Application of UBR5 in preparation of medicine for treating pigmented dermatosis

Abstract

The invention provides application of UBR5 in preparation of drugs for treating pigmented skin diseases, and further the pigmented skin diseases comprise various types of pigmented nevus (mainly congenital pigmented nevus and megalous with the risk of malignant transformation). Various pigmented spots (mainly chloasma, freckles, Taitian nevus, post-inflammation hyperpigmentation and the like) and hypopigmentation / depigmentation spots (mainly leucoderma, post-inflammation hypopigmentation and the like). Experimental results show that UBR5 is highly expressed in disease tissues such as pigmented nevus. The UBR5 expression level and the melanogenesis ability are in significant positive correlation, targeted knockout / knockdown of UBR5 in melanocytes can significantly inhibit the expression level of melanogenesis related genes such as MITF, TRP1, TRP2, TYR and other proteins, the melanin content of melanocytes and tyrosinase activity, vice versa, and the melanogenesis ability of melanocytes after overexpression of UBR5 is significantly increased.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of UBR5 in preparing a drug for treating pigmented skin diseases. Background Art

[0002] Pigmented skin diseases are caused by a variety of factors, including heredity, gene mutation, external stimulation, drugs, diet and daily routine, which can lead to abnormal differentiation, proliferation and migration of melanocytes in the skin, and disorders in melanin synthesis, secretion and transport. Such skin diseases are very common in dermatology. Although most pigmented skin diseases are not life-threatening, there is still a certain proportion of congenital diseases that are at risk of malignant transformation to melanoma. Huge skin lesions in special parts are often difficult to remove surgically and there is a risk of disfigurement or functional impairment, which will eventually seriously affect the appearance, daily work, study and life, and even death. It brings huge psychological, physical and economic burdens to patients. As people pay more and more attention to their physical and mental health and appearance, more and more patients are beginning to pay attention to early intervention and non-surgical treatments of pigmented skin diseases. Common pigmented skin diseases in clinical practice include various types of pigmented nevi (mainly congenital pigmented nevi and giant nevi with the risk of malignant transformation), various pigmented spots (mainly chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, etc.) and depigmented / hypopigmented spots (mainly vitiligo, post-inflammatory hypopigmentation, etc.), but traditional treatments such as surgery, laser and conventional drugs have very limited effects, and finding safe and effective treatment strategies is still a huge challenge for clinicians. Therefore, it is urgent to screen new treatment targets and develop new drugs and treatment strategies.

[0003] Melanogenesis is a complex biological process involving the differentiation, proliferation, migration of melanocytes, and the synthesis, secretion, and transport of melanin. This process not only determines the color of the skin, hair, and eyes, but is also closely related to a variety of skin diseases, especially in diseases of abnormal melanin deposition. Melanocytes originate from neural crest cells in the embryonic period, and they function by migrating to the skin, hair follicles, etc. During the differentiation process, regulatory factors such as the Wnt signaling pathway, SOX10, and MITF play an important role. MITF regulates the expression of melanin synthases such as tyrosinase (TYR). The proliferation of melanocytes is regulated by the MC1R pathway, and cAMP signals promote their proliferation to maintain the stability of skin pigments. The migration process depends on the extracellular matrix and chemokines. Abnormal migration may lead to localized pigment deficiency or aggregation, such as mottled disease. Melanin synthesis occurs in melanosomes, and enzymes such as TYR catalyze the oxidation of tyrosine to produce melanin. There are two main types of melanin: eumelanin and pheomelanin, and the ratio of the two determines the color of skin and hair. MITF ensures the synthesis of melanin by regulating the expression of synthase genes. The generated melanin is transported to adjacent keratinocytes through the cytoskeleton and transport proteins and distributed on the skin surface. GTPases such as Rab27a are involved in this transport process, and any abnormality will lead to pigment distribution disorders, such as Griscelli syndrome.

[0004] Melanocyte differentiation, proliferation, migration, melanin synthesis and transport in the process of melanogenesis are precisely regulated. Disorders in any link will lead to abnormal deposition or uneven distribution of melanin, which in turn will cause a variety of pigmentary diseases, such as vitiligo: an autoimmune disease in which the immune system attacks melanocytes, causing skin depigmentation and the formation of white spots; various pigmented spots such as freckles and chloasma, acanthosis nigricans, skin aging and photoaging; congenital pigmented nevus: abnormal proliferation of melanocytes during the embryonic period leads to the formation of pigment deposition areas on the skin surface; although most are benign, larger congenital pigmented nevus may have the risk of malignant transformation. In-depth research on these mechanisms not only helps to explain the occurrence of pigmentary diseases, but also provides a basis for the development of new treatment strategies.

