalai), and the dissociated cells were passaged at a density of approximately 1 × 10 6 cells / well in a 6-well plate coated with Matrigel.

[0232] <iPast Culture and A1 Reactivity Induction>

[0233] Unless otherwise stated, iPast was maintained in iPast-differentiation medium. During moderate passage times of 7 to 15, iPast cultures were collected for analysis. iPast was also stored in serum-free CellBanker (registered trademark) 2 (Zenoaq, Japan). A1-like phenotype was induced by treating iPast for 24 hours with TIC mixture (30ng / ml TNFα (AF-300-01A, Pipetech), 3ng / ml IL-1α (200-01A, Pipetech), 400ng / ml C1q (PRO-554L, Prospec)) in DMEM / F12 medium.

[0234] <Karyotype analysis>

[0235] G-banding analysis of iPSC lines was performed by LSI Medical Corporation (Tokyo, Japan).

[0236] <Quantitative Reverse Transcription-PCR (qRT-PCR)>

[0237] Total RNA was purified using RNeasy Mini Kit (QIAGEN) and reverse transcribed in the presence of random hexamers. qPCR reactions were performed using TB Green Premix Ex Taq II (TAKARA BIO Inc.) in the ViiA7 system (Applied Biosystems) with cDNA and gene-specific primers. At least three independent cultures were analyzed and the threshold cycle (Ct) values ​​of interest were normalized to the value of GAPDH. The primer sequences for EDIL3 and GAPDH are as follows:

[0238] EDIL3: 5'-AGCATACCGAGGGGATACATT-3' (SEQ ID NO: 9)

[0239] and 5'-CAAGGCTCAACTTCGCATTCA-3' (SEQ ID NO:10)

[0240] GAPDH: 5'-AGGCTGAGAACGGGAAGCTT-3' (SEQ ID NO: 23)

[0241] and 5'-ACTCCACGACGTACTCAGCG-3' (SEQ ID NO: 24)

[0242] <Construction of expression plasmid>

[0243] For plasmids expressing human EDIL3 under the CAGGS promoter, the PCR product was first subcloned into the XbaI-EcoRI of the pCAGGS vector and then verified by sequencing. Human EDIL3 cds fragment (1446 base pairs) was amplified from human brain cDNA using specific primers with the following sequences: 5'-ATTTCTAGAATCATGAAGCGCTCGGT AGC-3' (SEQ ID NO: 25) and 5'-TAAGAATTCTCATTCCTCCTCTG TGCAGC-3' (SEQ ID NO: 26).

[0244] <Western blot analysis>

[0245] The cultured cells were homogenized in RIPA buffer (50 mM Tris-Cl (pH 7.6), 150 mM NaCl, 0.5 mM EDTA, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, complete protease inhibitor cocktail (Roche), 1 mM PMSF). Equal amounts of cell lysate (10 to 20 μg per lane) or culture medium were separated in an Extra PAGE One Precast Gel (Nacalai tesque Inc.) and transferred to a PVDF membrane. The membrane was blocked in 5% skim milk / TBS for 1 hour and incubated with specific primary antibodies as follows: goat anti-ApoE (1:1000, AB947, Millipore), rabbit anti-EDIL3 (1:1000, ab190692, Abcam), mouse anti-actin (1:10000, A1978, Sigma). The membrane was then incubated with IRDye 800CW or IRDye 680 labeled secondary antibodies (LI-COR Bioscience). The signal was developed and quantified using the Odyssey infrared imaging system (LI-COR Bioscience).

[0246] <Immunocytochemistry>

[0247] Fix iPast or iPSC cultures in a multi-well plate with 4% paraformaldehyde, block with a solution containing 5% FBS and 0.1% Triton X-100 for 1 h at room temperature, and incubate overnight at 4 °C with the indicated primary antibodies. The following primary antibodies were used: rat anti-GFAP (1:500, #13-0300, Thermo Fisher Scientific), mouse anti-S100β (1:500, S2532, Sigma-Aldrich), mouse anti-CD44 (1:200, MA5-13890, Thermo Fisher Scientific), rabbit anti-MAP2 (1:200, AB5622, Millipore), or mouse anti-SSEA-4 (1:500, Abcam, ab16287). Then wash the cultures in phosphate-buffered saline and incubate with the appropriate Alexa Fluor (405, 488, 555, or 647)-conjugated secondary antibody (Invitrogen) for 1 h at room temperature. Detect signals by LSM 700 confocal microscopy (Carl-Zeiss).

