Adeno-associated virus mutants and their applications
By inserting targeted peptides, especially RGD peptides, in the AAV capsid protein, adeno-associated virus mutants with muscle or cardiac targeting are constructed, the problem of ineffective and cost of targeting capabilities in existing AAV gene therapy is solved, and higher specificity and safe drug delivery is achieved, which promotes the large-scale application of gene therapy.
Patent Information
- Application Number
- CN202411870497.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-25
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2044-06-25
AI Technical Summary
The existing adeno-associated virus (AAV) gene therapy has problems such as failure of targeting ability, high cost and major side effects, especially in the treatment of muscle diseases, which is difficult to achieve efficient and safe drug delivery.
By inserting targeted peptides, especially RGD peptides, adeno-associated virus mutants with muscle or cardiac targeting are constructed, which improves muscle tissue targeting and reduces liver tropism, forming higher specific AAV mutants.
The targeting of muscle or cardiac has been increased by 258 times, and the liver tropism has been reduced by nearly a hundred times. New AAV gene therapy products with lower dose demand and lower costs have been developed to promote the large-scale and social application of gene therapy methods.
Smart Images

Figure CN119708163B_ABST
Abstract
Description
[0001] This invention patent application is a divisional application based on the Chinese patent application No. 2024108238929, titled "Adeno-associated virus mutant and its application", filed on June 25, 2024. Technical Field
[0002] The present invention relates to the field of biomedical technology, and specifically relates to an adeno-associated virus mutant and its application. Background Art
[0003] Adeno-associated virus (AAV) is a small non-enveloped virus that encapsulates a linear single-stranded DNA genome. It belongs to the genus Dependovirus of the family Parvoviridae and requires a helper virus (usually adenovirus) to participate in replication. The AAV genome is a single-stranded DNA fragment contained within a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames (Rep gene, Cap gene) and inverted terminal repeats (ITR). Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. Due to its advantages such as wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance, and stable physical properties, it has been widely used as a gene transfer vector in gene therapy and vaccine research. In medical research, rAAV has been used in the research of gene therapy for various diseases (including in vivo and in vitro experiments), such as gene function research, construction of disease models, preparation of gene knockout mice, etc.
[0004] In recent years, gene therapy has become a novel method for treating muscle diseases, and adeno-associated virus (AAV) has been widely used as an effective gene vector. Taking Duchenne muscular dystrophy (DMD) as an example, it is a rare and fatal neuromuscular genetic disease that affects one in every 3,500 - 5,000 males worldwide. DMD is caused by alterations or mutations in the gene encoding dystrophin. The symptoms of DMD usually appear in infants and young children, and affected patients may experience developmental delays, such as difficulty walking, climbing stairs, or standing up from a sitting position. Elevidys (trade name), with the generic name delandistrogene moxeparvovec and formerly known as SRP-9001, is a gene therapy that delivers the truncated DMD gene (mini-protein gene micro-dystrophin) in DMD patients using the AAVrh74 vector and the MHCK7 promoter. It was approved for marketing in the United States in June 2023 for DMD patients aged 4 - 5 years who can walk independently (patients with deletion mutations in exons 8 and / or 9 are prohibited). On June 20, 2024, the US Food and Drug Administration (FDA) fully approved ELEVIDYS for DMD patients aged 4 years and above who can walk independently, and simultaneously accelerated the approval (conditional marketing) of this drug for DMD patients aged 4 years and above who cannot walk independently. In addition, there are some other AAV treatment cases or clinical studies underway. However, AAV treatment also has some potential risks. For example, too high a dose may cause an immune system reaction, leading to side effects. In addition, a high dose also means higher production difficulty and higher cost.
[0005] In addition, the current AAV screening strategy mainly based on directed evolution, although it can obtain some effective mutants in large-scale screening, the screening process is cumbersome and expensive. Especially the loss of targeting ability caused by species differences and the huge cost of screening in monkeys not only increase the threshold for researchers to participate, but also the high development cost is ultimately reflected in the drug cost.
[0006] Therefore, the main purpose of AAV serotype modification is to develop serotypes with better therapeutic effects, lower treatment doses, fewer side effects and usage costs, in order to obtain drugs with higher targeting to reduce the drug dose, or to make the drug have better specificity to avoid adverse reactions. Summary of the Invention
[0007] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an adeno-associated virus mutant with muscle or heart targeting and its application.
[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:
[0009] In a first aspect, the present invention provides an adeno-associated virus capsid protein mutant, the amino acid sequence of which comprises a sequence shown in any one of SEQ ID No. 1 to 4.
[0010] The adeno-associated virus capsid protein mutant of the present invention has muscle or heart targeting properties, especially good targeting properties for different muscle tissues (such as quadriceps femoris, biceps brachii, and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting property is increased by up to about 258 times, and the liver tropism is also nearly 100 times lower than that of the control group, with good specificity.
[0011] As a preferred embodiment of the adeno-associated virus capsid protein mutant of the present invention, a targeting peptide is inserted into the amino acid sequence; the amino acid sequence of the targeting peptide is a sequence shown in any one of SEQ ID No. 5 to 8.
