Use of ubr5 in the preparation of a medicament for treating a pigmented skin disease

By regulating UBR5 enzyme activity and utilizing UBR5 inhibitors or enhancers, the treatment challenges of pigmentary skin diseases have been solved, achieving effective regulation of melanin production and therapeutic effects for pigmentary diseases.

CN119700983BActive Publication Date: 2025-10-21XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510022727.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-07
Publication Date
2025-10-21
Estimated Expiration
2045-01-07

AI Technical Summary

Technical Problem

Existing treatments for pigmentary skin diseases have limited effectiveness, lacking safe and effective therapeutic targets and drugs. Traditional surgical and drug treatments are insufficient to address the problem of abnormal pigment deposition or uneven distribution.

Method used

By utilizing UBR5 as an E3 ubiquitin ligase, the expression of melanin production-related genes can be regulated by inhibiting or enhancing UBR5 siRNA, shRNA, or sgRNA. UBR5 inhibitors or enhancers can be developed for the preparation of drugs to treat pigmented skin diseases. They can also be combined with small molecule compounds such as ellagic acid and frappindole to target melanin production.

Benefits of technology

It significantly regulates melanin production, inhibits or increases melanin content and tyrosinase activity in melanocytes, and effectively treats pigmented skin diseases such as nevus and piebaldism, providing a new treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application provides application of UBR5 in preparation of a drug for treating pigmented skin diseases, and further the pigmented skin diseases include various types of pigmented nevus (mainly congenital pigmented nevus and giant nevus with the risk of malignant transformation), various pigmented spots (mainly chloasma, freckle, nevus spilus, post-inflammatory pigmentation and the like) and hypopigmentation / loss of pigmentation spots (mainly vitiligo, post-inflammatory hypopigmentation and the like). The experimental results of the application show that UBR5 is highly expressed in the tissues of diseases such as pigmented nevus. The expression level of UBR5 is significantly positively correlated with the melanogenesis capacity, the expression level of proteins such as MITF, TRP1, TRP2 and TYR related to melanogenesis is significantly inhibited by targeted knockout / knockdown of UBR5 in melanocytes, the melanin content and tyrosinase activity of the melanocytes, and vice versa, the melanogenesis capacity of the melanocytes is significantly increased after overexpression of UBR5.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the application of UBR5 in preparing a drug for treating pigmented skin diseases. Background Art

[0002] Pigmentary skin diseases are caused by a variety of factors, including heredity, gene mutations, external stimuli, drugs, diet and daily routines. They can lead to abnormal differentiation, proliferation and migration of melanocytes in the skin, and disorders in melanin synthesis, secretion and transport. These skin diseases are very common in dermatology. Although most pigmentary skin diseases are not life-threatening, there is still a certain proportion of congenital diseases that carry the risk of melanoma malignancy. Large skin lesions in special areas are often difficult to surgically remove and there is a risk of disfigurement or functional impairment, which will ultimately seriously affect appearance, daily work, study and life, and may even lead to death. This brings huge psychological, physical and financial burdens to patients. As people pay more attention to their physical and mental health and appearance, more and more patients are beginning to pay attention to early intervention and non-surgical treatments for pigmentary skin diseases. Common pigmented skin diseases in clinical practice include various types of pigmented nevi (primarily congenital pigmented nevi and giant nevi with a risk of malignant transformation), various pigmented spots (primarily melasma, freckles, nevus of Ota, and post-inflammatory hyperpigmentation), and hypopigmented / hypopigmented spots (primarily vitiligo and post-inflammatory hypopigmentation). However, traditional treatments such as surgery, laser therapy, and conventional medications have limited efficacy, and finding safe and effective treatment strategies remains a significant challenge for clinicians. Therefore, the search for new therapeutic targets and the development of new drugs and treatment strategies are urgent.

[0003] Melanogenesis is a complex biological process involving melanocyte differentiation, proliferation, migration, and melanin synthesis, secretion, and transport. This process not only determines the color of skin, hair, and eyes but is also closely linked to various skin diseases, particularly those involving abnormal melanin deposition. Melanocytes originate from neural crest cells during the embryonic period and function by migrating to the skin and hair follicles. During differentiation, the Wnt signaling pathway, regulatory factors such as SOX10 and MITF play crucial roles. MITF regulates the expression of melanin synthesizing enzymes such as tyrosinase (TYR). Melanocyte proliferation is regulated by the MC1R pathway, with cAMP signals promoting proliferation and maintaining skin pigmentation stability. Migration is dependent on the extracellular matrix and chemokines. Abnormal migration can lead to localized pigment loss or aggregation, such as in mottling. Melanin synthesis occurs within melanosomes, where enzymes such as TYR catalyze the oxidation of tyrosine to form melanin. There are two main types of melanin: eumelanin and pheomelanin, and the ratio of these two types determines skin and hair color. MITF ensures melanin synthesis by regulating the expression of synthase genes. The resulting melanin is transported to neighboring keratinocytes via the cytoskeleton and transport proteins, where it is distributed on the skin's surface. GTPases such as Rab27a are involved in this transport process, and any abnormalities in this process can lead to pigmentation disorders, such as Griscelli syndrome.