[0248] <Enzyme-linked immunosorbent assay (ELISA) for APOE>

[0249] Maintain iPast cultures in 12-well plates for 3 to 7 days. Centrifuge the collected media to remove insoluble materials and store at -80 °C until analysis. Lyse the remaining cells in RIPA buffer and measure protein concentration by BCA protein assay (Pierce). Coat a 96-well plate overnight at 4 °C with ApoE antibody (AB947, Millipore) in 0.1 M carbonate buffer. Block the plate with 1% non-fat milk in PBS and then wash 3 times with PBST. Use recombinant apoE3 (PeptideTech) as a standard for ELISA quantification. Dilute the samples appropriately and incubate overnight at 4 °C. Wash the plate and incubate with biotin-conjugated goat anti-ApoE antibody (1:10,000, Meridian Life Science) for 2 h at room temperature. After incubating with streptavidin-horseradish peroxidase (1:1,000, Fitzgerald Industries) for 90 min at room temperature, develop the plate by adding tetramethylbenzidine Super Slow substrate (T5569, Sigma-Aldrich) for approximately 5 min. Terminate the reaction with 1 M H2SO4 and read at 450 nm with an iMark microplate reader (Bio-Rad). Normalize each APOE concentration by the protein level of the culture.

[0250] <Size-exclusion chromatography (SEC)>

[0251] The approximately 8 ml of iPast medium incubated in a 10-cm culture dish for 7 days was concentrated using an ultrafiltration centrifugal tube (Amicon Ultra Ultracel-30K) (30 kDa cut-off value, Millipore). The concentrated medium (about 0.7 ml) was loaded onto a Superdex 200 Increase 10 / 300 GL column (GE Healthcare). The column was developed with a phosphate buffer containing 50 mM sodium phosphate (pH 7.4) and 150 mM NaCl at a flow rate of 0.5 ml / min. The eluate was monitored at 280 nm, and 0.5-ml fractions were collected. As described above, small aliquots of each fraction were analyzed by ELISA.

[0252] <Immunoprecipitation of APOE particles>

[0253] Streptavidin-conjugated agarose beads (Sigma) were incubated with biotin-conjugated goat anti-ApoE antibody (K74180B, MyBioSource) by shaking at room temperature for 2 h. The anti-ApoE-agarose beads were mixed with iPast conditioned medium at 4 °C overnight. After washing, the agarose beads were resuspended in 100 μl of TBS containing 0.1% Triton X-100. The amount of cholesterol dissolved in the supernatant was measured by Amplex Red cholesterol assay (Invitrogen). In addition, the beads were suspended in 100 μl of 0.1 M glycine buffer (pH 2.5) and then immediately neutralized with Tris-HCl (pH 8.8). The amount of APOE in the mixture was measured by APOE ELISA. The amount of APOE-related cholesterol was determined by dividing the total cholesterol amount by the total APOE amount in the eluate.

[0254] <Intracellular lipid staining>

[0255] To measure neutral lipid accumulation, iPast was used at 1×10 4Cells were seeded at a density of 10 cells / well on 96-well microplates μCLEAR (Greiner, Cat#655096) coated with 5% Matrigel (Corning) in PBS. iPast was incubated in DMEM / F12 supplemented with 2% FBS (Sigma) for 2 weeks. iPast was treated with dimethyl sulfoxide (DMSO) or oleic acid (OA) (final 200 μM) in culture medium for 16 hours at 37°C. For staining of neutral lipids, iPast was treated with LipiBlue (final 0.1 μM, DOJINDO), Calcein-AM (final 1 μg / mL, DOJINDO), DRAQ5 (final 5 μM, Cosmo Bio) in culture medium at 37°C for 1 hour. Then, iPast was washed twice with DMEM / F12 and fixed with 4% paraformaldehyde in PBS at 4°C for 16 hours. Fixed cells were imaged using an IN Cell Analyzer 6000 (Cytiva); a 4×4 field of view was collected from each well using a 20× objective. Images were analyzed using the In Cell Developer Toolbox version 1.9.2 (Cytiva). Round lipid particles stained with LipiBlue in calcein-AM positive cells were counted. Round or oval nuclei stained with DRAQ5 were counted to identify the number of cells.

[0256] <Mouse primary hippocampal neuron culture>

[0257] Hippocampi from wild-type C57BL / 6J pups were dissected and treated with 0.25% trypsin at 37°C for 12 min. Cells were plated at 65,000 cells / cm 2 The cells were seeded at a density of 1.5-1.5 μg / cm2 on 12-mm coverslips (Costar) coated with poly-D-lysine (Sigma). Primary hippocampal neurons were cultured in Neurobasal medium (Thermo Fisher Scientific) supplemented with 1% B27 and 1×GlutaMAX until DIV 16 to 21 for further molecular and morphological analysis.

[0258] <Neuron morphology analysis>

[0259] Primary neurons were sparsely transfected with a plasmid expressing actin-EGFP (generously provided by Dr. Bito) together with a plasmid expressing DsRed protein using Lipofectamine 2000 (Thermo Fisher Scientific) on DIV 5 to 6. During the last 4 to 6 days, approximately 1×10 neurons were co-cultured using Transwell 0.4 μm membrane inserts (Corning). 5 iPast cells. The cultures were fixed with 4% paraformaldehyde, permeabilized, blocked, and incubated with chicken anti-GFP (1:1000, aveslab, GFP-1010) and rabbit anti-RFP (1:500, MBL, PM005) antibodies at 4°C overnight. The samples were then washed and incubated with the appropriate Alexa Fluor 488 or 555-conjugated secondary antibodies (Invitrogen) for 1 h at room temperature. After washing with PBS, coverslips were mounted on slides with ProLong Gold AntiFAde ReAgent (Invitrogen). GFP-positive neurons were imaged with an LSM 700 confocal microscope using a 63× lens. Each of these images was acquired in a z-stack at 0.5-μm intervals, with an average of 6 to 8 sections per z-stack. The number of spines on secondary or tertiary neurites was counted using ImageJ software (NIH), and spine density was calculated by dividing the number of spines by the neurite length. DsRed signals were acquired by confocal microscopy with a 10x lens. Neurite complexity was analyzed using Sholl analysis using the ImageJ plug-in.