[0005] UBR5 (also known as EDD1) is an important member of the E3 ubiquitin ligase family and participates in the ubiquitin-proteasome pathway to regulate the degradation of multiple proteins in cells. As an E3 ubiquitin ligase, UBR5 regulates protein homeostasis in cells by binding to specific substrates and attaching ubiquitin molecules to these proteins, marking them for entry into the proteasome for degradation. UBR5 has a wide range of functions, involving multiple biological processes such as cell cycle control, DNA damage response, gene transcription regulation, and signal transduction, and is closely related to a variety of diseases, especially in cancer, neurodegenerative diseases, and inflammation-related pathological mechanisms. At present, no research reports have described the effects and mechanisms of UBR5 on the melanogenesis function of melanocytes. Summary of the invention

[0006] In view of the shortcomings of existing technologies, this study aims to provide new targets for the treatment of pigmented skin diseases, further explore the impact of UBR5 on the melanogenesis function of melanocytes and its specific regulatory mechanism, and provide new ideas for the preparation of drugs for the treatment of pigmented skin diseases.

[0007] The technical solution of the present invention is: Application of UBR5 in the preparation of drugs for the treatment of pigmented skin diseases.

[0008] Preferably, the pigmented skin disease includes hyperpigmented skin disease and hypopigmented skin disease.

[0009] Preferably, the pigmented skin diseases include pigmented nevi, pigmented spots, and depigmented / hypopigmented spots.

[0010] Preferably, the pigmented skin diseases include pigmented nevi, congenital pigmented nevi and giant nevi with risk of malignant transformation, chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, vitiligo, and post-inflammatory hypopigmentation.

[0011] Preferably, the application includes the use of a UBR5 inhibitor or a UBR5 enhancer in the preparation of a drug for treating pigmented skin diseases.

[0012] The pigmented skin diseases include various types of pigmented nevi (mainly congenital pigmented nevi and giant nevi with the risk of malignant transformation), various pigmented spots (mainly chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, etc.) and hypopigmentation / loss spots (mainly vitiligo, post-inflammatory hypopigmentation, etc.).

[0013] Preferably, the UBR5 inhibitor includes siRNA, shRNA or sgRNA of UBR5, and the UBR5 enhancer includes shRNA of UBR5.

[0014] The present invention also provides the use of UBR5 in preparing an inhibitor or activator for regulating melanogenesis. Further, it includes the use of an inhibitor of UBR5 or an enhancer of UBR5 in preparing an inhibitor or activator for regulating melanogenesis. Further, the inhibitor of UBR5 includes siRNA, shRNA or sgRNA of UBR5, and the enhancer of UBR5 includes shRNA of UBR5.

[0015] The present invention also provides the use of UBR5 in the preparation of a tyrosinase activity inhibitor or enhancer. Further, it includes the use of a UBR5 inhibitor or a UBR5 enhancer in the preparation of a tyrosinase activity inhibitor or enhancer. Further, the UBR5 inhibitor includes siRNA, shRNA or sgRNA of UBR5, and the UBR5 enhancer includes shRNA of UBR5.

[0016] Further preferably, the inhibitors of UBR5 or enhancers of UBR5 include ubenimex, 1-naphthylacetyl spermine, GSK369796 dihydrochloride, carvedilol, CP-91149, naftopidil, BN82002, higenamine hydrochloride, cefuroxime, cefprozil monohydrate, carvedilol, nadolol, AR-13324 M1 metabolite, DL-norepinephrine hydrochloride, midodrine, carvedilol phosphate, cefaclor, ampicillin, A-366, L-ANAP hydrochloride, H-phenylalanine-phenylalanine-OH, zeatin riboside, cephalexin, pindolol, capivasertib, flavopiridol, ractopamine hydrochloride, neridrin hydrochloride, dexlansoprazole, cephradine, cephradine monohydrate, cefadroxil hydrate, labetalol hydrochloride, A-366.

[0017] The experimental results of the present invention found that: 1. UBR5 is highly expressed in disease tissues such as pigmented nevi.

[0018] 2. The expression level of UBR5 is significantly positively correlated with the ability to produce melanin. Targeted knockout / knockdown of UBR5 in melanocytes can significantly inhibit the expression levels of melanogenesis-related genes MITF, TRP1, TRP2, TYR and other proteins, the melanin content and tyrosinase activity of melanocytes. Vice versa, the melanogenesis ability of melanocytes is significantly increased after overexpression of UBR5.