[0004] Melanocyte differentiation, proliferation, migration, melanin synthesis, and transport are precisely regulated during melanogenesis. Disruptions in any of these processes can lead to abnormal melanin deposition or uneven distribution, which in turn can cause a variety of pigmentary disorders, including vitiligo, an autoimmune disease in which the immune system attacks melanocytes, causing skin depigmentation and the formation of white spots; various pigmented spots such as freckles and melasma, acanthosis nigricans, skin aging, and photoaging; and congenital nevi, in which abnormal melanocyte proliferation during the embryonic period leads to the formation of pigmented areas on the skin's surface. While most are benign, larger congenital nevi may be at risk for malignant transformation. In-depth understanding of these mechanisms not only helps explain the occurrence of pigmentary disorders but also provides a basis for the development of new treatment strategies.

[0005] UBR5 (also known as EDD1) is a key member of the E3 ubiquitin ligase family and participates in the ubiquitin-proteasome pathway to regulate the degradation of multiple proteins within the cell. As an E3 ubiquitin ligase, UBR5 regulates protein homeostasis by binding to specific substrates and attaching ubiquitin molecules to these proteins, marking them for degradation in the proteasome. UBR5 has a wide range of functions, involving multiple biological processes such as cell cycle control, DNA damage response, gene transcription regulation, and signal transduction. It is closely related to various diseases, particularly in the pathological mechanisms of cancer, neurodegenerative diseases, and inflammation. However, no studies have yet described the effects and mechanisms of UBR5 on melanogenesis in melanocytes. Summary of the Invention

[0006] In response to the shortcomings of existing technologies, this study aims to provide new targets for the treatment of pigmented skin diseases, further explore the impact of UBR5 on the melanogenesis function of melanocytes and its specific regulatory mechanism, and provide new ideas for the preparation of drugs for the treatment of pigmented skin diseases.

[0007] The technical solution of the present invention is:

[0008] Application of UBR5 in the preparation of drugs for treating pigmented skin diseases.

[0009] Preferably, the pigmented skin disease includes hyperpigmented skin disease and hypopigmented skin disease.

[0010] Preferably, the pigmented skin diseases include pigmented nevi, pigmented spots, and depigmented / hypopigmented spots.

[0011] Preferably, the pigmented skin diseases include pigmented nevi, congenital pigmented nevi, giant nevi with a risk of malignant transformation, chloasma, freckles, nevus of Ota, post-inflammatory hyperpigmentation, vitiligo, and post-inflammatory hypopigmentation.

[0012] Preferably, the application includes the use of a UBR5 inhibitor or a UBR5 enhancer in the preparation of a drug for treating pigmented skin diseases.

[0013] The pigmented skin diseases include various types of pigmented nevi (mainly congenital pigmented nevi and giant nevi with the risk of malignant transformation), various pigmented spots (mainly chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, etc.) and hypopigmentation / loss spots (mainly vitiligo, post-inflammatory hypopigmentation, etc.).

[0014] Preferably, the UBR5 inhibitor includes UBR5 siRNA, shRNA or sgRNA, and the UBR5 enhancer includes UBR5 shRNA.

[0015] The present invention also provides the use of UBR5 in preparing an inhibitor or activator for regulating melanogenesis. Furthermore, the present invention also provides the use of a UBR5 inhibitor or UBR5 enhancer in preparing an inhibitor or activator for regulating melanogenesis. Furthermore, the UBR5 inhibitor includes siRNA, shRNA, or sgRNA targeting UBR5, and the UBR5 enhancer includes shRNA targeting UBR5.

[0016] The present invention also provides the use of UBR5 in preparing a tyrosinase activity inhibitor or enhancer. Furthermore, the present invention includes the use of a UBR5 inhibitor or enhancer in preparing a tyrosinase activity inhibitor or enhancer. Furthermore, the UBR5 inhibitor includes siRNA, shRNA, or sgRNA targeting UBR5, and the UBR5 enhancer includes shRNA targeting UBR5.