[0012] In a second aspect, the present invention provides a nucleic acid encoding the adeno-associated virus capsid protein mutant.
[0013] As a preferred embodiment of the nucleic acid of the present invention, its nucleotide sequence comprises the nucleotide sequences shown in SEQ ID No. 9 to 12.
[0014] In a third aspect, the present invention provides an expression vector, which comprises the nucleic acid.
[0015] In a fourth aspect, the present invention provides a host cell, which comprises the expression vector.
[0016] In a fifth aspect, the present invention provides a host cell, which expresses the adeno-associated virus capsid protein mutant.
[0017] In a sixth aspect, the present invention provides a recombinant adeno-associated virus, which comprises the adeno-associated virus capsid protein mutant.
[0018] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, it further comprises a heterologous target gene.
[0019] As a further preferred embodiment of the recombinant adeno-associated virus of the present invention, the heterologous target gene encodes any one of gene products such as interfering RNA, aptamer, endonuclease, and guide RNA.
[0020] In a seventh aspect, the present invention provides a method for preparing a recombinant adeno-associated virus, which comprises introducing at least the following components into a host cell: 1) the nucleic acid or the expression vector, 2) an adenovirus helper plasmid, and 3) a plasmid containing two terminal inverted repeats.
[0021] In an eighth aspect, the present invention provides rAAV prepared by the method.
[0022] In a ninth aspect, the present invention provides a pharmaceutical composition comprising the recombinant adeno-associated virus or the rAAV as described above, and a pharmaceutically acceptable carrier.
[0023] In a tenth aspect, the present invention applies the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug or preparation for delivering a gene product to cells or tissues of a subject.
[0024] As a preferred embodiment of the application described in the present invention, the cells are muscle cells or heart cells; the tissues are muscle tissues or heart tissues.
[0025] In an eleventh aspect, the present invention applies the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases.
[0026] As a preferred embodiment of the application described in the present invention, the muscle diseases include but are not limited to any one of Duchenne muscular dystrophy, Becker muscular dystrophy, X-linked myotubular myopathy, limb-girdle muscular dystrophy, myotonic dystrophy, facioscapulohumeral muscular dystrophy; the heart diseases include but are not limited to any one of arrhythmogenic cardiomyopathy, ischemic cardiomyopathy, hypertrophic cardiomyopathy, dilated cardiomyopathy, angina pectoris, coronary heart disease, myocardial infarction, heart failure.
[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0028] The present invention incorporates the RGD peptide segment into a low-hepatotropic backbone, and the obtained adeno-associated virus capsid protein mutant has muscle or heart targeting properties, especially good targeting properties for different muscle tissues (such as quadriceps femoris, biceps brachii, and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting property is increased by up to about 258 times, and the hepatotropism is also nearly a hundred times lower than that of the control group. It has good specificity, good safety, and a wide range of applications. The present invention has developed a new AAV gene therapy product with lower dosage requirements and costs to meet the needs of more different patients, and to promote the large-scale and social application of AAV-based gene therapy methods. This will be of great significance for enhancing the effectiveness of gene therapy and serving the majority of patients in the future. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 are the in vivo imaging results of different serotypes infecting Balb / c mice; Figure 1 In, A is the mouse infected for 14 days, and B is the mouse infected for 21 days.
[0030] Figure 2 Targeting analysis of different serotypes on the muscle (biceps brachii) of Balb / c mice (21 days); Figure 2 In it, A is the relative mRNA expression level, and B is the protein expression level.
[0031] Figure 3 Targeting analysis of different serotypes on the muscle (triceps brachii) of Balb / c mice (21 days); Figure 3 In it, A is the relative mRNA expression level, and B is the protein expression level.
[0032] Figure 4 Targeting analysis of different serotypes on the muscle (quadriceps femoris) of Balb / c mice (21 days); Figure 4 In it, A is the relative mRNA expression level, and B is the protein expression level.
[0033] Figure 5 Targeting analysis of different serotypes on the muscle (abdominal muscle) of Balb / c mice (21 days); Figure 5 In it, A is the relative mRNA expression level, and B is the protein expression level.
[0034] Figure 6 Targeting analysis of different serotypes on the muscle (gastrocnemius) of Balb / c mice (21 days); Figure 6 In it, A is the relative mRNA expression level, and B is the protein expression level.
[0035] Figure 7 Targeting analysis of different serotypes on the heart of Balb / c mice (21 days); Figure 7 In it, A is the relative mRNA expression level, and B is the protein expression level.
[0036] Figure 8 Targeting analysis of different serotypes on the liver of Balb / c mice (21 days); Figure 8 In it, A is the relative mRNA expression level, and B is the protein expression level.
[0037] Figure 9 Targeting analysis of different serotypes on other organs of Balb / c mice (21 days, relative mRNA expression level); Figure 9 In it, A is the lung, B is the kidney, and C is the brain.
