New therapeutic uses of harpagides

By screening harpagides from traditional Chinese medicine and developing them into pharmaceutical compositions, the shortcomings of existing radiation protection drugs in the treatment of high-dose ionizing radiation damage have been resolved, effective protection of aquatic organisms has been achieved, the rate of deformities and inflammation has been reduced, and the hematopoietic system has been protected.

CN119700790BActive Publication Date: 2025-09-30INST OF RADIATION MEDICINE CHINESE ACADEMY OF MEDICAL SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411888187.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-20
Publication Date
2025-09-30
Estimated Expiration
2044-12-20

AI Technical Summary

Technical Problem

Existing radiation protection drugs such as amifostine have problems such as rapid metabolism, serious side effects and inconvenient administration in the treatment of high-dose ionizing radiation damage, which limits their application. Other drugs are still in the early stages of research and development, and there is a lack of effective radiation protection agents for aquatic organisms.

Method used

Harpagides and their pharmaceutically acceptable salts were screened out from the treasure trove of traditional Chinese medicine and developed into pharmaceutical compositions for preventing or treating ionizing radiation damage, including oral, parenteral and topical dosage forms, which are made into tablets, capsules and other forms using conventional preparation methods and combined with pharmaceutically acceptable excipients and excipients.

Benefits of technology

Harpagine shows effective protection against ionizing radiation damage, reduces malformation rates and developmental delays, lowers inflammation levels, protects the hematopoietic system, provides safe administration concentrations and routes, and is suitable for radiation protection of aquatic organisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119700790B_ABST
    Figure CN119700790B_ABST
Patent Text Reader

Abstract

This invention discloses a novel therapeutic application of harpagsides. Using zebrafish as research subjects, the authors investigated the effects of harpagsides on ionizing radiation-induced damage. The results showed that harpagsides can effectively prevent or treat ionizing radiation-induced damage and have broad clinical application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a new therapeutic application of harpagine. Background Art

[0002] Radioactive contamination poses a serious threat, not only to public health but also to national security. Water, a precious global resource, is also a key pathway for the spread of radioactive contaminants. Once radioactive material enters a body of water, it accelerates its spread and expands the scope of contamination. Accidental nuclear leaks and improper handling of radioactive waste can cause water pollution. Therefore, the development of new and effective radiation protection drugs is crucial for protecting marine life and, ultimately, human health.

[0003] Currently, only one radiation protection drug, amifostine, is clinically used to treat ionizing radiation-related injuries. However, its rapid metabolism, severe side effects (such as vomiting, diarrhea, and neurotoxicity), and inconvenient injection administration significantly limit its application in combating high-dose ionizing radiation damage. Scientists here have also been working on developing other new radiation protection drugs. The drugs currently authorized by the US FDA for clinical trials include 5-androstene-3,17-diol (5-AED) / Neumune, genistein (BIO300), CBLB502 (Entolimod), HemaMax (recombinant human interleukin-12, rHuIL-12), and ON01210 (a chlorobenzyl sulfone derivative). Drugs in the preclinical research stage include AEOL10150 (meso-porphyrin mimetic), ALXN4100TPO, Palifermin, a phosphoinositide-3 kinase (PI3K) inhibitor (LY294002), a fibroblast growth factor peptide (FGF-P), a histone deacetylase inhibitor (phenylbutyric acid), and a geldanamycin analog.

[0004] Other radiation protectants, such as 17-dimethylamino-ethy-lamino-17-demethoxygeldanamycin (17-DMAG), are still in the early stages of basic research, including chemical, biological, and herbal radiation protectants. Their development remains some distance from practical clinical application. Summary of the Invention

[0005] In the current situation where radioactive contamination of water bodies is a prominent problem and radiation protection of aquatic organisms is in urgent need, this invention intends to screen radiation protection agents with high safety and excellent effects from natural plant ingredients from the treasure house of traditional Chinese medicine and evaluate their protective effects, so as to protect and rescue aquatic organisms from ionizing radiation damage, and open up new strategies for maintaining the safety of aquatic organisms and species diversity.

[0006] According to one aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating ionizing radiation damage, wherein the pharmaceutical composition comprises a preventive or therapeutically effective amount of harpagside or a pharmaceutically acceptable salt thereof.