[0017] Further preferably, the inhibitors or enhancers of UBR5 include ubenimex, 1-naphthylacetyl spermine, GSK369796 dihydrochloride, carvedilol, CP-91149, naftopidil, BN82002, higenamine hydrochloride, cephradine, cefprozil monohydrate, carvedilol, nadolol, AR-13324 M1 metabolite, DL-norepinephrine hydrochloride, midodrine, carvedilol phosphate, cefaclor, ampicillin, A-366, L-ANAP hydrochloride, H-phenylalanine-phenylalanine-OH, zeatin riboside, cephalexin, pindolol, capivasertib, flavopiridol, ractopamine hydrochloride, neridin hydrochloride, dexlansoprazole, cephradine, cephradine monohydrate, cefadroxil hydrate, labetalol hydrochloride, A-366.

[0018] The experimental results of the present invention found that:

[0019] 1. UBR5 is highly expressed in disease tissues such as pigmented nevi.

[0020] 2. The expression level of UBR5 is significantly positively correlated with the ability to produce melanin. Targeted knockout / knockdown of UBR5 in melanocytes can significantly inhibit the expression levels of melanogenesis-related genes such as MITF, TRP1, TRP2, TYR, and other proteins, as well as the melanin content and tyrosinase activity of melanocytes. Vice versa, overexpression of UBR5 significantly increases the melanogenesis ability of melanocytes.

[0021] 3. The present invention discovered that approximately 30 small molecule compounds bind well to or around the active center of the UBR5 enzyme. This suggests that these compounds block or activate the UBR5 catalytic site to a certain extent, thereby inhibiting or activating UBR5 enzyme activity. In particular, small molecule drugs such as ellagic acid and flavopiridol and their analogs hold promise as UBR5-targeted drugs for the treatment of pigmented skin diseases.

[0022] The results of this study suggest that UBR5 is a potential important therapeutic target in regulating the process of melanogenesis. The development of drugs or reagents that regulate UBR5 expression levels is expected to provide new ideas and strategies for the treatment of pigmented skin diseases.

[0023] The detailed structure of the present invention is further described below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a differential analysis chart of the transcriptome sequencing data of skin tissue (left) and nevus tissue (right) in the GTEX database. After log2 transformation, the wilcox.test was used to compare the mRNA expression levels of UBR5 between the two groups.

[0025] Figure 2 This is the test result after knocking out UBR5 in B16F10 cells: Figure 2 A is the color change diagram of centrifugal precipitation; Figure 2 B is a graph showing changes in intracellular melanin content; Figure 2 C is a graph showing changes in tyrosinase activity; Figure 2 D. Western blot method was used to detect the expression changes of the important transcription factor MITF and the key proteins TRP1, TRP2 and TYR in cells. Figure 2 E is Figure 2 Statistical chart of D; Figure 2 F, 2G, after UBR5 was knocked out in zebrafish, the intensity of melanin signal in the head and its statistical graph were detected;

[0026] Figure 3 This is the result of Western blot analysis after inhibiting UBR5 expression; Figure 3 A is the expression diagram of MITF, an important transcription factor in the melanin synthesis pathway, and TRP1, TRP2 and TYR, key proteins in melanin synthesis, in PIG1 and MNT1 cells. Figure 3 B. Figure 3 C is a statistical graph showing changes in melanin content and tyrosinase activity;

[0027] Figure 4 This is the result of Western blot analysis of overexpressed UBR5. Figure 4 A is the expression diagram of MITF, an important transcription factor in the melanin synthesis pathway, and TRP1, TRP2 and TYR, key proteins in melanin synthesis, in PIG1 and MNT1 cells. Figure 4 B. Figure 4 C is a statistical graph showing the changes in melanin content and tyrosinase activity in MNT1 cells.

[0028] Figure 5 A is the 3D image of EA docking with UBR5 protein. Figure 5 B is a graph showing the proliferation activity of B16F10 cell lines detected by CCK8 assay after culture with medium containing different concentrations of EA for 24 h and 48 h.

[0029] Figure 6 A is a graph showing the protein expression levels of melanogenesis-related genes such as MITF, TYR, TYRP1, and TYRP1 detected by Western blot after B16F10 cell lines were treated with specific concentrations of EA; Figure 6 B. Figure 6 C is the result of simultaneous detection of changes in melanin content and tyrosinase activity.

[0030] Figure 7 A. Figure 7 B shows the melanin signal intensity and its statistical results of the zebrafish head at 2 dpf after culturing zebrafish embryos with culture medium containing a specific concentration of EA. Figure 7 C. Figure 7 D. EA was made into a 2 mg / ml hydrogel and applied to a fixed position on the mouse tail. The changes in the color of the mouse tail were observed for 25 days and the statistical results are shown in the figure.

[0031] Figure 8 A. Figure 8 B is the treatment of B16F10 cell line with specific concentrations of EA analogs E1, E2, and E3, and the melanin content was detected ( Figure 8 A) and tyrosinase activity changes ( Figure 8 B).