[0019] 3. The present invention found that more than 30 small molecule compounds have good binding with the UBR5 enzyme activity center or its surroundings, indicating that these compounds block or activate the UBR5 catalytic site to a certain extent, thereby inhibiting or activating the UBR5 enzyme activity. In particular, small molecule drugs such as ellagic acid and flavopiridol and their analogs are expected to be used as UBR5 targeted drugs for the treatment of pigmented skin diseases.

[0020] The results of this study suggest that UBR5 is a potential important therapeutic target in regulating the process of melanogenesis. The development of drugs or reagents that regulate the expression level of UBR5 is expected to provide new ideas and strategies for the treatment of pigmented skin diseases.

[0021] The detailed structure of the present invention is further described below in conjunction with the accompanying drawings and specific implementation methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a differential analysis chart of the transcriptome sequencing data of skin tissue (left) and nevus tissue (right) in the GTEX database. After log2 transformation, the wilcox.test was used to compare the mRNA expression level of UBR5 between the two groups.

[0023] Figure 2 This is the test result after knocking out UBR5 in B16F10 cells: Figure 2 A is the color change diagram of centrifugal precipitation; Figure 2 B is a graph showing changes in intracellular melanin content; Figure 2 C is a graph showing changes in tyrosinase activity; Figure 2 D. Western blot method was used to detect the changes in the expression of the important transcription factor MITF and the key proteins TRP1, TRP2 and TYR in the cells. Figure 2 E is Figure 2 Statistical graph of D; Figure 2 F, 2G After knocking out UBR5 in zebrafish, the intensity of melanin signal in the head and its statistical graph were detected; Figure 3 This is the result of Western blot analysis after inhibiting UBR5 expression; Figure 3 A is the expression diagram of MITF, an important transcription factor in the melanin synthesis pathway, and TRP1, TRP2 and TYR, key proteins in melanin synthesis, in PIG1 and MNT1 cells. Figure 3 B. Figure 3 C is a statistical chart showing changes in melanin content and tyrosinase activity; Figure 4 This is the result of Western blot analysis of overexpressed UBR5. Figure 4 A is the expression diagram of MITF, an important transcription factor in the melanin synthesis pathway, and TRP1, TRP2 and TYR, key proteins in melanin synthesis, in PIG1 and MNT1 cells. Figure 4 B. Figure 4 C is a statistical graph showing the changes in melanin content and tyrosinase activity in MNT1 cells.

[0024] Figure 5 A is the 3D image of EA docking with UBR5 protein. Figure 5 B is a graph showing the proliferation activity of B16F10 cells detected by CCK8 assay after the cells were cultured with medium containing different concentrations of EA for 24 h and 48 h.

[0025] Figure 6A is a graph showing the protein expression levels of melanogenesis-related genes such as MITF, TYR, TYRP1, and TYRP1 detected by Western blot after B16F10 cell line was treated with specific concentrations of EA; Figure 6 B. Figure 6 C is the result of simultaneously detecting the changes in melanin content and tyrosinase activity.

[0026] Figure 7 A. Figure 7 B is the observation of the melanin signal intensity in the zebrafish head and its statistical results at 2 dpf after culturing zebrafish embryos with culture medium containing a specific concentration of EA. Figure 7 C. Figure 7 D. EA was made into a 2 mg / ml hydrogel and applied to a fixed position on the mouse tail. The changes in the color of the mouse tail were observed for 25 days and the statistical results are shown in the figure.

[0027] Figure 8 A. Figure 8 B is the treatment of B16F10 cell line with specific concentrations of EA analogs E1, E2, and E3 to detect the melanin content ( Figure 8 A) and tyrosinase activity changes ( Figure 8 B).

[0028] Fig. 9 A is the 3D image of FH docking with UBR5 protein. Fig. 9 B is a graph showing the proliferation activity of B16F10 cells detected by CCK8 assay after the cells were cultured with medium containing different concentrations of FH for 24 h and 48 h.

[0029] Fig.10 A is a graph showing the expression levels of melanogenesis-related gene proteins such as MITF, TYR, TYRP1, and TYRP1 detected by Western blot after B16F10 cell line was treated with a specific concentration of FH; Fig.10 B is a graph showing the results of the melanin content test; Fig.10 C is a graph showing the results of detecting changes in tyrosinase activity.

[0030] Fig.11 This is the image of melanin signal intensity in the zebrafish head observed at 2 dpf after culturing zebrafish embryos with culture medium containing a specific concentration of FH ( Fig.11 A) and its statistical results ( Fig.11 B).

[0031] Fig.12 To treat B16F10 cell line with specific concentrations of FH analogs F1, F2, and F3, and to detect melanin content ( Fig.12 A) and tyrosinase activity changes ( Fig.12 B); Fig.12C is a schematic diagram of the molecular docking of voruciclib and UBR5. DETAILED DESCRIPTION

[0032] Example 1

[0033] 1. Construction of mouse melanocyte cell line with UBR5 gene knockout and Western blot identification.