[0007] The term "pharmaceutically acceptable salt" refers to pharmaceutically acceptable salts of harpagside, which means those carboxylates, amino acid addition salts, etc. of the compound (harpagside) of the present invention, which are suitable for contact with patients within the scope of sound medical judgment, do not produce undue toxicity, irritation, allergic reaction, etc., are commensurate with a reasonable benefit / risk ratio, and are effective for their intended use, including (if possible) zwitterionic forms of the compound (harpagside) of the present invention.

[0008] In some embodiments, examples of the "pharmaceutically acceptable salt of harpagside" include, but are not limited to, salts with alkali metal ions such as Li+, Na+ or K+ (as counter ions), or salts with alkaline earth metal ions such as Mg2+ or Ca2+, or salts with any other pharmaceutically acceptable metal ions such as Zn2+ or Al3+; or pharmaceutically acceptable salts formed with organic bases such as diethanolamine, ethanolamine, N-methylglucamine, triethanolamine or tromethamine.

[0009] In some embodiments, pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali metal and alkaline earth metal hydroxides or organic amines. Examples of metals used as cations include sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines include N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N-methylglucamine, and procaine.

[0010] In some embodiments, base addition salts of acidic compounds can be prepared by contacting the free acid form with a sufficient amount of the desired base in a conventional manner to form the salt. The free acid can be regenerated by contacting the salt form with an acid in a conventional manner and isolating the free acid. The free acid forms differ somewhat from their respective salt forms in certain physical properties, such as solubility in polar solvents, but for the purposes of the present invention, the salts are equivalent to their respective free acids.

[0011] In some embodiments, the salt can be a sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide prepared from an inorganic acid, such as hydrochloric acid, nitric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, phosphoric acid, etc. Representative salts include hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, toluenesulfonate, citrate, maleate, fumarate, succinate, tartrate, naphthoate, methanesulfonate, glucoheptonate, lactobionate, laurylsulfonate, and isethionate, etc. Salts can also be prepared from organic acids, such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, alkanedioic acids, aromatic acids, aliphatic and aromatic sulfonic acids, etc. Representative salts include acetate, propionate, octanoate, isobutyrate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, mandelate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, naphthoate, benzenesulfonate, toluenesulfonate, phenylacetate, citrate, lactate, maleate, tartrate, methanesulfonate, and the like. Pharmaceutically acceptable salts may include cations based on alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. Salts of amino acids, such as arginate, gluconate, galacturonate, and the like are also contemplated.

[0012] According to a second aspect of the present invention, the present invention provides a pharmaceutical preparation for preventing or treating ionizing radiation damage, wherein the pharmaceutical preparation comprises the pharmaceutical composition described above.

[0013] Preferably, the dosage form of the pharmaceutical preparation includes an oral dosage form, a parenteral dosage form and / or a topical dosage form.

[0014] Preferably, the dosage form of the pharmaceutical preparation includes solution, sustained-release agent, suspension, granule, tablet, capsule, powder, effervescent agent, emulsion, syrup, drop and / or chewable agent.

[0015] According to a third aspect of the present invention, the present invention provides use of harpagine or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing or treating ionizing radiation damage.

[0016] Preferably, the ionizing radiation damage includes ionizing radiation-induced embryonic development retardation, ionizing radiation-induced inflammation enhancement, ionizing radiation-induced hematopoietic damage, ionizing radiation-induced hematopoietic erythroid cell reduction, and ionizing radiation-induced hematopoietic myeloid cell reduction.

[0017] Preferably, the drug further comprises pharmaceutically acceptable adjuvants and / or excipients.

[0018] Preferably, the dosage form of the drug includes an oral dosage form, a parenteral dosage form and / or a topical dosage form.

[0019] Preferably, the dosage form of the drug includes solutions, sustained-release preparations, suspensions, granules, tablets, capsules, powders, effervescent preparations, emulsions, syrups, drops and / or chewable preparations.

[0020] Preferably, the safe concentration of harpagside in the drug is 0 to 0.2 mM.

[0021] Preferably, the protective concentration of harpagside in the drug is 0.1 mM.

[0022] Preferably, the ionizing radiation is gamma-rays.

[0023] Preferably, the ionizing radiation is 2 Gy-6 Gy.

[0024] More preferably, the ionizing radiation is 2 Gy, 4 Gy, or 6 Gy.

[0025] In some embodiments, the pharmaceutical composition or pharmaceutical preparation described in the present invention can be prepared into a dosage form suitable for oral administration, parenteral administration or topical administration by a known method, such as by conventional mixing, granulation, coating, solvent or freeze-drying methods, and the dosage form includes but is not limited to: tablets, capsules, granules, injections, powders for injection, transdermal patches, ointments, gels, suppositories, oral solutions, oral suspensions, emulsions for injection, oral emulsions, sustained-release tablets, controlled-release tablets, etc.