[0032] Figure 9 A is the 3D image of FH docking with UBR5 protein. Figure 9 B is a graph showing the proliferation activity of B16F10 cell lines detected by CCK8 assay after culture with medium containing different concentrations of FH for 24 h and 48 h.

[0033] Figure 10 A is a graph showing the protein expression levels of melanogenesis-related genes such as MITF, TYR, TYRP1, and TYRP1 detected by Western blot after B16F10 cell lines were treated with specific concentrations of FH; Figure 10 B is a graph showing the results of melanin content testing; Figure 10 C is a graph showing the results of detecting changes in tyrosinase activity.

[0034] Figure 11 After culturing zebrafish embryos with culture medium containing a specific concentration of FH, the melanin signal intensity of the zebrafish head was observed at 2 dpf ( Figure 11 A) and its statistical results ( Figure 11 B).

[0035] Figure 12 To treat B16F10 cell lines with specific concentrations of FH analogs F1, F2, and F3, and to detect the melanin content ( Figure 12 A) and tyrosinase activity changes ( Figure 12 B); Figure 12 C is a schematic diagram of the molecular docking of voruciclib and UBR5. DETAILED DESCRIPTION Example 1

[0036] 1. Construction of a mouse melanocyte cell line with UBR5 gene knockout and identification by Western blot.

[0037] 1.1 Group settings:

[0038] sgNC (control group)

[0039] sg Ubr5 (UBR5 gene knockout group)

[0040] 1.2 Experimental methods and procedures:

[0041] (1) Lip2000 transfection reagent: 1 μg of plasmid (purchased from Fenghui Bio) was mixed with 3 μl of transfection reagent and allowed to stand at room temperature for 15 min.

[0042] (2) Add to pre-selected B16F10 cells and incubate for 6 h before replacing the medium with complete culture medium;

[0043] (3) After 48 h of culture, add puromycin 1 μg / ml and screen for one week until only a small number of dead cells remain. Then, remove the cells for subsequent testing.

[0044] (4) The sgRNA sequence for UBR5 knockout is:

[0045] #1 GGGTCTGCCTGCGTGAATCA CGG (SED ID NO1)

[0046] #2 CAGACCCGCGTCATCCGCAC CGG (SED ID NO2)

[0047] 1.3 Experimental results:

[0048] Depend on Figure 2 The mouse melanocyte cell line with UBR5 gene knockdown shown in D was successfully constructed, and Western blot identification results showed that the expression level of UBR5 protein in the gene knockout group was significantly decreased compared with the control group.

[0049] The methods for synthesizing sgRNA, siRNA, and shRNA sequences in the examples are existing methods, and reference can be made to the literature: Bek JW, Shochat C, De Clercq A, De Saffel H, Boel A, Metz J, Rodenburg F, Karasik D, Willaert A, Coucke PJ. Lrp5 Mutant and Crispant Zebrafish Faithfully Model Human Osteoporosis, Establishing the Zebrafish as a Platform for CRISPR-Based Functional Screening of Osteoporosis Candidate Genes. J Bone Miner Res. 2021Sep;36(9):1749-1764. doi: 10.1002 / jbmr.4327 . Epub 2021 May 19. PMID:33957005.

[0050] 2. Construction of human melanocyte cell line with gene silencing / overexpression of UBR5 and Western blot identification.

[0051] 2.1 Group settings:

[0052] siNC or Vector (control group)

[0053] si UBR5 or UBR5 OE (UBR5 gene silencing / overexpression group)

[0054] 2.2 Experimental methods and procedures:

[0055] Use lip2000 transfection reagent, mix 100 pmol siRNA with 5 μl transfection reagent, and let it stand at room temperature for 20 minutes;

[0056] Add pre-selected plated PIG1 and MNT1 cells, incubate for 6 h, and then change the medium;

[0057] (3) After 48 h of culture, the cells were harvested for the next experiment.

[0058] (4) The siRNA sequence for UBR5 silencing (purchased from Suzhou Genema Gene Co., Ltd.) is:

[0059] #1 GCAAGGUUGAAUUGUUUCATT (SED ID NO3)

[0060] #2 GGUCAUAAGUAGAGAAGAUTT (SED ID NO4)

[0061] The UBR5 overexpression shRNA sequence (purchased from Suzhou Genema Gene Co., Ltd.) is: ACGUGACACGUUCGGAGAA (SED ID NO5)

[0062] 2.3 Experimental results:

[0063] Depend on Figure 3 A. Human melanocyte cell lines with gene silencing or overexpression of UBR5 shown in 4A were successfully constructed. Western blot identification results showed that compared with the control group, the expression level of UBR5 protein in the gene silencing / overexpression group was significantly decreased / increased.