[0034] 1.1 Group settings: sgNC (control group) sg Ubr5 (UBR5 gene knockout group) 1.2 Experimental methods and procedures: (1) Lip2000 transfection reagent: 1 μg of plasmid (purchased from Fenghui Biotechnology) was mixed with 3 μl of transfection reagent and placed at room temperature for 15 min; (2) Add to pre-plated B16F10 cells and incubate for 6 h before replacing the medium with complete medium; (3) After 48 h of culture, add puromycin 1 μg / ml and screen for one week until only a small number of dead cells remain. Then, remove the cells for subsequent testing.

[0035] (4) The sgRNA sequence for UBR5 knockout is: #1 GGGTCTGCCTGCGTGAATCA CGG (SED ID NO1) #2 CAGACCCGCGTCATCCGCAC CGG (SED ID NO2) 1.3 Experimental results: Depend on Figure 2 The mouse melanocyte cell line with UBR5 gene knockdown shown in D was successfully constructed, and Western blot identification results showed that the expression level of UBR5 protein in the gene knockout group was significantly decreased compared with the control group.

[0036] The synthesis methods of sgRNA, siRNA and shRNA sequences in the embodiments are existing methods, and reference can be made to the literature: Bek JW, Shochat C, De Clercq A, De Saffel H, Boel A, Metz J, Rodenburg F, Karasik D, Willaert A, Coucke PJ. Lrp5 Mutant and Crispant Zebrafish Faithfully Model Human Osteoporosis, Establishing the Zebrafish as a Platform for CRISPR-Based Functional Screening of Osteoporosis Candidate Genes. J Bone Miner Res. 2021Sep;36(9):1749-1764. doi: 10.1002 / jbmr.4327 . Epub 2021 May 19. PMID:33957005.

[0037] 2. Construction of human melanocyte cell line with gene silencing / overexpression of UBR5 and identification by Western blot.

[0038] 2.1 Group settings: siNC or Vector (control group) si UBR5 or UBR5 OE (UBR5 gene silencing / overexpression group) 2.2 Experimental methods and procedures: Use lip2000 transfection reagent, mix 100 pmol siRNA with 5 μl transfection reagent, and leave at room temperature for 20 minutes; Add the pre-selected PIG1 and MNT1 cells and change the medium after incubation for 6 h; (3) After 48 h of culture, the cells were harvested for the next experiment.

[0039] (4) The siRNA sequence for UBR5 silencing (purchased from Suzhou Genema Gene Co., Ltd.) is: #1 GCAAGGUUGAAUUGUUUCATT (SED ID NO3) #2 GGUCAUAAGUAGAGAAGAUTT (SED ID NO4) The UBR5 overexpression shRNA sequence (purchased from Suzhou Genema Gene Co., Ltd.) is: ACGUGACACGUUCGGAGAA (SED ID NO5) 2.3 Experimental results: Depend on Figure 3 A. The human melanocyte cell line with gene silencing or overexpression of UBR5 shown in 4A was successfully constructed. Western blot identification results showed that compared with the control group, the expression level of UBR5 protein in the gene silencing / overexpression group was significantly decreased / increased.

[0040] 3. After intervening in UBR5 gene expression, the expression levels of melanogenesis-related genes MITF (microphthalmia-related transcription factor), TRP1 (tyrosinase-related protein 1), TRP2 (tyrosinase-related protein 2), TYR (tyrosinase) and other proteins in melanocytes, as well as the melanin content and tyrosinase activity of melanocytes were detected.

[0041] 3.1 Experimental methods and procedures: Western Blot: Protein was extracted with RIPA lysis buffer (Cat. No.: P0013C, Beyotime) and centrifuged at 12000 rpm for 10 min at 4 °C. Protein concentration was determined by BCA protein assay (Cat. No.: P0010S, Beyotime) and boiled for 5 min before the experiment. 20 μg protein sample was loaded into each well, separated by 10% SDS PAGE (separation gel), and transferred to PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibodies (TYR, TYRP1, TYRP1, MITF, UBR5) at 4 °C overnight. The PVDF membrane was washed with PBST and then incubated with HRP (horseradish peroxidase)-labeled goat anti-rabbit IgG (Cat. No.: AS014, abclonal) or anti-mouse IgG (Cat. No.: AS003, abclonal) secondary antibody for 60 min at room temperature. The bound antibodies were detected by ECL chemiluminescence (Cat. No.: P10300, New Cycle).

[0042] Among them, BCA: bicinchoninic acid; PVDF: polyvinylidene fluoride; BSA: bovine serum albumin; ECL: Electrochemiluminescence.