[0026] In some embodiments, the pharmaceutical composition or formulation of the present invention may further comprise pharmaceutically acceptable adjuvants, including but not limited to preservatives, solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, flavoring agents, salts for regulating osmotic pressure, buffers, masking agents, or antioxidants. Furthermore, by including ingredients that delay absorption, the pharmaceutical dosage form can be provided with prolonged absorption.

[0027] Those skilled in the art will understand that although the pharmaceutical composition or pharmaceutical preparation mentioned above in the present invention may further contain pharmaceutically acceptable excipients and / or vehicles, when harpagine or its pharmaceutically acceptable salt, and / or at least one other anti-radiation drug is used as a drug for humans or animals, they can also be administered by themselves, that is, the present invention can be achieved without adding any of the above-mentioned pharmaceutically acceptable excipients and / or vehicles.

[0028] When using the pharmaceutical compositions or pharmaceutical formulations provided herein, the administration regimen and dosage regimen can be selected based on a variety of factors, including the type, species, age, weight, sex, and type of tumor / cancer being treated; the severity of the tumor / cancer being treated; the route of administration; the patient's renal and liver function; and the specific compound or salt thereof being used. A dosing / dosage regimen can be used, for example, to prevent a disease, inhibit (completely or partially) a disease, or halt the progression of the disease.

[0029] In some embodiments, the drugs, pharmaceutical compositions or pharmaceutical preparations provided herein can be administered in a variety of ways, including but not limited to: oral, subcutaneous, intravenous, intraarterial, intracoronary, intranasal, intrathecal, transdermal, mucosal, topical (e.g., gels, ointments, lotions, creams, etc.), intraperitoneal, intramuscular, intrapulmonary (e.g., using inhalable technology or pulmonary delivery systems), vaginal, parenteral, rectal or intraocular. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Figure showing the results of the safe concentration screening of harpagine; A: zebrafish embryo survival rate; B: zebrafish embryo deformity rate;

[0031] Figure 2 Figure showing the results of the safe concentration screening of amifostine; A: zebrafish embryo survival rate; B: zebrafish embryo malformation rate;

[0032] Figure 3 A graph showing the results of screening for the effective protective concentration of harpagine; A: zebrafish embryo survival rate; B: zebrafish embryo deformity rate;

[0033] Figure 4 A graph showing the results of the effective protective concentration screening of amifostine; A: zebrafish embryo survival rate; B: zebrafish embryo malformation rate;

[0034] Figure 5 Figure showing the effects of harpagine on the development of irradiated zebrafish embryos, where A: developmental morphology and progression; B: survival rate; C: ratio of various deformity types;

[0035] Figure 6 Showing the effects of harpagide on ionizing radiation-induced gene expression disorders and inflammation levels in zebrafish embryos; A: sox19a; B: p53; C: Wnt; D: TNF-α; E: IL-1β;

[0036] Figure 7Figure 3 shows the fluorescence intensity results of zebrafish hematopoietic damage induced by ionizing radiation; A: fluorescence image of zebrafish tail; B: statistical data of fluorescence intensity of zebrafish tail at 24 hpi; C: statistical data of fluorescence intensity of zebrafish tail at 48 hpi; D: statistical data of fluorescence intensity of zebrafish tail at 72 hpi;

[0037] Figure 8 Figure 1 shows the results of blood flow velocity in the tail of zebrafish with hematopoietic damage induced by ionizing radiation, where A: fluorescence image of the zebrafish tail; B: data statistics;

[0038] Figure 9 Figures showing the effects of harpagside on ionizing radiation-induced hematopoietic damage in zebrafish; A: Fluorescence image after harpagside and AMF treatment; B: Statistics of zebrafish fluorescence intensity; C: Statistics of zebrafish tail blood flow velocity;

[0039] Figure 10 Figure showing the results of O-Dianisidine staining to detect the effect of harpagine on the ionizing radiation-induced reduction of zebrafish directional hematopoietic erythroid cells; A: image of hematopoietic erythroid cell staining; B: statistical data of the hematopoietic erythroid cell staining area;

[0040] Figure 11 Figure showing the effect of Sudan Black B staining on the reduction of zebrafish hematopoietic myeloid cells induced by ionizing radiation detected by harpagine; A: Staining image of hematopoietic myeloid cells; B: Statistics of the total number of hematopoietic myeloid cells;