[0064] 3. After intervening in UBR5 gene expression, the expression levels of melanin production-related genes MITF (microphthalmia-related transcription factor), TRP1 (tyrosinase-related protein 1), TRP2 (tyrosinase-related protein 2), TYR (tyrosinase) and other proteins in melanocytes, as well as the melanin content and tyrosinase activity of melanocytes were detected.

[0065] 3.1 Experimental methods and procedures:

[0066] Western Blot: Proteins were extracted using RIPA lysis buffer (Cat. No. P0013C, Beyotime) and centrifuged at 12,000 rpm for 10 min at 4°C. Protein concentration was determined using the BCA protein assay (Cat. No. P0010S, Beyotime). The membranes were boiled for 5 min before the experiment. 20 μg of protein sample was loaded per well, separated by 10% SDS-PAGE, and transferred to a PVDF membrane. After blocking with 5% BSA for 2 h, the membranes were incubated with primary antibodies (TYR, TYRP1, TYRP1, MITF, and UBR5) overnight at 4°C. The PVDF membrane was washed with PBST and then incubated with HRP (horseradish peroxidase)-conjugated goat anti-rabbit IgG (Cat. No.: AS014, abclonal) or anti-mouse IgG (Cat. No.: AS003, abclonal) secondary antibody for 60 min at room temperature. The bound antibodies were detected by ECL chemiluminescence (Cat. No.: P10300, New Cycle).

[0067] Among them, BCA: bicinchoninic acid; PVDF: polyvinylidene fluoride; BSA: bovine serum albumin; ECL: electrochemiluminescence.

[0068] (2) Determination of melanin content: PIG1, MNT1, and B16F10 cells (2.5×10 5 Cells were seeded on plates (100 cells per 35 mm culture dish), digested with trypsin, and collected by centrifugation. The cells were lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min, and the absorbance was measured at 470 nm using a microplate reader.

[0069] (3) Tyrosinase activity assay: PIG1, MNT1, and B16F10 cells (2.5×10 5 Cells were plated (100 cells per 35 mm culture dish) and trypsinized, centrifuged, and collected. The cells were lysed with 200 μl of 1% triton X100 (Cat. No. A600198-0500, Sangon) and immediately placed at -80°C for 30 min. The cells were taken out and thawed at 37°C. The supernatant was centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA (Cat. No. 59-92-7, Aladdin) at 37°C for 20 min. The absorbance at 475 nm was measured using a microplate reader.

[0070] 3.2 Experimental results:

[0071] Figure 2 DE, 3A, and 4A showed that compared with the control group, the expression levels of melanogenesis-related genes MITF, TRP1, TRP2, TYR and other proteins in the gene intervention group changed significantly.

[0072] Figure 2 The results of BC, 3BC, and 4BC showed that compared with the control group, the melanin content and tyrosinase activity in the gene intervention group showed significant changes.

[0073] 4. Observe the changes in melanin production ability in the zebrafish model after knocking out the UBR5 gene.

[0074] 4.1 Group settings:

[0075] sgNC (control group)

[0076] sg Ubr5 (UBR5 gene knockout group)

[0077] 4.2 Experimental methods and procedures:

[0078] The sgRNA sequence for UBR5 knockout was designed as follows:

[0079] #1 GGGTCTGCCTGCGTGAATCA CGG (SED ID NO1)

[0080] #2 CAGACCCGCGTCATCCGCAC CGG (SED ID NO2)

[0081] The sgRNA target sites were co-injected. A control group received ineffective target injections. Wild-type zebrafish embryos were microinjected at the 1-cell stage, with approximately 200 embryos injected per group. After 2 dpf, 15 fish were randomly selected from each group to photograph their heads. Melanin signal intensity was analyzed to assess differential changes in melanogenesis.

[0082] 4.3 Experimental Results

[0083] Depend on Figure 2 As shown in FG, compared with the control group, the intensity of melanin signal in the zebrafish head was significantly decreased after knocking out UBR5.

[0084] 5. High-throughput AI virtual screening of potential small molecule drugs for UBR5 based on drug library

[0085] 5.1 Experimental methods and procedures:

[0086] This can be achieved through protein docking, using the Maestro software to simulate molecular docking between target proteins and compounds to predict their possible binding sites and interactions. Maestro was used to simulate molecular docking of UBR5 with compounds in the Seleck compound library (L1200, L1300, L1400, L1700, L1700-1, L3500, L3600, L3800, L3900, L5000, L5800, L7800, and L7900) to identify compounds that may bind to UBR5.