[0038] Figure 10 NGS detection and analysis of the muscle targeting and liver tropism of different serotypes in cynomolgus monkeys; Figure 10 In it, A is the puncture at 14 days, and B is the puncture at 28 days. Specific implementation mode
[0039] Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art.
[0040] Unless the context clearly indicates otherwise, the term "or" refers to a single one of the listed alternative elements, and the term "and / or" refers to any one, any two, any three, any more, or all of the listed alternative elements.
[0041] The term "comprising" or "including" means including the stated element, integer, or step, but does not exclude any other element, integer, or step. In the text, when the term "comprising" or "including" is used, unless otherwise specified, the case consisting of the stated element, integer, or step is also covered. For example, when referring to a polypeptide "including" a specific sequence, it is also intended to cover a polypeptide consisting of that specific sequence.
[0042] "Adeno-associated virus (AAV)" is a non-enveloped icosahedral capsid virus of the Parvoviridae family, including a single-stranded DNA viral genome. The Parvoviridae family includes the genus Dependovirus, which includes AAV, and depends on the presence of a helper virus such as adenovirus for its replication. Due to its relatively simple structure, ability to infect a variety of cells (including quiescent and dividing cells) without integrating into the host genome, and its relatively mild immunogenic characteristics, AAV has been shown to be useful as a biological tool for expressing a gene of interest in vitro or in vivo. Also contemplated herein are AAV-based expression vectors, including recombinant AAV (rAAV) carrying a gene of interest for therapeutic purposes.
[0043] The wild-type AAV viral genome is a linear, single-stranded DNA (ssDNA) molecule approximately 5000 nucleotides (nt) in length. The AAV viral genome typically includes two inverted terminal repeats (ITRs) that cap the viral genome at the 5' and 3' ends, respectively, providing an origin of replication for the viral genome. These ITRs have characteristic T-shaped hairpin structures and have multiple functions, including but not limited to serving as a starting point for DNA replication by acting as a primer for the endogenous DNA polymerase complex of the host virus replication cell.
[0044] The wild-type AAV viral genome also includes the Rep gene and the Cap gene, which encode four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40) and three capsid proteins or structural proteins (VP1, VP2, VP3), respectively. The Rep proteins are associated with virus replication and packaging, while the capsid proteins assemble to form the protein coat or AAV capsid of AAV. Alternative splicing and alternative start codons and promoters result in the production of four different Rep proteins from a single open reading frame in the Rep gene and three capsid proteins from a single open reading frame in the Cap gene.
[0045] When referring to AAV, the terms "viral capsid protein" or "capsid protein" refer to the protein of AAV that can self-assemble to produce AAV particles, also known as the coat protein or VP protein. The VP protein includes three subunits, VP1, VP2, and VP3. Thus, changes in the VP protein mutant relative to the wild-type VP protein can be reflected in the amino acid sequence changes of the VP1, VP2, and VP3 subunits. Correspondingly, in this article, "capsid protein mutant" includes VP protein mutants and also includes VP1, VP2, and / or VP3 subunit mutants. Due to the amino acid sequence identity among the VP1, VP2, and VP3 subunits expressed from the same Cap gene, when changes are made to the coding sequence in the Cap gene, for example, when changes are made to the coding sequence of the VP1 subunit, the amino acid sequences of the expressed VP2 and VP3 subunits are also changed simultaneously.
[0046] When referring to AAV, the term "serotype" is used to refer to the serological difference of the capsid protein of AAV from other AAV serotypes. The determination of serological distinctiveness is based on the reactivity of an antibody with one AAV and the lack of cross-reactivity with other or another AAV. This difference in cross-reactivity is usually due to differences in the capsid protein sequence (or its subunit sequence) / epitope (e.g., due to sequence differences in VP1, VP2, and / or VP3 of serotype AAV9). Currently, multiple AAV serotypes have been discovered, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12, as well as their mutants.
[0047] When referring to the capsid protein of AAV or its subunits, the "variable region" refers to the region where its amino acid sequence varies relatively greatly among different serotypes. Usually, by aligning the amino acid sequences of the capsid proteins of numerous AAV serotypes and determining the relatively conserved regions, the sequences located between them are the variable region sequences. The variable region may be related to the binding of AAV to cell surface receptors.
[0048] "Recombinant AAV vector" refers to an AAV genome derived by using molecular biology methods to remove part of the wild-type genes (such as Rep gene and Cap gene) from the AAV genome and replace them with heterologous nucleic acid sequences (such as the coding sequences of proteins or RNAs for therapeutic purposes). Generally, for a recombinant AAV vector, one or two inverted terminal repeat (ITR) sequences of the AAV genome are retained therein. In most cases, the recombinant AAV vector is replication-deficient and lacks the sequences encoding functional Rep and Cap proteins in its viral genome. These replication-deficient AAV particles may lack most of the parental coding sequences and essentially carry only one or two AAV ITR sequences and the target nucleic acid for delivery to cells, tissues, organs or organisms. The AAV including the recombinant AAV vector is referred to as recombinant AAV (rAAV) herein.