[0041] Figure 12 The results show the effect of harpagine on the expression levels of molecular markers of hematopoietic erythroid, myeloid and hematopoietic stem cells in irradiated zebrafish larvae, where A: βe1; B: lyc; B: c-myb. DETAILED DESCRIPTION

[0042] The present invention will be further described in detail below with reference to the accompanying drawings and examples. The following examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Experimental procedures where specific conditions are not specified in the examples are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0043] Example Study on the protective effect of harpagide against ionizing radiation

[0044] Experimental Materials

[0045] (1) Harpagide (HPG): purchased from Shanghai Yuanye Biotechnology Co., Ltd., product number B20481.

[0046] (2) Amifostine (AMF): purchased from MedChemExpress, product number HY-B0639.

[0047] (3) O-dianisidine: purchased from Sigma-Aldrich, product number 119-90-4.

[0048] (4) Sudan Black B: purchased from Sigma-Aldrich, catalog number 199664.

[0049] (5) Real-time fluorescence quantitative PCR reagent: FastStart Universal SYBR Green Master (Rox), purchased from Roche, Germany, product number 4913914001.

[0050] (6) TRIZOL: TRIzol reagent for RNA extraction was purchased from TaKaRa, catalog number 9109.

[0051] (7) RNA reverse transcription reagents: Ⅱ 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number 11123ES60.

[0052] (8) ELISA: ELISA detection kits for inflammatory factors TNF-α (F69008-A) and IL-1β (F69010-A) were purchased from Shanghai Kexing Trading Co., Ltd.

[0053] (9) Wild-type AB zebrafish: AB zebrafish at the peak of reproduction, aged 4 to 6 months, were purchased from the China Zebrafish Resource Center (CZRC).

[0054] (10) Fluorescently labeled transgenic zebrafish: Myeloid-specific green fluorescent labeled zebrafish, Tg(mpx:EGFP), were purchased from the China Zebrafish Resource Center (CZRC).

[0055] (11) 137Csγ-ray irradiation source: purchased from Atomic Energy of Canada Ltd., model USD Autocell40, with a dose rate of 0.84 Gy / min.

[0056] (12) Stereo fluorescence microscope: Nikon, model SMZ1270.

[0057] (13) Zebrafish micro-visual behavior analysis system: DanioScope, Noldus Information Technology.

[0058] (14)Image J software: 1.49X, NIH, http: / / rsb.info.nih.gov / ij / .

[0059] Experimental methods

[0060] (1) Screening of safe concentrations of harpagine (HPG) and amifostine (AMF)

[0061] Wild-type AB zebrafish were paired 1:1, and embryos were collected. HPG experiments were performed at Ctrl, 0.02, 0.2, 2, and 20 mM, while AMF (a clinical radiation protection drug used as a positive control) experiments were performed at Ctrl, 0.02, 0.2, and 2 mM, with three replicates per group. Embryos in each group were cultured in 24-well plates, with 20 embryos per well in 1 mL of Holt buffer (5 mmol / L NaCl, 0.17 mmol / L KCl, 0.33 mmol / L CaCl2, and 0.66 mmol / L NaHCO3, pH 7.2) in a 28°C incubator. At 3 hpf (hours post-fertilization), the corresponding drug concentrations were added to the 24-well plates and cultured. Fresh Holt buffer was replaced daily, and the corresponding HPG or AMF concentrations were added. The survival rate of each group of embryos was observed and counted under a stereomicroscope at 3, 24, 48 and 72 hpf. The deformity rate of each group of embryos was counted at 72 hpf. Based on this, the safe concentration range of HPG and AMF for zebrafish embryos was preliminarily screened.

[0062] (2) Screening of effective protective concentrations of HPG and amifostine (AMF)

[0063] Wild-type AB zebrafish were paired male and female in a 1:1 ratio, and embryos were collected. HPG and AMF screening experiments were performed in groups of Ctrl, IR (6 Gy), IR (6 Gy) + 0.05 mM HPG / AMF, IR (6 Gy) + 0.1 mM HPG / AMF, and IR (6 Gy) + 0.2 mM HPG / AMF, with three replicates per group. Embryos in each group were cultured in 24-well plates, with 20 embryos per well in 1 mL of Holt Buffer, in a 28°C incubator. At 3 hpf (hours post-fertilization), the corresponding concentrations of the two drugs were added to the 24-well plates. The ionizing radiation group was irradiated with 6 Gy of γ-rays at 4 hpf. Fresh Holt Buffer was replaced daily, and the corresponding concentrations of HPG or AMF were added. The survival rates of embryos in each group were observed and counted under a stereomicroscope at 3, 24, 48 and 72 hpf. The deformity rates of embryos in each group were counted at 72 hpf. Based on these results, the optimal protective concentrations of HPG and AMF against γ-ray irradiated zebrafish embryos were preliminarily screened.