[0043] (2) Determination of melanin content: PIG1, MNT1, and B16F10 cells (2.5×10 5The cells were collected by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using a microplate reader.

[0044] (3) Tyrosinase activity assay: PIG1, MNT1, and B16F10 cells (2.5×10 5 The cells were plated (10 cells per 35 mm culture dish) and digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μl 1% tritonX100 (Cat. No. A600198-0500, Bioengineering) and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA (Cat. No. 59-92-7, Aladdin) at 37 °C for 20 min, and the absorbance at 475 nm was detected using a microplate reader.

[0045] 3.2 Experimental results: Figure 2 DE, 3A, and 4A showed that compared with the control group, the expression levels of melanogenesis-related genes MITF, TRP1, TRP2, TYR and other proteins in the gene intervention group changed significantly.

[0046] Figure 2 The results of BC, 3BC, and 4BC showed that compared with the control group, there were significant changes in melanin content and tyrosinase activity in the gene intervention group.

[0047] 4. Observe the changes in melanin production ability in the zebrafish model after knocking out the UBR5 gene.

[0048] 4.1 Group settings: sgNC (control group) sg Ubr5 (UBR5 gene knockout group) 4.2 Experimental methods and procedures: The sgRNA sequence for UBR5 knockout was designed as follows: #1 GGGTCTGCCTGCGTGAATCA CGG (SED ID NO1) #2 CAGACCCGCGTCATCCGCAC CGG (SED ID NO2) The sgRNA target was co-injected. The control group was injected with an ineffective target. Wild zebrafish embryos were microinjected at the 1-cell stage. About 200 embryos were injected in each group. After 2 dpf, 15 fish were randomly selected from each group to take pictures of the zebrafish head and analyze the melanin signal intensity of the zebrafish head to evaluate the differential changes in its melanin production.

[0049] 4.3 Experimental results: Depend on Figure 2 As shown in FG, compared with the control group, the intensity of melanin signal in the zebrafish head was significantly decreased after UBR5 knockout.

[0050] 5. High-throughput AI virtual screening of potential small molecule drugs for UBR5 based on drug library 5.1 Experimental methods and procedures: Specifically, it can be obtained through protein docking, and the software Maestro is used to simulate the molecular docking of the target protein and the compound to predict its possible binding sites and interactions. The software Maestro is used to simulate the molecular docking of UBR5 with the compounds in the Seleck compound library (L1200, L1300, L1400, L1700, L1700-1, L3500, L3600, L3800, L3900, L5000, L5800, L7800, L7900) to find compounds that may bind to UBR5.

[0051] 5.2 Experimental results: The results showed that about 30 small molecule compounds all had good binding to the UBR5 enzyme activity center or its surroundings, indicating that these compounds blocked or activated the UBR5 catalytic site to a certain extent, thereby inhibiting or activating the UBR5 enzyme activity. See Table 1 below for details: Table 1 Inhibition or activation of UBR5 enzyme activity by different compounds Compound Name CAS XP GScore MM-GBSA dG Bind (kcal / mol) Ubenimex 58970-76-6 -7.409 -33.97 1-Naphthoacetyl spermine 122306-11-0 -6.893 -49.99 GSK369796 dihydrochloride 1010411-21-8 -6.795 -42.53 Carvedilol 72956-09-3 -6.734 -45.7 CP-91149 186392-40-5 -6.705 -41.55 Naftopidil 57149-07-2 -6.623 -53.69 BN82002 396073-89-5 -6.619 -30.79 Higenamine Hydrochloride 11041-94-4 -6.581 -39.43 Cefuroxime 38821-53-3 -6.565 -49.14 Cefprozil monohydrate 121123-17-9 -6.549 -48.62 Carvedilol 72956-09-3 -6.548 -45.62 Nadolol 42200-33-9 -6.436 -47.2 AR-13324 M1 metabolite 1254032-16-0 -6.432 -42.69 DL-Norepinephrine hydrochloride 55-27-6 -6.394 -32.66 Midodrine 42794-76-3 -6.386 -37.97 Carvedilol phosphate 610309-89-2 -6.37 -50.73 Cefaclor 70356-03-5 -6.369 -49.11 Ampicillin 7177-48-2 -6.367 -49.53 L-ANAP hydrochloride 1313516-26-5 -6.343 -34.36 H-Phe-Phe-OH 2577-40-4 -6.331 -30.91 Zeatin riboside 6025-53-2 -6.213 -33.72 Cephalexin 15686-71-2 -6.197 -48.39 Pindolol 13523-86-9 -6.187 -30.69 Capivasertib 1143532-39-1 -6.17 -44.72 Flapin 146426-40-6 -6.042 -40.44 Ellagic acid 476-66-4 -6.01 -40.65 Omeprazole 73590-58-6 -5.957 -48.39 Inosine 58-63-9 -5.895 -30.69 Thiamphenicol 15318-45-3 -5.89 -35.46 Ractopamine Hydrochloride 90274-24-1 -5.872 -42.66 Nellide hydrochloride 849-55-8 -5.858 -46.12 Dexlansoprazole 138530-94-6 -5.856 -31.76 Cefuroxime 38821-53-3 -5.849 -31.22 Cefuroxime Monohydrate 75975-70-1 -5.849 -31.22 Cefadroxil hydrate 66592-87-8 -5.803 -31.84 Labetalol Hydrochloride 32780-64-6 -5.79 -39.88 A-366 1527503-11-2 -5.766 -40.21