[0049] "Amino acid change" includes amino acid substitution, deletion or insertion herein. The number of amino acid changes in the mutant sequence relative to the parental sequence can be counted as the sum of the number of amino acid substitutions, the number of deleted amino acids and the number of inserted amino acids.
[0050] In this article, the terms "nucleic acid molecule", "nucleic acid" and "polynucleotide" are used interchangeably and refer to nucleotide polymers. Such nucleotide polymers may contain natural and / or unnatural nucleotides and include (but are not limited to) DNA, RNA and PNA. "Nucleic acid sequence" refers to the linear sequence of nucleotides contained in a nucleic acid molecule or polynucleotide. "Isolated nucleic acid molecule" refers to a nucleic acid molecule that has been removed from its natural environment (such as the intracellular environment), is substantially free of one or more substances usually associated with it naturally, such as proteins, nucleic acids, lipids, carbohydrates, cell membranes, etc., or is a nucleic acid molecule prepared artificially (such as artificially synthesized).
[0051] The term "expression vector" refers to a nucleic acid molecule containing various expression elements for expressing a protein of interest or an RNA of interest in a host cell. For an expression vector used for expressing a protein of interest in eukaryotic cells, these expression elements usually include a promoter, an enhancer, a polyadenylation signal sequence, etc. For convenient amplification in Escherichia coli, the expression vector usually also includes an Escherichia coli replicon sequence. In addition, the expression vector may also include an antibiotic resistance gene or a selection marker gene for screening (such as ampicillin resistance gene (AmpR), thymidine kinase gene (TK), kanamycin resistance gene (KanR), neomycin resistance gene (NeoR), etc.) and a multiple cloning site (MCS) for insertion of the gene of interest.
[0052] The term "host cell" refers to cells in which an expression vector can be maintained and / or replicated, including prokaryotic cells and eukaryotic cells, such as bacteria (such as E. coli), fungi (yeast), insect cells (such as SF9) and mammalian cells (such as HEK-293T).
[0053] When referring to a pharmaceutical composition, the term "pharmaceutically acceptable carrier" is used to refer to a solid or liquid diluent, filler, antioxidant, stabilizer, or other substance that can be safely administered, is suitable for administration to humans and / or animals without excessive adverse side effects, and is suitable for maintaining the activity of the drug or active agent located therein. Depending on the route of administration, various different carriers well known in the art can be used, including, but not limited to, sugars, starch, cellulose and its derivatives, maltose, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffer, emulsifiers, isotonic saline, and / or pyrogen-free water, etc.
[0054] The "targeting" of AAV or rAAV refers to the phenomenon that when it is introduced into the body, it is relatively concentrated in a specific tissue or organ. For example, the targeting can be manifested as a higher concentration in tissue A than in tissue B. This targeting can be reflected by detecting the content or concentration of its genome in different tissues or organs.
[0055] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0056] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.
[0057] Example 1: Construction of AAV capsid protein mutants and virus production
[0058] (1) Discovery and determination of targeting peptide sequences
[0059] The present invention explores the structural and functional analysis of naturally occurring viruses or ligand peptides in nature, and applies different strategies to construct candidate serotype mutants in a more direct way and at a lower cost. The RGD motif can bind to the motif of the integrin receptor, and some integrin receptors are relatively specifically expressed in muscle cells. Some integrin receptor-related ligands and viruses with muscle infection ability are screened, and potential muscle-targeted peptides are mined from them, especially peptides containing the RGD motif as potential targeting peptides, and then relevant experimental verification analysis is performed.
[0060] RGD peptide segments of different sequences, peptide segments of different lengths, different insertion or replacement methods, etc. may all have a huge impact on the final targeting effect. The peptide segment sequences selected in the present invention are shown in Table 1:
[0061] Table 1 Peptide segment sequences selected
[0062] Type Sequence Source Peptide Sequence Remarks Viral Peptide FMDV O VP1 SPNLRGDLQVLAA Mutant 1 Targeting Peptide Viral Peptide FMDV O VP1 SNLRGDLQVLA Mutant 5 Targeting Peptide Viral Peptide FMDV C VP1 SASARGDLAHLTA Mutant 2 Targeting Peptide Viral Peptide FMDV C VP1 SSARGDLAHLA Mutant 6 Targeting Peptide Ligand Peptide TGFβ STGRRGDLATIHA Mutant 3 Targeting Peptide Ligand Peptide TGFβ SGRRGDLATIA Mutant 7 Targeting Peptide Ligand Peptide Tenascin (TNC) SISRRGDMSSNPA Mutant 4 Targeting Peptide Ligand Peptide Tenascin (TNC) SSRRGDMSSNA Mutant 8 Targeting Peptide
[0063] Take "S" and "A" at both ends of the amino acid sequence in Table 1 as the linking sequences between the serotype VP1 skeleton and the targeting peptide. For example, replace R584 to R587 of low hepatotropic serotype (SEQ ID NO.13) VP1 or S584 to R594 of serotype 109 (SEQ ID NO.14) VP1 with the above-mentioned targeting peptide amino acid sequence to form a new serotype VP1 sequence.