[0064] (3) Effects of HPG on the development of irradiated zebrafish embryos

[0065] Wild-type AB zebrafish were paired male and female in a 1:1 ratio, and their embryos were collected. The zebrafish were grouped according to Ctrl, IR (6 Gy), IR (6 Gy) + 0.1 mM HPG, and IR (6 Gy) + 0.1 mM AMF, with three replicates per group. Embryos in each group were cultured in 24-well plates, with 20 embryos per well immersed in 1 mL of Holt Buffer, and cultured in a 28-degree incubator. At 3 hpf (hours post-fertilization), the corresponding concentrations of the two drugs were added to the 24-well plates. The group requiring ionizing radiation was irradiated with 6 Gy of γ-rays at 4 hpf. Fresh Holt Buffer was replaced daily, and the corresponding concentrations of HPG or AMF drugs were added. The developmental process and morphology of embryos in each group were observed under a stereomicroscope at 3, 24, 48, and 72 hpf, and photographed. The survival rate of embryos in each group was calculated. The deformity rate of different types of embryos in each group (including tail bending, pericardial edema, microphthalmia, yolk cyst, and complex deformities of the above) was calculated at 72 hpf. Based on this, the effects of HPG on the developmental process, survival, and developmental morphology of γ-ray irradiated zebrafish embryos were evaluated.

[0066] (4) Effects of HPG on ionizing radiation-induced gene expression disorders and inflammation levels in zebrafish embryos

[0067] Wild-type AB zebrafish were paired male and female in a 1:1 ratio, and their embryos were collected. The zebrafish were divided into groups according to Ctrl, IR (6 Gy), IR (6 Gy) + 0.1 mM HPG, and IR (6 Gy) + 0.1 mM AMF, with three replicates per group. Embryos in each group were cultured in 24-well plates, with 30 embryos per well immersed in 1 mL of Holt Buffer, and cultured in a 28-degree incubator. At 3 hpf (hours post-fertilization), the corresponding concentrations of the two drugs were added to the 24-well plates. The group requiring ionizing radiation was irradiated with 6 Gy of γ-rays at 4 hpf. Fresh Holt Buffer was replaced daily, and the corresponding concentrations of HPG or AMF drugs were added. Embryonic tissues were collected at 72 hpf and total RNA was extracted for real-time fluorescence quantitative PCR analysis. Data were analyzed using the 2-ΔΔCT method. The expression levels of development-related genes, sox19a (forward: TGTCAACAGCCAACAACAGCA; reverse: GTTGTGCATTTTGGGGTTCT), p53 (forward: GGGCAATCAGCGAGCAAA; reverse: ACTGACCTTCCTGAGTCTCCA), and Wnt (forward: CACGGAGTCAGTCCAGAAGG; reverse: TGTGGCACCGTCGAATTTCT), were measured in embryos of each group. Alternatively, embryos were homogenized in PBS on ice and the expression levels of two inflammatory factors, TNF-α and IL-1β, were measured using commercial ELISA kits. This study evaluated the effects of HPG on ionizing radiation-induced developmental gene expression disturbances and inflammation in zebrafish embryos.

[0068] (5) Effects of HPG on ionizing radiation-induced hematopoietic damage in zebrafish