[0087] 5.2 Experimental Results

[0088] The results showed that approximately 30 small molecule compounds all had good binding to the UBR5 enzyme active center or its surroundings, indicating that these compounds blocked or activated the UBR5 catalytic site to a certain extent, thereby inhibiting or activating the UBR5 enzyme activity. See Table 1 below for details:

[0089]

[0090] Example 2

[0091] 1. Effect of ellagic acid (EA) on the proliferation of melanocytes.

[0092] 1.1 Group settings:

[0093] Control

[0094] EA 0.1 μM (EA group concentration 1)

[0095] EA 1 μM (EA group concentration 2)

[0096] EA 10 μM (EA group concentration 3)

[0097] EA 50 μM (EA group concentration 4)

[0098] 1.2 Experimental methods and procedures:

[0099] (1) CCK8 assay: Cells were plated at 5 x 10 3 Inoculate 100 µL of culture medium per well in a 96-well plate, and set aside a blank well. Add gradients of EA and continue incubation for 24 and 48 hours. After the incubation period, add 10 µL of CCK-8 solution (Cat. No. B34302, Selleck) to each well (mixed at a 1:10 ratio with culture medium). Return the 96-well plate to the incubator and incubate in the dark at 37°C, 5% CO₂ for 2-3 hours. After incubation, read the absorbance (OD) of each well at 450 nm using a microplate reader.

[0100] 1.3 Experimental results:

[0101] Figure 5 AB showed that EA bound to the UBR5 enzyme active center or its surroundings and could significantly inhibit the proliferation of melanocyte cell lines in a concentration-dependent and time-dependent manner.

[0102] 2. Western blot was used to identify changes in the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR.

[0103] 2.1 Group settings:

[0104] Control

[0105] EA 0.25 μM 24h (EA intervention group 1)

[0106] EA 0.25 μM 48h (EA intervention group 2)

[0107] 2.2 Experimental methods and procedures:

[0108] (1) Western Blot: Protein was extracted using RIPA lysis buffer (Cat. No.: P0013C, Biyuntian) and centrifuged at 12,000 rpm for 10 min at 4°C. Protein concentration was determined by BCA protein assay and the samples were boiled for 5 min before the experiment. 20 μg of protein sample was loaded into each well, separated by 10% SDS PAGE, and transferred to a PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibodies (TYR, TYRP1, TYRP1, MiTF, UBR5) at 4°C overnight. The PVDF membrane was washed with PBST and then incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG secondary antibodies at room temperature for 60 min. The bound antibodies were detected by ECL chemiluminescence. (The specific method of Western Blot is the same as that in Example 1)

[0109] 2.3 Experimental results:

[0110] Depend on Figure 6 As shown in A, after B16F10 cells were treated with EA, Western blot results showed that compared with the control group, the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR in the intervention group was significantly downregulated.

[0111] 3. Determination of the effect of EA on melanin content and tyrosinase activity in melanocytes.

[0112] 3.1 Group settings:

[0113] Control

[0114] EA 0.25 μM 24h (EA intervention group 1)

[0115] EA 0.25 μM 48h (EA intervention group 2)

[0116] 3.2 Experimental methods and procedures:

[0117] (1) Determination of melanin content: Melanocyte cell line (2.5×10 5 Cells were seeded on a 35 mm culture dish (100 cells per dish), digested with trypsin, and collected by centrifugation. The cells were lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min, and the absorbance was measured at 470 nm using a microplate reader.

[0118] (2) Tyrosinase activity assay: Melanocyte cell line (2.5×10 5Cells were seeded on a 35 mm culture dish (100 cells per 35 mm dish) and trypsinized, centrifuged, and collected. The cells were lysed with 200 μL of 1% triton X100 and immediately placed at -80°C for 30 min. The cells were taken out and thawed at 37°C. The supernatant was centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37°C for 20 min. The absorbance at 475 nm was measured using a microplate reader.

[0119] 3.3 Experimental results:

[0120] Figure 6 BC showed that EA could significantly inhibit the melanin content and tyrosinase activity of B16F10 cells.

[0121] 4. In vivo study of the regulatory role of EA in melanogenesis in zebrafish and mouse tail models.

[0122] 4.1 Group settings:

[0123] Control

[0124] EA (EA intervention group)

[0125] Gel-vehicle (blank gel group)

[0126] Gel-EA (EA gel group)

[0127] 4.2 Experimental methods and procedures

[0128] (1) Zebrafish melanin detection: 6 hpf wild-type AB strain zebrafish were randomly selected and placed in a 6-well plate, with 30 zebrafish embryos treated in each well. EA (concentration 1.95 μg / ml) was administered in water, and a normal control group was set up. The volume of each well was 3 mL. After 2 days of treatment at 28°C, 5 zebrafish were randomly selected from each experimental group and photographed under a dissecting microscope. The data were analyzed and collected using Image J advanced image processing software. The melanin signal intensity of the zebrafish head was analyzed, and the whitening efficacy of the sample was evaluated based on the statistical analysis results of this indicator. The statistical analysis results were expressed as mean ± SEM. Statistical analysis was performed using SPSS 26.0 software.