[0064] (2) Construction of mutant serotype vectors and plasmid extraction
[0065] Double-digest the AAV9 Rep-CAP plasmid (purchased from Guangzhou Pazhou Biotechnology Co., Ltd.) with Smi I and BshT I, perform gel electrophoresis and cut out the fragment band about 5000bp for gel recovery to obtain the digested backbone fragment.
[0066] According to the Cap sequence of mutant 1, design the following primers. The specific steps are as follows: Use the Cap-f + YJ561-R primers to amplify and perform gel recovery with the Rep-CAP plasmid of serotype 109 as the template to obtain the target product YJ561-1. Use the YJ561-F + cap-r primers to amplify and perform gel recovery with the Rep-CAP plasmid of serotype 109 as the template to obtain the target product YJ561-2. Recombinant construction of the Rep-CAP plasmid of mutant 1 can be achieved by mixing the backbone fragment, YJ561-1, and YJ561-2 through the following steps and ratios;
[0067] According to the Cap sequence of mutant 2, design the following primers. The specific steps are as follows: Use the Cap-f + YJ563-R primers to amplify and perform gel recovery with the Rep-CAP plasmid of serotype 109 as the template to obtain the target product YJ563-1. Use the YJ563-F + cap-r primers to amplify and perform gel recovery with the Rep-CAP plasmid of serotype 109 as the template to obtain the target product YJ563-2. Recombinant construction of the Rep-CAP plasmid of mutant 2 can be achieved by mixing the backbone fragment, YJ563-1, and YJ563-2 through the following steps and ratios;
[0068] Based on the Cap sequence of Mutant 3, the following primers were designed. The specific steps are as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f + YJ565-R primers and recover the target product YJ565-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ565-F + cap-r primers and recover the target product YJ565-2 by gel extraction. Recombinant construction of the Rep-CAP plasmid of Mutant 3 can be achieved by mixing the backbone fragment, YJ565-1, and YJ565-2 through the following steps and ratios.
[0069] Based on the Cap sequence of Mutant 4, the following primers were designed. The specific steps are as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f + YJ567-R primers and recover the target product YJ567-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ567-F + cap-r primers and recover the target product YJ567-2 by gel extraction. Recombinant construction of the Rep-CAP plasmid of Mutant 4 can be achieved by mixing the backbone fragment, YJ567-1, and YJ567-2 through the following steps and ratios.
[0070] Based on the Cap sequence of Mutant 5, the following primers were designed. The specific steps are as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f + YJ562-R primers and recover the target product YJ562-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ562-F + cap-r primers and recover the target product YJ562-2 by gel extraction. Recombinant construction of the Rep-CAP plasmid of Mutant 5 can be achieved by mixing the backbone fragment, YJ562-1, and YJ562-2 through the following steps and ratios.
[0071] Based on the Cap sequence of Mutant 6, the following primers were designed. The specific steps are as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f + YJ564-R primers and recover the target product YJ564-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ564-F + cap-r primers and recover the target product YJ564-2 by gel extraction. Recombinant construction of the Rep-CAP plasmid of Mutant 6 can be achieved by mixing the backbone fragment, YJ564-1, and YJ564-2 through the following steps and ratios.
[0072] According to the Cap sequence of mutant 7, the following primers were designed. The specific steps were as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f+YJ566-R primers and recover the target product YJ566-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ566-F+cap-r primers and recover the target product YJ566-2 by gel extraction. By mixing the backbone fragment, YJ566-1, and YJ566-2 through the following steps and ratios, the Rep-CAP plasmid of mutant 7 can be recombinantly constructed;
[0073] According to the Cap sequence of mutant 8, the following primers were designed. The specific steps were as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f+YJ568-R primers and recover the target product YJ568-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ568-F+cap-r primers and recover the target product YJ568-2 by gel extraction. By mixing the backbone fragment, YJ568-1, and YJ568-2 through the following steps and ratios, the Rep-CAP plasmid of mutant 8 can be recombinantly constructed;
[0074] The primers involved in the construction of the Rep-CAP vector of the above AAV capsid protein mutants are shown in Table 2:
[0075] Table 2 Primer sequences