[0069] (a) Dose response of Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish to γ-irradiation: Transgenic zebrafish (Tg(mpx:EGFP)) with fluorescently labeled blood system were paired 1:1, and embryos were collected. Embryos were cultured in Holt Buffer in a 28°C incubator, with fresh Holt Buffer replaced daily. At 2 days post-fertilization (dpf), zebrafish larvae with good development and consistent fluorescence intensity were selected under a stereofluorescence microscope. γ-irradiation groups of 0, 0.5, 1, 2, and 4 Gy were set up, with three replicates per group. Each group of larvae was cultured in a 24-well plate, with 20 larvae per well immersed in 1 mL of Holt Buffer. Each group received a single dose of γ-irradiation. Fresh Holt Buffer was replaced daily after irradiation. Whole-body fluorescence images of zebrafish in each group were taken under a stereofluorescence microscope at 0, 24, 48, and 72 hpi (hours post-irradiation), and tail blood flow velocity videos were recorded at 72 hpf. Whole-body fluorescence intensity of zebrafish in each group was calculated using Image J software, and blood flow velocity of zebrafish in each group was analyzed and calculated using the zebrafish micro-behavioral analysis system. The above experiments were used to evaluate the response of Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish to γ-ray irradiation and screen for appropriate irradiation doses. (b) Effect of HPG on fluorescence intensity and blood flow velocity in radiation-damaged Tg(mpx:EGFP) zebrafish: Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish were paired 1:1 between male and female, and the resulting embryos were collected in Holt Buffer and cultured in a 28-degree incubator, with fresh Holt Buffer replaced daily. At 2 dpf, zebrafish larvae with good development and consistent fluorescence intensity were selected under a stereofluorescence microscope. Three replicates were set up in the control, IR (final screening dose, 2 Gy), IR (2 Gy) + 0.1 mM HPG, and IR (2 Gy) + 0.1 mM AMF groups. Each group contained 20 larvae in 1 mL of Holt buffer per well in 24-well plates. Larvae in the ionizing radiation-requiring group received a single dose of 2 Gy of γ-rays. One hour before irradiation, the IR (2 Gy) + 0.1 mM HPG and IR (2 Gy) + 0.1 mM AMF groups were treated with 0.1 mM HPG or 0.1 mM AMF, respectively. After irradiation, fresh Holt buffer was replaced daily and supplemented with the appropriate concentrations of HPG or AMF. Whole-body fluorescence images of zebrafish in each group were taken under a stereofluorescence microscope at 72 hpi, and videos of tail blood flow velocity were recorded. Image J software was used to calculate the whole-body fluorescence intensity of each group of zebrafish, and the zebrafish micro-visual behavior analysis system was used to analyze and calculate the blood flow velocity of each group of zebrafish.The above experiments were used to preliminarily evaluate the effects of HPG on ionizing radiation-induced hematopoietic damage in zebrafish.

[0070] (6) O-Dianisidine staining to detect the effect of HPG on ionizing radiation-induced hematopoietic erythroid cell reduction in zebrafish

[0071] Weigh 100 mg of O-Dianisidine powder and dissolve it in 70 mL of anhydrous ethanol. Store at 4°C in the dark. Add 2 mL of ddH2O, 2 mL of O-Dianisidine solution, 500 mL of 0.1 M sodium acetate solution (pH 4.5), and 100 μL of 30% H2O2 to a 15 mL centrifuge tube in that order, mix well, and set aside. Pair Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish in a 1:1 ratio, collect the resulting embryos, place them in Holt Buffer, and culture them in a 28°C incubator. Replace the Holt Buffer daily. At 2 dpf, zebrafish larvae with good development and consistent fluorescence intensity were selected under a stereofluorescence microscope. Three replicates were set up in each group: control, IR (2 Gy), IR (2 Gy) + 0.1 mM HPG, and IR (2 Gy) + 0.1 mM AMF. Each group of larvae was cultured in 24-well plates, with 20 larvae per well in 1 mL of Holt buffer. Larvae in the ionizing radiation-requiring group received a single dose of 2 Gy of γ-rays. One hour prior to irradiation, the IR (2 Gy) + 0.1 mM HPG and IR (2 Gy) + 0.1 mM AMF groups were treated with 0.1 mM HPG or 0.1 mM AMF, respectively. After irradiation, the Holt buffer was replaced daily with fresh HPG or AMF at the appropriate concentration. At 3.5 dpf, larvae from each group were collected, placed in 1.5 mL EP tubes, and 500 μL of the working staining solution was added. The larvae were stained for 30–60 min at room temperature on a shaker in the dark. During this time, remove a few juveniles and examine the staining under a microscope. After staining, aspirate the dye solution and wash the specimen three times with PBST (10 minutes each). Add 1 mL of 4% paraformaldehyde and fix for at least 2 hours. Wash the specimen three times with PBST (10 minutes each) and store in 100% glycerol. Image acquisition is performed under a stereomicroscope.