[0129] (2) Detection of melanin in the mouse tail: The mice were randomly divided into three groups. Except for the control group, no intervention was performed. Blank gel and EA gel were applied to a fixed area of ​​the mouse tail every day. After 25 consecutive days of administration, the color changes of the drug-applied area of ​​the mouse tail were observed, and the Image J advanced image processing software was used to analyze and collect data and analyze the grayscale value of the mouse tail.

[0130] 4.3 Experimental results: Figure 7 The results showed that EA could significantly inhibit the melanin production ability of zebrafish embryos and mouse tail skin.

[0131] 5. Determination of the effects of EA structural analogues on melanin content and tyrosinase activity in melanocyte cell lines.

[0132] 5.1 Group settings:

[0133] Control

[0134] E1 (punicalagin intervention group)

[0135] E2 (Corilagin intervention group)

[0136] E3 (punicalagin intervention group)

[0137] 5.2 Experimental methods and procedures

[0138] (1) Cell intervention: B16F10 cell lines were treated with 10 μM punicalagin, corilagin, and punicalagin, respectively. After 24 h, the cells were trypsinized and used for the next experiment.

[0139] (1) Determination of melanin content: B16F10 cells (2.5×10 5 Cells were seeded on plates (100 cells per 35 mm culture dish), digested with trypsin, and collected by centrifugation. The cells were lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min, and the absorbance was measured at 470 nm using a microplate reader.

[0140] (2) Tyrosinase activity assay: B16F10 cells (2.5×10 5 Cells were seeded on a plate (100 cells per 35 mm culture dish), digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μl of 1% triton X100 and immediately placed at -80°C for 30 min. The cells were taken out and thawed at 37°C. The supernatant was centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37°C for 20 min. The absorbance at 475 nm was measured using a microplate reader.

[0141] 5.3 Experimental Results Figure 8 AB showed that the structural analogues of EA could significantly inhibit the melanin content and tyrosinase activity of B16F10 melanocyte cell line.

[0142] Example 3

[0143] 1. Effect of flavopiridol hydrochloride (FH) on proliferation of melanocytes.

[0144] 1.1 Group settings:

[0145] Control

[0146] FH 0.1 μM (FH group concentration 1)

[0147] FH 1 μM (FH group concentration 2)

[0148] FH 10 μM (FH group concentration 3)

[0149] FH 50 μM (FH group concentration 4)

[0150] 1.2 Experimental methods and procedures:

[0151] (1) CCK8 assay: Cells were plated at 5 x 10 3 Inoculate 100 µL of culture medium per well in a 96-well plate, and set aside a blank well. Add gradient concentrations of FH and continue incubation for 24 and 48 hours. At the end of the incubation period, add 10 µL of CCK-8 solution (mixed at a 1:10 ratio with culture medium) to each well. Return the 96-well plate to the incubator and incubate in the dark at 37°C, 5% CO₂ for 2-3 hours. After incubation, read the absorbance (OD) of each well at 450 nm using a microplate reader.

[0152] 1.3 Experimental results:

[0153] Figure 9 AB showed that FH bound to the UBR5 enzyme active center or its surroundings and could significantly inhibit the proliferation of melanocyte cell lines in a concentration-dependent and time-dependent manner.

[0154] 2. Western blot was used to identify changes in the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR.

[0155] 2.1 Group settings:

[0156] Control

[0157] FH 0.1 μM 24h (FH intervention group 1)

[0158] FH 0.1 μM 48h (FH intervention group 2)

[0159] 2.2 Experimental methods and procedures:

[0160] (1) Western Blot: Protein was extracted using RIPA lysis buffer (Cat. No.: P0013C, Biyuntian) and centrifuged at 12,000 rpm for 10 min at 4°C. Protein concentration was determined by BCA protein assay and the samples were boiled for 5 min before the experiment. 20 μg of protein sample was loaded into each well, separated by 10% SDS PAGE, and transferred to a PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibodies (TYR, TYRP1, TYRP1, MiTF, UBR5) at 4°C overnight. The PVDF membrane was washed with PBST and then incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG secondary antibodies at room temperature for 60 min. The bound antibodies were detected by ECL chemiluminescence. (The specific method of Western Blot is the same as that in Example 1)

[0161] 2.3 Experimental results:

[0162] Depend on Figure 10 As shown in A, after B16F10 cells were treated with FH, Western blot results showed that compared with the control group, the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR in the intervention group was significantly downregulated.