[0052] Example 2 1. Effect of ellagic acid (EA) on proliferation of melanocytes.

[0053] 1.1 Group settings: Control EA 0.1 μM (EA group concentration 1) EA 1 μM (EA group concentration 2) EA 10 μM (EA group concentration 3) EA 50 μM (EA group concentration 4) 1.2 Experimental methods and procedures: (1) CCK8 assay: cells were plated at 5 x 10 3100 µL of culture medium were inoculated into 96-well plates per well, and blank wells were set. EA with gradient concentrations was added and culture was continued for 24 h and 48 h. After the culture was completed, 10 µL of CCK-8 solution (Cat. No.: B34302, selleck) was added to each well (mixed with culture medium at a ratio of 1:10). The 96-well plate was returned to the incubator and incubated in the dark at 37 °C and 5% CO2 for 2-3 h. After the incubation, the absorbance (OD value) of each well was read at a wavelength of 450 nm using a microplate reader.

[0054] 1.3 Experimental results: Figure 5 AB showed that EA bound to the UBR5 enzyme activity center or its periphery and could significantly inhibit the proliferation of melanocyte cell lines in a concentration-dependent and time-dependent manner.

[0055] 2. Western blot was used to identify changes in the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR.

[0056] 2.1 Group settings: Control EA 0.25 μM 24h (EA intervention group 1) EA 0.25 μM 48h (EA intervention group 2) 2.2 Experimental methods and procedures: (1) Western Blot: Protein was extracted with RIPA lysis buffer (Cat. No.: P0013C, Biyuntian) and centrifuged at 12,000 rpm for 10 min at 4 °C. Protein concentration was determined by BCA protein assay and boiled for 5 min before the experiment. 20 μg of protein sample was loaded into each well, separated by 10% SDS PAGE, and transferred to PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibodies (TYR, TYRP1, TYRP1, MiTF, UBR5) at 4 °C overnight. The PVDF membrane was washed with PBST and then incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG secondary antibodies at room temperature for 60 min, and the bound antibodies were detected by ECL chemiluminescence. (The specific method of Western Blot is the same as that in Example 1) 2.3 Experimental results: Depend on Figure 6 As shown in A, after B16F10 cells were treated with EA, Western blot results showed that compared with the control group, the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR in the intervention group was significantly downregulated.

[0057] 3. Determination of the effect of EA on melanin content and tyrosinase activity in melanocytes.

[0058] 3.1 Group settings: Control EA 0.25 μM 24h (EA intervention group 1) EA 0.25 μM 48h (EA intervention group 2) 3.2 Experimental methods and procedures: (1) Determination of melanin content: Melanocyte cell line (2.5×10 5 The cells were harvested by trypsin digestion and centrifugation. The cells were lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using a microplate reader.

[0059] (2) Tyrosinase activity assay: Melanocyte cell line (2.5×10 5 The cells were plated (100 cells per 35 mm culture dish) and digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μL 1% tritonX100 and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37 °C for 20 min, and the absorbance at 475 nm was detected using an enzyme reader.

[0060] 3.3 Experimental results: Figure 6 BC showed that EA could significantly inhibit the melanin content and tyrosinase activity of B16F10 cells.

[0061] 4. In vivo study on the regulatory role of EA in melanogenesis in zebrafish and mouse tail models.

[0062] 4.1 Group settings: Control EA (EA intervention group) Gel-vehicle (blank gel group) Gel-EA (EA gel group) 4.2 Experimental methods and procedures (1) Zebrafish melanin detection: 6 hpf wild-type AB strain zebrafish were randomly selected and placed in a 6-well plate, and 30 zebrafish embryos were treated in each well. EA (concentration 1.95 μg / ml) was given in water and a normal control group was set up. The volume of each well was 3 mL. After 2 days of treatment at 28°C, 5 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. The data were analyzed and collected using Image J advanced image processing software. The melanin signal intensity of the zebrafish head was analyzed, and the whitening effect of the sample was evaluated based on the statistical analysis results of this indicator. The statistical analysis results were expressed as mean ± SEM. SPSS26.0 software was used for statistical analysis.