[0072] (7) Sudan Black B staining to detect the effect of amifostine on the reduction of committed hematopoietic myeloid cells induced by ionizing radiation in zebrafish

[0073] Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish were paired in a 1:1 ratio of male to female pairs. Embryos were collected and cultured in Holt buffer in a 28°C incubator, with fresh Holt buffer replaced daily. At 2 dpf, well-developed zebrafish larvae with consistent fluorescence intensity were selected under a stereofluorescence microscope. Three replicates were set up in 24-well plates, each containing 20 larvae per well, each immersed in 1 mL of Holt buffer. Larvae in the irradiation-requiring group received a single dose of 2 Gy of γ-ray irradiation. 1 hour prior to irradiation, the IR(2 Gy)+0.1 mM HPG and IR(2 Gy)+0.1 mM AMF groups were treated with 0.1 mM HPG or 0.1 mM AMF, respectively. After irradiation, fresh Holt Buffer was replaced daily and supplemented with the appropriate concentration of HPG or AMF. At 3.5 dpf (days post-fertilization), juvenile zebrafish from each group were collected and fixed with 4% paraformaldehyde and shaken overnight at 4°C. 0.6 g of Sudan Black B powder was dissolved in 200 mL of anhydrous ethanol, filtered through filter paper, and set aside. Fixed zebrafish larvae from each group were rinsed three times with PBST, each for 5 minutes. 500 μL of Sudan Black B staining solution was added to a 1.5 mL EP tube containing embryos, and staining was continued for 30-60 minutes on a shaker at room temperature in the dark. During this time, several larvae were removed and examined under a microscope for staining. Once a clear staining signal was observed, the larvae were rinsed with 100% anhydrous ethanol until the signal was clearly visible. The larvae from each group were placed in 100% glycerol for image acquisition.

[0074] (8) Effects of HPG on the expression levels of molecular markers of erythroid, myeloid, and hematopoietic stem cells in irradiated zebrafish larvae

[0075] Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish were paired in a 1:1 ratio of male to female pairs. Embryos were collected and cultured in Holt buffer in a 28°C incubator, with fresh Holt buffer replaced daily. At 2 dpf, well-developed zebrafish larvae with consistent fluorescence intensity were selected under a stereofluorescence microscope. Three replicates were set up in 24-well plates, each containing 20 larvae per well, each immersed in 1 mL of Holt buffer. Larvae in the irradiation-requiring group received a single dose of 2 Gy of γ-ray irradiation. 1 hour prior to irradiation, the IR(2 Gy)+0.1 mM HPG and IR(2 Gy)+0.1 mM AMF groups were treated with 0.1 mM HPG or 0.1 mM AMF, respectively. After irradiation, fresh Holt buffer was replaced daily and supplemented with HPG or AMF at the corresponding concentrations for a total of 3 days. At 5 dpf (days post-fertilization), juvenile fish from each group were collected and RNA was extracted using TRIzol lysis. cDNA was obtained by reverse transcription. Real-time quantitative PCR was used to analyze the mRNA expression levels of the committed erythroid marker βe1 (forward: GCAAGGTGTCTCATCGTGT; reverse: GTCAAGCAATCAGCCAAAA), the committed myeloid marker lyc (forward: GATACGGGGAAGGACTACGG; reverse: CAGCCCGTCCATTTTCACAA), and the hematopoietic stem cell marker c-myb (forward: GGAAAGTGGAGCAAGAAGGTTA; reverse: TCGCTGTAGTGTCTCTGGATAG).

[0076] Experimental results

[0077] (1) Screening of safe concentrations of harpagine (HPG) and amifostine (AMF)

[0078] After screening, 2mM HPG, 20mM HPG and 2mM AMF can cause a significant decrease in the survival rate of zebrafish embryos and a significant increase in the deformity rate. HPG and AMF at concentrations of 0.2mM and below did not cause significant changes in embryo survival rate and deformity rate. Therefore, the safe concentrations of HPG and AMF on zebrafish embryos are 0-0.2mM ( Figure 1 and 2 ).

[0079] (2) Screening of effective protective concentrations of HPG and amifostine (AMF)

[0080] After screening, 0.1mM HPG and AMF can reverse the decreased survival rate and increased deformity rate of irradiated zebrafish embryos to the greatest extent. Therefore, the optimal protective concentration of HPG and AMF on zebrafish embryos is 0.1mM ( Figure 3 and 4 ).

[0081] (3) Effects of HPG on the development of irradiated zebrafish

[0082] γ-ray irradiation can cause developmental delay, decreased survival rate, and the appearance of various deformities in zebrafish embryos. However, both HPG and AMF treatments can reverse this trend to varying degrees, with AMF having a relatively better reversal effect ( Figure 5 ).