[0163] 3. Determination of the effect of FH on melanin content and tyrosinase activity in melanocytes.

[0164] 3.1 Group settings:

[0165] Control

[0166] FH 0.1 μM 24h (FH intervention group 1)

[0167] FH 0.1 μM 48h (FH intervention group 2)

[0168] 3.2 Experimental methods and procedures:

[0169] (1) Determination of melanin content: Melanocyte cell line (2.5×10 5 Cells were seeded on plates (per 35 mm culture dish), digested with trypsin, and collected by centrifugation. The cells were lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min, and the absorbance was measured at 470 nm using a microplate reader.

[0170] (2) Tyrosinase activity assay: Melanocyte cell line (2.5×10 5Cells were seeded on a 35 mm culture dish (100 cells per 35 mm dish) and trypsinized, centrifuged, and collected. The cells were lysed with 200 μL of 1% triton X100 and immediately placed at -80°C for 30 min. The cells were taken out and thawed at 37°C. The supernatant was centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37°C for 20 min. The absorbance at 475 nm was measured using a microplate reader.

[0171] 3.3 Experimental results:

[0172] Figure 10 BC showed that FH could significantly inhibit the melanin content and tyrosinase activity of B16F10 cells.

[0173] 4. In vivo study of the role of FH in regulating melanogenesis in zebrafish models.

[0174] 4.1 Group settings:

[0175] Control

[0176] FH (FH intervention group)

[0177] 4.2 Experimental methods and procedures

[0178] Zebrafish melanin assay: 6 hpf wild-type AB strain zebrafish were randomly selected and plated in a 6-well plate, with 30 zebrafish embryos treated per well. FH was administered in water, and a normal control group was also established. Each well contained 3 mL of FH. After two days of treatment at 28°C, five zebrafish were randomly selected from each experimental group and photographed under a dissecting microscope. Data were analyzed and collected using Image J advanced image processing software. The intensity of melanin signals in the zebrafish heads was analyzed, and the whitening efficacy of the samples was evaluated using statistical analysis of this indicator. Statistical results are expressed as mean ± SEM. Statistical analysis was performed using SPSS 26.0 software.

[0179] 4.3 Experimental results: Figure 11 These results showed that FH could significantly inhibit the melanogenesis ability of zebrafish embryos.

[0180] 5. Determination of the effects of FH structural analogues on melanin content and tyrosinase activity in melanocyte cell lines.

[0181] 5.1 Group settings:

[0182] Control

[0183] F1 (voruciclib group)

[0184] F2 (orientin group)

[0185] F3 (vitexin group)

[0186] 5.2 Experimental methods and procedures

[0187] (1) Cell intervention: B16F10 cell lines were treated with 10 μM voruciclib, orientin, and vitexin, respectively. After 24 h, the cells were trypsinized and used for the next experiment.

[0188] (1) Determination of melanin content: B16F10 cells (2.5×10 5 Cells were seeded on plates (100 cells per 35 mm culture dish), digested with trypsin, and collected by centrifugation. The cells were lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min, and the absorbance was measured at 470 nm using a microplate reader.

[0189] (2) Tyrosinase activity assay: B16F10 cells (2.5×10 5 Cells were seeded on a plate (100 cells per 35 mm culture dish), digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μl of 1% triton X100 and immediately placed at -80°C for 30 min. The cells were taken out and thawed at 37°C. The supernatant was centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37°C for 20 min. The absorbance at 475 nm was measured using a microplate reader.

[0190] 5.3 Experimental Results

[0191] Figure 12 AB shows that voruciclib, a structural analogue of FH, can significantly upregulate the pigment content and tyrosinase activity in mouse B16F10. Figure 12 C suggests that voruciclib interacts with UBR5.

[0192] The above is a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solutions and concepts of the present invention, should be covered by the scope of protection of the claims of the present invention.

Claims

1. Use of a UBR5 inhibitor in the preparation of a drug for treating pigmented skin diseases, wherein the UBR5 inhibitor comprises siRNA and sgRNA of UBR5, wherein the siRNA is shown as SED ID NO3 and SED ID NO4; and the sgRNA is shown as SED ID NO1.

2. The use according to claim 1, characterized in that The pigmented skin diseases include hyperpigmented skin diseases.

3. The use according to claim 1 or 2, characterized in that The pigmented skin diseases include pigmented nevi and pigmented spots.

4. The use according to claim 3, characterized in that The pigmented skin diseases include congenital pigmented nevi and giant nevi with the risk of malignant transformation, chloasma, freckles, nevus of Ota, and post-inflammatory pigmentation.