[0063] (2) Detection of melanin in the mouse tail: The mice were randomly divided into three groups. Except for the control group, no intervention was given. Blank gel and EA gel were applied to a fixed area of ​​the mouse tail every day. After continuous administration for 25 days, the color changes of the drug-coated area of ​​the mouse tail were observed, and the Image J advanced image processing software was used to analyze and collect data, and the grayscale value of the mouse tail was analyzed.

[0064] 4.3 Experimental results: Figure 7 The results showed that EA could significantly inhibit the melanin production in zebrafish embryos and mouse tail skin.

[0065] 5. Determination of the effects of EA structural analogs on melanin content and tyrosinase activity in melanocyte cell lines.

[0066] 5.1 Group settings: Control E1 (punicalagin intervention group) E2 (Corilagin intervention group) E3 (punicalagin intervention group) 5.2 Experimental methods and procedures (1) Cell intervention: B16F10 cell lines were treated with 10 μM punicalagin, corilagin, and punicalagin, respectively. After 24 h, the cells were digested with trypsin for the next experiment.

[0067] (1) Determination of melanin content: B16F10 cells (2.5×10 5 The cells were harvested by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using a microplate reader.

[0068] (2) Tyrosinase activity assay: B16F10 cells (2.5×10 5The cells were plated (100 cells per 35 mm culture dish), digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μl 1% tritonX100 and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37 °C for 20 min, and the absorbance at 475 nm was detected using an enzyme reader.

[0069] 5.3 Experimental results: Figure 8 AB shows that the structural analogues of EA can significantly inhibit the melanin content and tyrosinase activity of the B16F10 melanocyte cell line.

[0070] Example 3 1. Effect of Fipexide Hydrochloride (FH) on proliferation of melanocytes.

[0071] 1.1 Group settings: Control FH 0.1 μM (FH group concentration 1) FH 1 μM (FH group concentration 2) FH 10 μM (FH group concentration 3) FH 50 μM (FH group concentration 4) 1.2 Experimental methods and procedures: (1) CCK8 assay: cells were plated at 5 x 10 3 100 µL of culture medium were inoculated into 96-well plates, and blank wells were set. FH with gradient concentrations was added and culture was continued for 24 h and 48 h. After the culture was completed, 10 µL of CCK-8 solution (mixed with culture medium at a ratio of 1:10) was added to each well. The 96-well plate was returned to the incubator and incubated in the dark at 37 °C and 5% CO2 for 2-3 h. After the incubation, the absorbance (OD value) of each well was read at a wavelength of 450 nm using a microplate reader.

[0072] 1.3 Experimental results: Fig. 9 AB showed that FH bound to the UBR5 enzyme activity center or its periphery and could significantly inhibit the proliferation of melanocyte cell lines in a concentration-dependent and time-dependent manner.

[0073] 2. Western blot was used to identify changes in the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR.

[0074] 2.1 Group settings: Control FH 0.1 μM 24h (FH intervention group 1) FH 0.1 μM 48h (FH intervention group 2) 2.2 Experimental methods and procedures: (1) Western Blot: Protein was extracted with RIPA lysis buffer (Cat. No.: P0013C, Biyuntian) and centrifuged at 12,000 rpm for 10 min at 4 °C. Protein concentration was determined by BCA protein assay and boiled for 5 min before the experiment. 20 μg of protein sample was loaded into each well, separated by 10% SDS PAGE, and transferred to PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibodies (TYR, TYRP1, TYRP1, MiTF, UBR5) at 4 °C overnight. The PVDF membrane was washed with PBST and then incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG secondary antibodies at room temperature for 60 min, and the bound antibodies were detected by ECL chemiluminescence. (The specific method of Western Blot is the same as that in Example 1) 2.3 Experimental results: Depend on Fig.10 As shown in A, after B16F10 cells were treated with FH, Western blot results showed that compared with the control group, the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR in the intervention group was significantly downregulated.

[0075] 3. Determination of the effect of FH on melanin content and tyrosinase activity in melanocytes.

[0076] 3.1 Group settings: Control FH 0.1 μM 24h (FH intervention group 1) FH 0.1 μM 48h (FH intervention group 2) 3.2 Experimental methods and procedures: (1) Determination of melanin content: Melanocyte cell line (2.5×10 5 Cells were collected by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using an ELISA reader.