[0076] Primer Name Primer Sequence (5’->3’) Cap-f CATCTTTGAACAATAAATGATTTAAATCAGGTATG cap-r TCAACTGAAACGAATCAACCGGTTT YJ561-R GACCTGGAGGTCTCCTCTCAGGTTAGGGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ561-F GAGAGGAGACCTCCAGGTCCTGGCTGCTCAAGCAGCTACCGCAGAT YJ563-R ATGAGCGAGGTCTCCTCTTGCAGAAGCGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ563-F AGAGGAGACCTCGCTCATCTGACAGCTCAAGCAGCTACCGCAGAT YJ565-R ATAGTAGCGAGGTCTCCTCTTCGACCAGTGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ565-F AGAGGAGACCTCGCTACTATCCATGCTCAAGCAGCTACCGCAGAT YJ567-R TTGGAAGACATGTCTCCTCTTCGAGAGATGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ567-F AGAGGAGACATGTCTTCCAATCCTGCTCAAGCAGCTACCGCAGAT YJ562-R GACCTGGAGGTCTCCTCTCAGGTTGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ562-F GAGAGGAGACCTCCAGGTCCTGGCTCAAGCAGCTACCGCAGAT YJ564-R ATGAGCGAGGTCTCCTCTTGCAGAGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ564-F AGAGGAGACCTCGCTCATCTGGCTCAAGCAGCTACCGCAGAT YJ566-R ATAGTAGCGAGGTCTCCTCTTCGACCGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ566-F AGAGGAGACCTCGCTACTATCGCTCAAGCAGCTACCGCAGAT YJ568-R TTGGAAGACATGTCTCCTCTTCGAGAGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ568-F AGAGGAGACATGTCTTCCAATGCTCAAGCAGCTACCGCAGAT
[0077] Take a clean 200 μL PCR tube, make a mark and place it on an ice box. Prepare the reaction solution by mixing the above-mentioned digested backbone and each target fragment according to a molar ratio of backbone:fragment of 1:3. Carry out recombinant ligation in a PCR instrument at 50 °C for 30 min. Take 50 μL of competent cells and thaw them on ice. Mix 10 μL of the ligation product with DH5α competent cells and place them on ice for 20 - 30 minutes; heat shock at 42 °C for 45 seconds; quickly place them on ice for an ice bath for 2 minutes, add 400 μL of recovery SOC medium (without antibiotics), culture at 37 °C and 200 rpm for 1 h; evenly spread on an Amp-resistant plate (50 μg / ml) and culture at 37 °C for 14 hours. Select monoclonal bacteria and expand the culture in 4 ml of liquid LB medium (Amp+ resistance) at 37 °C for 14 hours.
[0078] The bacterial solution was centrifuged at 12,000 rpm for 1 minute, and the supernatant culture medium was discarded; 250 μL of buffer P1 / RNaseA mixture was added, and the bacteria were resuspended by high-speed vortexing; 250 μL of buffer P2 was added, and the mixture was inverted up and down 8 - 10 times; 350 μL of buffer P3 was added, and the mixture was immediately inverted and mixed 8 - 10 times to completely neutralize the solution; it was centrifuged at 13,000 rpm for 10 minutes, and the supernatant was taken and passed through the column; it was centrifuged at 12,000 rpm for 1 minute, the waste liquid was discarded, 500 μL of PW1 was added, centrifuged at 12,000 rpm for 1 minute, and the waste liquid was discarded; 600 μL of PW2 was added, centrifuged at 12,000 rpm for 1 minute, and the supernatant was discarded; 600 μL of PW2 was added, centrifuged at 12,000 rpm for 1 minute, and the supernatant was discarded; it was idled at 12,000 rpm for 2 minutes; 30 - 50 μL of elution buffer preheated at 55 °C was added, allowed to stand for 2 minutes, and centrifuged at 12,000 rpm for 1 minute. The concentration was detected using a micro nucleic acid quantifier.
[0079] After the obtained plasmid passed the concentration detection, 10 μL of the positive plasmid identified by enzyme digestion was sent for sequencing, and the positive plasmid was stored at -20 °C. The sequencing results showed that the obtained plasmid could encode the variant capsid protein VP1. Finally, according to the virus amount required for later tests, the relevant Helper plasmids, each group of Rep-Cap plasmids (control serotypes AAV2, AAV9, MyoAAV 4A, 109 and mutants 1 - 8) plasmids, and GOI plasmids (ssAAV.CAG.Fluc-2a-eGFP.WPRE.SV40pA) were extracted.
[0080] (3) Packaging and purification of mutant serotype viruses
[0081] The Rep-Cap plasmids of each group (control serotype and AAV mutants 1 - 8), the GOI plasmids expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP), and the pHelper plasmids were co-transfected into HEK-293T cells in appropriate amounts, and the AAV viruses were purified by iodixanol gradient ultra-high-speed centrifugation. The virus titer was measured to be suitable at 1E+12 GC / mL - 1E+13 GC / mL, and it was stored at -80 °C for later use.
[0082] Example 2: Comparative tests of various indicators of mutant serotypes
[0083] (1) Mouse injection and dissection
[0084] Animal experiments were conducted using 6-8-week-old male Balb / c mice. Relevant viruses were prepared according to the designed experimental group and control group (only 1 mouse was used for mutant 5 due to low virus production). Each mouse in each group was injected with 2E11 GC virus. In vivo imaging was performed at 14 days and 21 days after injection. Animal dissection and tissue sampling of various organs were carried out 21 days after injection. After tissue sampling, the samples were immediately frozen in liquid nitrogen and used for subsequent RNA extraction and WB detection experiments, etc.