[0260] <Mass spectrometry>

[0261] iPast was maintained in the same iPast-differentiation medium except that phenol red-free medium was used. Proteins in the conditioned medium were denatured with 2M urea in 100mM Tris-HCl pH 8.5 by sonication on ice for 10 minutes, reduced and alkylated with 10mM tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) and 40mM 2-chloroacetamide (FUJIFILM Wako), and digested overnight with 0.5μg LysC and 0.5μg trypsin. The resulting peptides were purified using a reverse phase SDB-XC StageTip. After tandem mass tag (TMT) labeling, the labeled peptides were fractionated into nine fractions using a high pH reverse phase peptide fractionation kit (Thermo Fisher Scientific), with the eluent containing the following concentrations of ACN: 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 35%, and 60%.

[0262] An LC / MS / MS system including an UltImate 3000RSLCnano pump (Thermo Fisher Scientific) and an Orbitrap Fusion Lumos triple mass spectrometer (Thermo Fisher Scientific) equipped with a FAIMSpro interface (Thermo Fisher Scientific) was used. All fractions were divided into four parts and analyzed by measuring four times with different FAIMS compensation voltages of -40, -55, -70 and -85. Peptides were injected by HTC-PAL autosampler (CTC Analytics), loaded on a 15 cm fused silica emitter filled with 3 μm ReproSil-Pur C18-AQ (Nikkyo Technos), and separated by the following linear gradient (solvent A, 0.1% formic acid; solvent B, 0.1% formic acid in 80% ACN): for fractions 1 to 4, 5 to 10% B in 5 minutes, 10 to 30% B in 70 minutes, 30 to 99% B in 5 minutes, and 99% B in 10 minutes; for fractions 5 to 9, 5 to 15% B in 5 minutes, 15 to 35% B in 70 minutes, 35% to 99% B in 5 minutes, and 99% B in 10 minutes. The flow rate was set to 300 nL / min. Peptides were ionized at 2,000 V. All MS1 spectra were obtained in the range of 400 to 1600 m / z in an Orbitap analyzer with a resolving power of 120,000. For subsequent MS / MS analysis, precursor ions were selected and isolated in the highest speed mode (cycle time = 3 seconds, isolation window = 1.4 m / z), activated by collision-induced dissociation (collision energy = 35), and detected in turbo mode in the ion trap analyzer. For TMT-reporter ion quantification, MS3 scans were performed in synchronous precursor scan mode by isolating the first 10 strong fragment ions. In all scans, the maximum injection time was set to "automatic". In MS and MS2 scans, the AGC target value was set to "standard", and in MS3 scans it was set to 250%. The dynamic exclusion time was set to 30 seconds.

[0263] LC / MS / MS raw data were processed using MaxQuant (v.1.6.17.0). Database searches were performed against the UniprotKB / SwissProt (March 2019) human database including isoforms, which was linked to the human APOE4 sequence. The following parameters were applied: 10-plex TMT quantification at the MS3 level, a precursor mass tolerance of 4.5 ppm, a fragment ion mass tolerance of 0.5 Da, and a minimum peptide length of 7 amino acids. Cysteine ​​carbamidomethylation was set as a fixed modification, while methionine oxidation and acetylation on the N-terminus of the protein were allowed as variable modifications. The false discovery rate was estimated by searching the reverse bait database and filtered to <1% at the peptide spectrum match and protein level. TMT reporter intensities were log2 transformed and normalized by the trimmed mean method of M values.

[0264] <Transcriptome analysis>

[0265] Total RNA was purified using RNeasy Mini Kit or RNeasy Micro Kit (Qiagen). RNA quality was assessed using Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). According to the protocol detailed by Affymetrix, a total of 500 ng of RNA was reverse transcribed, biotin labeled, and hybridized to Clariom S array (Affymetrix, USA). Each data was obtained from iPast of APOE3 / 3 (201B7, n = 3 independent culture batches) and APOE4 / 4 (#87-5, #87-8, #89-1, #89-8, n = 4 lines in total). The raw data were normalized using the robust multi-chip analysis (RMA) algorithm. PCA and cluster heat map analysis were performed on differentially expressed genes with logFC>0.5 or logFC<-0.5 (FDR p value <0.05).