[0077] (2) Tyrosinase activity assay: Melanocyte cell line (2.5×10 5The cells were plated (100 cells per 35 mm culture dish) and digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μL 1% tritonX100 and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37 °C for 20 min, and the absorbance at 475 nm was detected using an enzyme reader.

[0078] 3.3 Experimental results: Fig.10 BC showed that FH could significantly inhibit the melanin content and tyrosinase activity of B16F10 cells.

[0079] 4. In vivo study on the regulatory role of FH in melanogenesis in zebrafish model.

[0080] 4.1 Group settings: Control FH (FH intervention group) 4.2 Experimental methods and procedures Zebrafish melanin detection: 6 hpf wild-type AB strain zebrafish were randomly selected in a 6-well plate, and 30 zebrafish embryos were treated in each well. FH was given in water, and a normal control group was set up at the same time, with a volume of 3 mL per well. After 2 days of treatment at 28 ℃, 5 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. The Image J advanced image processing software was used to analyze and collect data, and the melanin signal intensity of the zebrafish head was analyzed. The statistical analysis results of this indicator were used to evaluate the whitening effect of the sample. The statistical analysis results were expressed as mean ± SEM. SPSS26.0 software was used for statistical analysis.

[0081] 4.3 Experimental results: Fig.11 These results showed that FH could significantly inhibit the melanogenesis ability of zebrafish embryos.

[0082] 5. Determination of the effects of FH structural analogs on melanin content and tyrosinase activity in melanocyte cell lines.

[0083] 5.1 Group settings: Control F1 (voruciclib group) F2 (Orientin group) F3 (vitexin group) 5.2 Experimental methods and procedures (1) Cell intervention: B16F10 cells were treated with 10 μM voruciclib, orientin, and vitexin, respectively. After 24 h, the cells were digested with trypsin for the next experiment.

[0084] (1) Determination of melanin content: B16F10 cells (2.5×10 5 The cells were harvested by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using an ELISA reader.

[0085] (2) Tyrosinase activity assay: B16F10 cells (2.5×10 5 The cells were plated (100 cells per 35 mm culture dish), digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μl 1% tritonX100 and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37 °C for 20 min, and the absorbance at 475 nm was detected using an enzyme reader.

[0086] 5.3 Experimental results: Fig.12 AB shows that voruciclib, a structural analogue of FH, can significantly upregulate the pigment content and tyrosinase activity in mouse B16F10. Fig.12 C suggests that voruciclib interacts with UBR5.

[0087] The above is a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, can make equivalent replacements or changes according to the technical solutions and concepts of the present invention, which should be covered by the protection scope of the claims of the present invention.

Claims

1. Application of UBR5 in the preparation of drugs for the treatment of pigmented skin diseases.

2. The use according to claim 1, characterized in that The pigmented skin diseases include hyperpigmented skin diseases and hypopigmented skin diseases.

3. The use according to claim 1 or 2, characterized in that: The pigmented skin diseases include pigmented nevi, pigmented spots, and depigmented / hypopigmented spots.

4. The use according to claim 3, characterized in that The pigmented skin diseases include pigmented nevi, congenital pigmented nevi, giant nevi with risk of malignant transformation, chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, vitiligo, and post-inflammatory hypopigmentation.

5. The use according to claim 1 or 2, characterized in that: The application includes the application of the UBR5 inhibitor or UBR5 enhancer in the preparation of a drug for treating pigmented skin diseases.

6. The use according to claim 1 or 2, characterized in that: The UBR5 inhibitor includes UBR5 siRNA, shRNA or sgRNA, and the UBR5 enhancer includes UBR5 shRNA.

7. The use according to claim 1 or 2, characterized in that: The inhibitors or enhancers of UBR5 include Bestatin, 1-naphthylacetyl spermine, GSK369796 dihydrochloride, carvedilol, CP-91149, naftopidil, BN82002, higenamine hydrochloride, cefuroxime, cefprozil monohydrate, carvedilol, nadolol, AR-13324M1 metabolite, DL-norepinephrine hydrochloride, midodrine, carvedilol phosphate, cefaclor, ampicillin, L-ANAP hydrochloride, H-phenylalanine-phenylalanine-OH, zeatin riboside, cephalexin, pindolol, capivasertib, flavopiridol, ellagic acid, omeprazole, inosine, thiamphenicol, ractopamine hydrochloride, neridrin hydrochloride, dexlansoprazole, cephradine, cephradine monohydrate, cefadroxil hydrate, labetalol hydrochloride, A-366.

8. Application of UBR5 in the preparation of inhibitors or activators for regulating melanogenesis.

9. Application of UBR5 in the preparation of tyrosinase activity inhibitors or enhancers.

Images