[0085] (2) In vivo imaging
[0086] In vivo imaging was performed on the mice at 14 days and 21 days after injection respectively. Before imaging, the mice were weighed. The animal in vivo imaging system (AniView100, Guangzhou Boluteng Biotechnology Co., Ltd.) was turned on in advance and the small animal anesthesia system was adjusted. The image saving path, shooting parameters and other information were set. Each mouse was intraperitoneally injected with luciferin (15 mg / mL, Promega, E1605) at a dose of 150 mg / kg, that is, 10 μL / g. Imaging started 10 min after injection in each group. The shooting of each batch of mice was completed in the order of supine, left lateral, prone, and right lateral. After shooting, the mice were put back into the cage to wait for the anesthesia to wear off, and the status of the mice was observed for any abnormalities.
[0087] (3) Detection of the mRNA expression level of the target gene
[0088] (3.1) Total RNA extraction and reverse transcription:
[0089] Grinding of samples: The grinder was pre-cooled 10 min in advance and the grinding parameters were set. The animal tissue samples stored in the -80 °C refrigerator were taken out. About 50-100 mg of tissue was taken, cut into the size of soybean grains in a sterile culture dish, and then transferred into a 1.5 ml RNase-free EP tube. An appropriate amount of TransZolUp was added according to the ratio of 50-100 mg of tissue: 1 ml of TransZolUp, and then two clean and sterile 3 mm grinding steel beads were added, and the tube was sealed with sealing film. The sample was placed in a 24-well grinding adapter and balanced, the screw was tightened, and the lid closing button was pressed. The grinding program was started. After the instrument operation was completed, the sample was taken out, and the grinding particle size of the sample was observed. If there was no large tissue residue, the subsequent extraction operation could be carried out. The ground sample was centrifuged at 4 °C and 12,000×g for 2 min, and the supernatant was aspirated and transferred into a new 1.5 ml RNase-free EP tube with corresponding labels.
[0090] Extraction of total RNA from samples: Specifically refer to the instruction manual of TransZol Up Plus RNA Kit (TransGen Biotech, Beijing, product number: ER501). For every 1 ml of TranZol up used, add 0.2 ml of RNA Extraction Agent and shake vigorously for 5 min; centrifuge at 12,000×g at 4°C for 10 min. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5 ml RNase-free EP tube, add an equal volume of absolute ethanol (precipitation may occur at this time), and gently invert and mix; add the obtained solution and precipitate together into the centrifugal column, centrifuge at 12,000×g at room temperature for 30 s, and discard the filtrate; add 500 μL of CB9, centrifuge at 12,000×g at room temperature for 30 s, and discard the filtrate; repeat the above step once; add 500 μL of WB9, centrifuge at 12,000×g at room temperature for 30 s, and discard the filtrate; repeat the above step once; centrifuge at 12,000×g at room temperature for 2 min to completely remove the residual ethanol; place the centrifugal column into a 1.5 ml RNase-free EP tube, add 30 - 50 μL (depending on the tissue size) of RNase-free Water in the center of the centrifugal column, let stand at room temperature for 1 min; centrifuge at 12,000×g at room temperature for 1 min to elute the RNA;
[0091] Determination of nucleic acid concentration of samples: Use a micro nucleic acid quantifier detector to detect the RNA concentration, record the concentration, OD260 / 280, and OD260 / 230, and store the RNA at -80°C.
[0092] Reverse transcription: For each group of RNA samples, use All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (TransGen Biotech, Beijing, product number: AE341-03), and refer to the instruction manual for specific steps.
[0093] (3.2) Quantitative PCR (qPCR) experiment:
[0094] Use each group of cDNA as a template and configure the qPCR system according to the instruction manual of 2x SYBR Green qPCR Master Mix (Bimake, product number: B21203):
[0095] Table 3 qPCR system
[0096] Reagent Dosage 2x SYBR Green qPCR Master Mix 10ul cDNA template 2ul Forward primer (10μM) 1ul Reverse primer (10μM) 1ul ROX Reference Dye 0.4ul Deionized water Up to 20ul
[0097] Table 4 qPCR program settings
[0098]
[0099] Table 5 qPCR primer sequences
[0100] Primer name Primer sequence (5’->3’) Fluc2-qPCR-F1 AACCAGCGCCATTCTGATCA Fluc2-qPCR-R1 TCGGGGTTGTTAACGTAGCC GAPDH-F2 CAGGAGAGTGTTTCCTCGTCC GAPDH-R2 TTCCCATTCTCGGCCTTGAC
[0101] (3.3) Data analysis
[0102] According to the Ct value of each group, calculate according to formula 2 -ΔΔct the relative expression level.