[0266] <Knockdown of EDIL3>

[0267] The plasmids used for lentiviral production are: pENTR4-H1, pCS-RfA-CG, pCMV-VSV-G and pCAG-HIVgp. These plasmids are provided by the RIKEN BRC through the National Bioresource Project of the Ministry of Education, Culture, Sports, Science and Technology of Japan (No. RDB04395, RDB04390, RDB04392 and RDB04394). Knockdown lentiviral shuttle vectors were produced by inserting siRNA oligo DNA into the donor plasmid pENTR4-H1. Using the Gateway system, the target sequence of the shRNA designed for human EDIL3mRNA in the shuttle vector for knockdown (5'-GTGGAATATGTACAGATCT-3', SEQ ID NO: 29) and the non-functional shRNA in the negative control (5'-TAAGGTTAAGTCGCCCTCG-3', SEQ ID NO: 30) are each recombined into the lentiviral shuttle plasmid pCS-RfA-CG. All constructs were confirmed by Sanger sequencing. According to the method described in Non-Patent Document 13, these shuttle plasmids were packaged into self-inactivating lentivirus.

[0268] <Preparation of human brain tissue>

[0269] Human postmortem brain tissue was obtained from the Brain Bank for Aging Research (BBAR) and the Institute of Gerontology, Tokyo Metropolitan Geriatric Hospital, according to the approval of the Institutional Review Board (approval number: R21-125). All AD cases met the criteria for a definitive diagnosis of AD by the Consortium to Establish a Registry for Alzheimer's Disease (CERAD). The parietal gray matter [BA = 39 / 40] of four AD patients and two healthy controls was analyzed.

[0270] <Immunohistochemical staining and quantitative analysis of human brain tissue>

[0271] Brain tissue was fixed with 4% paraformaldehyde, embedded in paraffin, and cut into 6 μm thick sections. After dewaxing, the brain sections were immersed in target recovery solution (S1699, DAKO) and boiled in a microwave oven for 10 minutes. After blocking with PBS containing 3% goat normal serum and 1% bovine serum albumin, the sections were incubated with rabbit anti-EDIL3 antibody (1:200, #12580-1-AP, Proteintech), rat anti-GFAP antibody (1:500, #13-0300, Thermo Fisher Scientific) and mouse anti-Aβ antibody (1:200, 12B2, IBL) in blocking solution at 4 ° C overnight. The sections were then washed three times in PBS for 5 minutes and then incubated in the dark with Alexa Fluor (488, 555 or 647) conjugated secondary antibodies (Invitrogen) at room temperature in PBS containing 3% goat normal serum for 2 h. The cell nuclei were counterstained with Hoechst 33342. The fluorescence signals were detected by LSM 700 confocal microscope (Carl Zeiss).

[0272] Histological analysis was performed by the following method. A concentric ring was set outside the amyloid plaque using ImageJ to increase the radius of the amyloid plaque by 10 μm. For each concentric ring, the number of astrocytes (cells positive for both GFAP and Hoechst 33342) was counted manually, and the astrocyte rate was calculated by dividing the number of astrocytes by the total number of cells (Hoechst 33342-positive nuclei). To obtain the EDIL3 accumulation level, the EDIL3 fluorescence intensity of the plaque area and the radioactive central ring was calculated. In each group, a total of 13 plaques in the postmortem brains of at least 2 AD patients were analyzed in each group.

[0273] <Example 1: Preparation of isogenic iPSC-derived astrocytes carrying the APOE4 / 4 variant>

[0274] Isogenic iPSC-derived astrocytes carrying the APOE4 / 4 variant were prepared according to the methods described in the Experimental Methods section.

[0275] First, isogenic iPSCs carrying the APOE4 / 4 variant were generated. Figure 1 Shown is an overview of the method used to generate an allele in which the gene encoding APOE4 is knocked into the APOE3 allele (wild-type allele). Figure 2 The results of gel electrophoresis analysis after amplification of genes of five iPSC clones (#86 to #90) into which the generated alleles were introduced by PCR are shown. Molecular weight bands corresponding to the targeting vector used for generation were detected in two clones #87 and #89 among the five clones #86 to #90. In addition, as Figure 3The sequencing results shown show that the 112th amino acid in #80, which is a control iPSC with a homozygous APOE3 / 3 genotype, is cysteine, while the 112th amino acid in the two clones #87 and #89 is arginine, which corresponds to the sequence of APOE4. Based on these results, the two clones #87 and #89 were selected as iPSCs with an APOE4 / 4 genotype.

[0276] iPSCs with the APOE4 / 4 genotype were then induced into astrocytes. Figure 4 An overview of the method for inducing iPSCs into astrocytes is shown. Figure 5 Representative morphologies of astrocytes derived from iPSCs having the APOE4 / 4 genotype (E4 / E4 (#87-5)) and astrocytes derived from 201B7, which is an iPSC having the APOE3 / 3 genotype, (E3 / E3 (201B7)) obtained by this induction process are shown. In addition, for astrocytes obtained by this induction process (iPast), Figure 6 shows a fluorescent image when astrocyte markers S100β, GFAP, and CD44 were immunofluorescently stained and cell nuclei were stained with Hoechst, and Figure 7 The fluorescence intensity of S100β, GFAP and CD44 in the fluorescence image is shown (mean ± SE, n = 3 to 6, ns: not significant). As shown above, the cells induced into astrocytes from iPSCs having the APOE4 / 4 genotype showed the same morphology and marker expression as the cells induced into astrocytes from 201B7, which is an iPSC having the APOE3 / 3 genotype, thereby revealing that iPSCs having the APOE4 / 4 genotype are induced into astrocytes.