[0083] (4) Effects of HPG on ionizing radiation-induced gene expression disorders and inflammation levels in zebrafish embryos

[0084] γ-ray irradiation can cause expression disorders of development-related genes in zebrafish embryonic tissues (sox19a and p53 mRNA levels are upregulated, Wnt mRNA levels are downregulated) and increased inflammation levels (inflammatory factors TNF-α and IL-1β protein levels are upregulated), while HPG and AMF treatment can reverse this trend to varying degrees, and the reversal effect of AMF treatment is more significant ( Figure 6 ).

[0085] (5) Effects of HPG on ionizing radiation-induced hematopoietic damage in zebrafish

[0086] The fluorescence intensity of Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish gradually weakened with the increase of γ-ray irradiation dose, especially in the 2Gy and 4Gy irradiation groups, and the weakening effect was more obvious with the extension of irradiation time ( Figure 7 ). 72 hours after irradiation, the blood flow velocity in the tail gradually slowed down with the increase of γ-ray irradiation dose, especially in the 2Gy and 4Gy irradiation groups ( Figure 8 ). 2Gyγ-ray irradiation can weaken the fluorescence intensity of Tg(mpx:EGFP) zebrafish, while HPG and AMF treatment can reverse this trend to a certain extent. The blood flow velocity shows a similar trend 72h after irradiation ( Figure 9 ).

[0087] (6) O-Dianisidine staining to detect the effect of HPG on ionizing radiation-induced hematopoietic erythroid cell reduction in zebrafish

[0088] 2Gyγ-ray irradiation can reduce the number of hematopoietic erythroid cells in Tg(mpx:EGFP) zebrafish (most obvious in the heart), while HPG and AMF treatment can reverse this trend to some extent ( Figure 10 ).

[0089] (7) Sudan Black B staining to detect the effect of amifostine on the reduction of committed hematopoietic myeloid cells induced by ionizing radiation in zebrafish

[0090] 2Gy γ-ray irradiation can reduce the number of hematopoietic myeloid cells in Tg(mpx:EGFP) zebrafish (most obvious in the tail), while HPG and AMF treatment can reverse this trend to some extent ( Figure 11 ).

[0091] (8) Effects of HPG on the expression levels of molecular markers of erythroid, myeloid and hematopoietic stem cells in irradiated zebrafish larvae.

[0092] 2Gy γ-ray irradiation can reduce the mRNA expression levels of βe1, a molecular marker of hematopoietic erythroid cells, lyc, a molecular marker of myeloid cells, and c-myb, a molecular marker of hematopoietic stem cells, in Tg(mpx:EGFP) zebrafish, while HPG and AMF treatment can reverse this trend to some extent ( Figure 12 ).

[0093] Although the specific embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the details based on all the teachings published, and these changes are all within the scope of protection of the present invention. The entire invention is given by the appended claims and any equivalents thereof.

Claims

1. Use of harpagside or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing or treating ionizing radiation damage.

2. The use according to claim 1, characterized in that The ionizing radiation damage includes ionizing radiation-induced embryonic development retardation, ionizing radiation-induced inflammation enhancement, and ionizing radiation-induced hematopoietic damage.

3. The use according to claim 1, characterized in that The ionizing radiation damage is ionizing radiation-induced hematopoietic myeloid cell reduction.

4. The use according to claim 1, characterized in that The ionizing radiation damage is ionizing radiation-induced hematopoietic erythroid cell reduction.

5. The use according to claim 1, characterized in that The drug further comprises pharmaceutically acceptable excipients.

6. The use according to claim 1, characterized in that The dosage form of the drug includes an oral dosage form, a parenteral dosage form and / or a topical dosage form.

7. The use according to claim 6, characterized in that The dosage forms of the drug include solutions, sustained-release preparations, suspensions, granules, tablets, capsules, powders, effervescent preparations, emulsions, syrups and / or drops.

8. The use according to claim 1, characterized in that The safe concentration of harpagside in the drug is 0.02 to 0.2 mM.

9. The use according to claim 1, characterized in that The effective concentration of harpagside in the drug is 0.1 mM.

10. The use according to claim 1, characterized in that The ionizing radiation is gamma-rays.

11. The use according to claim 1, characterized in that The ionizing radiation is 2 Gy-6 Gy.

12. The use according to claim 1, characterized in that The ionizing radiation is 2 Gy, 4 Gy or 6 Gy.