[0277] <Example 2: Study on the expression level of apoE protein in astrocytes derived from iPSCs having the APOE4 / 4 genotype>

[0278] For astrocytes (iPast) derived from iPSCs having an APOE4 / 4 genotype generated in Example 1, the gene amounts and expression levels of various proteins including the APOE protein were examined by the methods described in the Experimental Methods section. Figure 8 The results of measuring the expression levels of mRNA encoding APOE protein (APOE), astrocyte marker S100β and β-actin (ACTB) are shown. Figure 8 No significant difference in the expression level of mRNA encoding APOE protein was found between iPast with APOE4 / 4 genotype and iPast with APOE3 / 3 genotype. Fig. 9The results of quantification of the expression levels of APOE protein and β-actin expressed by each iPast by Western blotting as shown in the figure show that the expression level of APOE protein in iPast with APOE4 / 4 genotype was reduced to about 50% of that in iPast with APOE3 / 3 genotype, and the difference in expression levels between the two was significant (in Fig. 9 In the table, * indicates p value less than 0.05).

[0279] Subsequently, since APOE is a protein secreted outside the cell, the amount of APOE in the culture medium of each iPast was studied. The results of studying the amount of APOE by ELISA are shown in Fig.10 In. According to Fig.10 , the amount of APOE secreted by iPast with APOE4 / 4 genotype was low, but there was no significant difference from the amount of APOE secreted by iPast with APOE3 / 3 genotype. Specifically, the amount of APOE secreted by iPast derived from 201B7 was 16.78±3.82ng / μg, the amount of APOE secreted by iPast derived from clone #87 was 7.36±1.75ng / μg, and the amount of APOE secreted by iPast derived from clone #87 was 13.37±2.65. In Dunnett's test, the p-value between iPast derived from 201B7 and iPast derived from clone #87 was 0.06, and the p-value between iPast derived from 201B7 and iPast derived from clone #89 was 0.59. Fig.11 As shown in the results of mass spectrometry analysis of fragments obtained by treating APOE with trypsin, fragments derived from APOE3 were detected mutually exclusively from the culture medium of iPast having the APOE3 / 3 genotype, and fragments derived from APOE4 were detected mutually exclusively from the culture medium of iPast having the APOE4 / 4 genotype. From the above description, it can be seen that the amount of APOE secreted from iPast having the APOE4 / 4 genotype is lower than the amount of APOE secreted from iPast having the APOE3 / 3 genotype, although the difference is not significant.

[0280] <Example 3: Study on neuronal morphological changes of neurons co-cultured with iPast>

[0281] Based on the results of Example 2, in order to clarify the effect of iPast secretion on neuronal morphology, iPast with APOE4 / 4 genotype or iPast with APOE3 / 3 genotype was co-cultured with mouse primary neurons, and their morphological changes were studied.

[0282] Fig.12is a diagram showing the overview of co-culture of iPast with APOE4 / 4 genotype or iPast with APOE3 / 3 genotype with mouse primary neurons. In the co-culture system, iPast was cultured in a culture insert. Fig.13 In the representative fluorescence images shown, fluorescence of dendritic spines can be clearly observed in mouse primary neurons transfected with actin-GFP. Fig.14 shows fluorescent images of dendrites of mouse primary neurons co-cultured with iPast having an APOE4 / 4 genotype or iPast having an APOE3 / 3 genotype, and Fig.15 The number of dendritic spines observed per μm of dendrite is shown. Fig.15 In the table, * indicates that the p-value in the Tukey test is less than 0.05, and *** indicates that the p-value in the Tukey test is less than 0.001. Interestingly, the density of dendritic spines was significantly reduced in primary neurons co-cultured with iPast with the APOE4 / 4 genotype. Fig.16 As shown, when observing the shape of dendritic spines, mature mushroom-type spines were significantly reduced, while immature filopodial spines were significantly increased. These results show that the morphological changes observed in this example are larger than the difference in the amount of secreted APOE in Example 2, indicating that the reduction in dendritic spines of primary neurons in the presence of iPast with an APOE4 / 4 genotype is caused by another secretion other than the APOE protein.

[0283] <Example 4: Searching for mRNAs with altered expression levels in iPast with APOE4 / 4 genotype>

[0284] To elucidate the molecular mechanism of the reduction of dendritic spines in primary neurons in the presence of iPast with APOE4 / 4 genotype, total RNA was used to search for genes with different expression levels between iPast with APOE4 / 4 genotype and iPast with APOE3 / 3 genotype by microarray analysis (transcriptome analysis). The analysis was performed according to the method described in "transcriptome analysis" in the experimental methods section.

[0285] Fig.17 The results of the cluster analysis are shown as a heat map of z scores (scores obtained by normalizing logFC so that the mean is 0 and the standard deviation is 1) of logFC (fold change) of iPast with APOE4 / 4 genotype relative to iPast with APOE3 / 3 genotype. Fig.18 The results of principal component analysis (PCA) of the transcriptomes of iPast having the APOE3 / 3 genotype and iPast having the APOE4 / 4 genotype are shown. Fig.19 yes Fig.17These results reveal that iPast with the APOE3 / 3 genotype has similar but different transcriptomes from iPast with the APOE4 / 4 genotype. Fig. 20 As shown, among the mRNAs found, the expression levels of CDKN1A and EDIL3 were increased in iPast with APOE4 / 4 genotype, and β-actin (ACTB) was also quantified by quantitative reverse transcription PCR (qRT-PCR) as an indicator of cell number, and it was confirmed that its expression level was increased in iPast with APOE4 / 4 genotype compared with that in iPast with APOE3 / 3 genotype.

[0286] <Example 5: Study on the expression level of immune-related genes>

[0287] Among the mRNAs whose expression levels were found to vary between iPast having an APOE3 / 3 genotype and iPast having an APOE4 / 4 genotype in Example 4, the expression levels of immune-related genes known to be associated with the progression of Alzheimer's disease were examined in detail. Fig.21 and Fig. 22 The results of measuring the expression levels of genes known to be specifically expressed in pan-reactive, A1-like reactive (A1-specific) or A2-like reactive (A2-specific) astrocytes by the same method as in Example 4 are shown. According to these results, no significant difference was found between iPast with APOE3 / 3 genotype and iPast with APOE4 / 4 genotype in the markers of pan-reactive and A2-like reactive astrocytes, while in the markers of A1-like reactive astrocytes, an increase in expression level was found in iPast with APOE4 / 4 genotype. However, the increase was less than the degree of neuronal morphological changes found in Example 3, indicating that genes other than the immune-related genes examined in Example 4 are related to neuronal morphological changes obtained by co-culturing with iPast with APOE4 / 4 genotype.

[0288] <Example 6: Searching for secretion of iPast with APOE4 / 4 genotype that causes neuronal morphological changes>

[0289] The secretion of iPast with the APOE4 / 4 genotype caused morphological changes in neurons generated by co-culture with iPast with the APOE4 / 4 genotype. Fig.23As shown, four genes: EDIL3 (EGF-like repeat discoidin domain 3), GPC6 (Glypican 6), FAM20C (family with sequence similarity 20 member C), and MACROD2 (mono-ADP ribose hydrolase 2) were found to be common genes of the 119 mRNAs found in Example 4 and the 491 genes (AD GWAS genes, AD SNPs) found in the genome-wide association analysis in Non-Patent Document 12, wherein the RNA amount in these 119 mRNAs was increased in iPast with APOE4 / 4 genotype compared with that in iPast with APOE3 / 3 genotype, and these 491 genes are genes whose single nucleotide polymorphisms may be associated with Alzheimer's disease. Subsequently, regarding EDIL3 among them, the amount of EDIL3 protein in the iPast lysate and the medium (CM) in which iPast was cultured was evaluated by mass spectrometry analysis. As Fig.24 As shown in Figure 2, the expression level and secretion level of EDIL3 in iPast with APOE4 / 4 genotype were significantly higher than those in iPast with APOE3 / 3 genotype. In addition, as a result of lysing iPast and evaluating the expression level of EDIL3 protein by Western blotting, as shown in Figure 2, the expression level and secretion level of EDIL3 in iPast with APOE4 / 4 genotype were significantly higher than those in iPast with APOE3 / 3 genotype. Fig.25 As shown in Figure 2, the expression level of EDIL3 in iPast with APOE4 / 4 genotype was significantly higher than that in iPast with APOE3 / 3 genotype. In addition, the amount of EDIL3 secreted into the culture medium of iPast was similarly evaluated by Western blotting. As a result, Fig.26 As shown, the amount of EDIL3 secreted by iPast having the APOE4 / 4 genotype was significantly higher than that secreted by iPast having the APOE3 / 3 genotype. Figures 24 to 26 Data are presented as mean ± standard error of the mean (mean ± SE, n = 3 ( Fig.24 ), n = 4 to 5 ( Fig.24 and 25 ), * and *** refer to p values ​​less than 0.05 and less than 0.001 in Student's t-test, respectively. According to the above results, EDIL3 was found to be a candidate secreted by iPast having APOE4 / 4 genotype, which caused morphological changes in neurons generated by co-culturing with iPast having APOE4 / 4 genotype.

[0290] <Example 7: Examination of the effect of EDIL3 secreted from cells on mouse primary neurons using cells overexpressing EDIL3>

[0291] In order to examine the effect of EDIL3 discovered in Example 6 on mouse primary neurons, EDIL3 was overexpressed in cultured cell lines, and the effect of EDIL3 secreted from cells to the outside of the cells on the morphology of mouse primary neurons was examined.

[0292] Using the plasmid for expressing EDIL3 constructed according to the method described in "Construction of expression plasmid" in the experimental method section, EDIL3 was transduced into HEK293 cells by a conventional method. As a control (nc), HEK293 cells transduced with DsRed (a fluorescent protein, instead of EDIL3) were used. According to the Western blotting method performed in the same manner as in Example 6, EDIL3 was transduced into the cells, and EDIL3 was secreted from the cells to the outside of the cells, as shown in FIG. Fig. 27 Therefore, the culture medium in which the HEK293 cells transduced with EDIL3 were cultured was recovered and Fig.28 As shown, mouse primary neurons were cultured in this medium during the period from day 16 to day 21 of culture (DIV 16 to 21), and the effects of exposure to EDIL3 on the mouse primary neurons were evaluated. Fig.29 Shown are fluorescent images of actin-GFP in dendrites of mouse primary neurons after culture (left) and the results of quantification of the number of dendritic spines per μm (right). Fig.29 In the table, *** means the p value in Student's t-test is less than 0.001. Fig.29 In primary neurons from mice exposed to EDIL3 in culture medium, the number of dendritic spines was significantly reduced compared to controls. Fig.30 As shown, for each dendritic spine shape, mushroom-shaped spines were also significantly reduced, similar to the trend of the results in Example 3.

[0293] <Example 8: Studying the effects of cell-secreted EDIL3 on mouse primary neurons by comparing the presence or absence of EDIL3 knockdown in co-cultured iPast>

[0294] To examine the effects of EDIL3 discovered in Example 6 on mouse primary neurons, the morphology of mouse primary neurons co-cultured with EDIL3 knockdown iPast having an APOE4 / 4 genotype was evaluated.

[0295] The shEDIL3 shown in SEQ ID NO:29 was introduced into iPast with APOE4 / 4 genotype using lentivirus to knock down EDIL3. As a control, iPast with APOE4 / 4 genotype into which shcontrol shown in SEQ ID NO:30 was introduced instead of shEDIL3 was prepared. The results of evaluating the expression level of EDIL3 protein in these iPast with APOE4 / 4 genotype by Western blotting are shown in Fig.31 In iPast into which shEDIL3 was introduced, the expression of EDIL3 was significantly suppressed. Similarly, for iPast having an APOE3 / 3 genotype, iPast into which shEDIL3 or shcontrol was introduced was prepared.

[0296] shEDIL3: 5'-GTGGAATATGTACAGATCT-3' (SEQ ID NO: 29)

[0297] shcontrol:5'-TAAGGTTAAGTCGCCCTCG-3'(SEQ ID NO:30)

[0298] According to the same protocol as in Example 7, the iPast having an APOE4 / 4 genotype or the iPast having an APOE3 / 3 genotype introduced with shEDIL3 or shcontrol thus prepared was co-cultured with mouse primary neurons, and the morphology of the mouse primary neurons was evaluated. Fig.32 Shown are fluorescent images of actin-GFP in dendrites of mouse primary neurons after culture (left) and the results of quantification of the number of dendritic spines per μm (right). Fig.32 The results in are shown as mean ± standard error of the mean (mean ± SE, n = 17 neurons from 3 independent culture batches), where *** indicates a p value less than 0.001 in Tukey's test. Fig.32 In primary mouse neurons co-cultured with iPast having an APOE4 / 4 genotype into which shcontrol was introduced (i.e., EDIL3 was not knocked down), the number of dendritic spines was significantly reduced, while in primary mouse neurons co-cultured with iPast having an APOE4 / 4 genotype into which shEDIL3 was introduced (i.e., EDIL3 was knocked down), the number of dendritic spines was comparable to that in primary mouse neurons co-cultured with iPast having an APOE3 / 3 genotype, and the reduction in number was significantly inhibited. The results of Examples 7 and 8 show that EDIL3 has the effect of reducing dendritic spines in primary neurons, i.e., EDIL3 is secreted by iPast having an APOE4 / 4 genotype and has the effect of reducing dendritic spines in primary neurons.

[0299] <Example 9: Evaluation of the amount of EDIL3 in amyloid plaques in the brain of Alzheimer's disease patients with APOE4 genotype>

[0300] Based on the above results, it was examined whether accumulation of EDIL3 protein was observed in amyloid plaques in the postmortem brains of Alzheimer's disease patients having the APOE4 genotype.

[0301] Immunofluorescence staining of EDIL3, amyloid beta (Aβ), and GFAP was performed in samples collected from parietal lobe sections of postmortem brains of Alzheimer's disease patients (two patients: APOE3 / 3 genotype, two patients: APOE3 / 4 genotype) or people who did not show symptoms of Alzheimer's disease (controls), and cell nuclei were stained with Hoechst. Fluorescence images of the stained samples are shown in Fig.33 In. According to Fig.33 , accumulation of EDIL3 indicated by arrows was observed in amyloid plaques in the brains of Alzheimer's disease patients, whereas accumulation of EDIL3 was not observed in amyloid plaques in the brains of control patients. Fig.34 Shown are the areas of amyloid plaques in the brains of Alzheimer's disease patients (n=13 to 26). Fig.35 FIG. 5 shows the change in the ratio of GFAP-positive cells (the number of cells in which GFAP fluorescence images were observed / the number of Hoechst-stained cells) in the brain of an Alzheimer's disease patient according to the distance from the amyloid plaque. Fig.36 Shown is the change in fluorescence intensity derived from labeled anti-EDIL3 antibodies in the brain of an Alzheimer's disease patient as a function of distance from amyloid plaques. Fig.35 and 36 The data in are shown as the results for 13 to 26 amyloid plaques, and ns and **** indicate p values ​​of 0.05 or more and less than 0.0001, respectively, in Sidak's multiple comparisons test after two-way ANOVA. Fig.34 No significant differences in the size of amyloid plaques were found in patients with or without the APOE4 genotype. Fig.35 , since no significant difference was found in the proportion of GFAP-positive cells regardless of whether the Alzheimer's disease patients had the APOE4 genotype, it was revealed that there was no increase in astrocytes in the brains of patients with the APOE4 genotype. In addition, according to Fig.36, compared with the brains of patients without the APOE4 genotype, in the brains of patients with the APOE4 genotype, the fluorescence intensity was significantly high in the concentric rings of the amyloid plaques that overlapped with the amyloid plaques (rings with a distance of 0 μm), and significant accumulation of EDIL3 was observed near the amyloid plaques. This suggests that EDIL3 is related to Alzheimer's disease in humans, and is particularly closely related to Alzheimer's disease in patients with the APOE4 genotype. In addition, this suggests that in the brains of Alzheimer's patients (especially in the brains of Alzheimer's patients with the APOE4 genotype), EDIL3 is excessively deposited together with the amyloid beta peptide and causes synaptic damage near the plaques.

Claims

1. A kit for diagnosing or assisting in the diagnosis of Alzheimer's disease, the kit comprising: Nucleic acid primers or nucleic acid probes for detecting mRNA encoding EDIL3; Nucleic acid primers or nucleic acid probes for detecting cDNA complementary to the mRNA; or An anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

2. The kit as claimed in claim 1, wherein the subject to be diagnosed is a subject having an APOE4 genotype.

3. The kit according to claim 1 or 2, comprising instructions for use.

4. A method for diagnosing Alzheimer's disease, the method comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

5. A method for assisting the diagnosis of Alzheimer's disease, the method comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

6. The method of claim 4 or 5, wherein a higher quantified level of EDIL3 compared to a control indicates that the subject suffers from or is at risk of suffering from Alzheimer's disease.

7. The method of any one of claims 4 to 6, comprising detecting the presence or absence of the APOE4 genotype in the subject.

8. A pharmaceutical composition for treating Alzheimer's disease, comprising a substance that inhibits EDIL3. 9 . The pharmaceutical composition according to claim 8 , wherein the substance that inhibits EDIL3 is a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

10. The pharmaceutical composition according to claim 8 or 9, wherein the substance that inhibits EDIL3 is a nucleic acid that inhibits the expression of EDIL3, or an anti-EDIL3 antibody or an EDIL3 binding fragment thereof.

11. The pharmaceutical composition of any one of claims 8 to 10, which is a pharmaceutical composition for treating a human subject having an APOE4 genotype.

12. A method for screening a substance that inhibits EDIL3, the method comprising: Neurons were cultured in medium containing EDIL3 and the test substance; as well as The neurons were used to detect Alzheimer's disease phenotypes.

13. A method for screening a substance that inhibits EDIL3, the method comprising: introducing a nucleic acid for expressing EDIL3 into a cell or microorganism; culturing the cell or microorganism; recovering a culture supernatant obtained by culturing the cell or microorganism; culturing neurons in a medium containing the culture supernatant and a test substance; and The neurons were used to detect Alzheimer's disease phenotypes.

14. The screening method of claim 12 or 13, wherein the neuron is a neuron having an APOE4 genotype.

15. The screening method of any one of claims 12 to 14, wherein detecting the phenotype of Alzheimer's disease from the neuron comprises detecting a change in the number of spines of the neuron.

16. The screening method according to any one of claims 12 to 15, wherein the substance that inhibits EDIL3 is a substance for treating Alzheimer's disease.

17. A method for screening a substance that inhibits EDIL3 for treating Alzheimer's disease, the method comprising: culturing cells expressing EDIL3 in a medium containing a test substance; as well as The expression or secretion of EDIL3 was assessed. 18 . The screening method according to claim 17 , wherein evaluating the expression or secretion of EDIL3 is to quantify mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3.

19. The screening method according to claim 17 or 18, wherein EDIL3 quantification is performed using an anti-EDIL3 antibody or an EDIL3 binding fragment thereof.

20. The screening method according to any one of claims 12 to 19, wherein the substance that inhibits EDIL3 is a substance that inhibits the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

Images