[0103] (4) WB detection of the expression level of the target protein
[0104] Sample pretreatment: Cut the tissue into small pieces, weigh and record the weight, then place it in a 1.5 mL or 2 mL centrifuge tube, label the tube, freeze it at -80 °C for later use, and pre-cool the cryogenic grinder; Dissolve the RIPA (Beyotime, P0013B) lysis buffer (add PMSF within a few minutes before use to make the final concentration of PMSF 1 mM);
[0105] Add the above complete lysis buffer according to the ratio of adding 150 - 250 μL of lysis buffer per 20 mg of tissue, then add two sterilized zirconia grinding beads, and grind the sample directly in the lysis buffer (for tissue samples such as brain and spinal cord: temperature -20 °C, frequency 70 Hz, time pause for 10 s every 50 s of oscillation, cycle 3 - 4 times; for samples such as muscle and liver: temperature -20 °C, frequency 70 Hz, time pause for 10 s every 50 s of oscillation, 5 - 7 times). After the sample is ground, centrifuge the sample in a cryogenic centrifuge at 4 °C, 12,000 × g for 5 - 10 min, then take the supernatant and transfer it to a new sterilized EP tube, and store it at -20 °C or -80 °C;
[0106] Protein concentration determination: After determining the protein concentration according to the method in the improved BCA method protein concentration determination kit (Sangon Biotech, product number C503051), take an appropriate amount of protein homogenate sample according to the required amount, mix it with the corresponding amount of 5X SDS-PAGE protein loading buffer, boil it in a water bath for 10 min, cool it and centrifuge it at low speed for a moment, and wait for loading.
[0107] WB (Western Blot) detection:
[0108] A. SDS-PAGE Electrophoresis: Determine the appropriate sample loading volume according to the protein concentration and expression level, less than 20 μL / well. The protein sample loading volume for tissue homogenate is about 20 - 50 μg. The specific operation procedure of electrophoresis is as follows: Pull out the comb on the precast gel, install the gel into the electrophoresis tank, add electrophoresis buffer to both the inner and outer tanks. Add freshly prepared buffer to the inner tank and check for leaks. If there is no leak, add electrophoresis buffer to the outer tank; Take an appropriate amount of the treated protein sample for loading, use the prestained standard protein as a reference, and perform electrophoresis at a constant voltage of 100 V on the Tianneng electrophoresis device for 100 min until the bromophenol blue reaches the bottom of the gel. Turn off the power, carefully remove the precast gel plate, take out the gel, and place it in the transfer buffer for subsequent operations;
[0109] B. Transfer: Cut 6 pieces of filter paper and 1 piece of PVDF membrane according to the gel area. Immerse the PVDF membrane in methanol for 5 - 10 sec, then transfer it to the transfer buffer and soak for 5 min. The filter paper is also pre-wetted in the transfer buffer; Install the transfer device: negative electrode (black board) - sponge - 3 layers of wetted filter paper - gel - PVDF membrane - 3 layers of wetted filter paper - sponge - positive electrode (transparent board). Drive out the air bubbles in each layer to avoid affecting the transfer effect, clamp the bracket, and place it in the electrotransfer tank; Use a constant voltage of 100 V for ice-bath transfer for 100 min; Judge whether the transfer is successful according to whether the prestained protein molecular weight standard band is completely transferred to the PVDF membrane; Immerse the transferred PVDF membrane in PBST solution and wash it at room temperature for 5 min. Cut the PVDF membrane according to requirements, and pay attention not to let the PVDF membrane dry during the cutting process;
[0110] C. Blocking and Antibody Incubation: Incubate the PVDF membrane with the blocking solution (5% skim milk powder) at room temperature for 2 h or overnight at 4°C; Transfer the blocked PVDF membrane into the primary antibody hybridization solution (Luciferase Rabbit Polyclonal antibody (Proteintech, 27986-1-AP) at 1:2000; GADPH Rabbit Polyclonal antibody (Proteintech, 10494-1-AP) at 1:2000; Rabbit GFP tag Polyclonal antibody (Proteintech, 50430-2-AP) at 1:2000, respectively add to 4 ml QuickBlock TMIn Western primary antibody dilution solution (Beyotime, P0256), immediately prepare the primary antibody hybridization solution, incubate at room temperature for 1 h or overnight at 4 °C, and then wash the membrane with PBST, 3×5 min; transfer the washed PVDF membrane into the secondary antibody hybridization solution (HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H+L) (Proteintech, SA00001-2) is added to 4 ml of QuickBlock at a ratio of 1:5000 TM In Western secondary antibody dilution solution (Beyotime, P0258), immediately prepare the secondary antibody hybridization solution, incubate at room temperature for 1 h, and wash the membrane with PBST, 3×5 min;
[0111] D. Color development: Mix equal volumes of Solution A and Solution B of the ECL chemiluminescence kit, shake well, and drop the luminescent solution on the PVDF membrane so that the PVDF membrane is completely covered with the luminescent solution. Adjust different exposure times to make the protein bands clear, and take pictures with the instrument.
[0112] (5) Cynomolgus monkey injection, puncture and NGS analysis
[0113] For animal experiments, male cynomolgus monkeys about 4 years old were used. After passing the AAV2 and AAV9 neutralizing antibody tests before the experiment, different serotype mutants and control serotypes were packaged with different GOIs (ssAAV.CAG.Fluc.WPRE.polyA vectors carrying different Barcodes), and intravenous injection was performed with equal virus amounts (the total dose of the mixed virus was controlled at 3E13 GC / Kg). Muscle puncture and liver puncture at different sites were performed at 2 weeks and 4 weeks respectively. Finally, tissue RNA extraction, RT-PCR and NGS sequencing were performed. By analyzing the NGS data, the fold change of each serotype mutant relative to the control AAV9 was determined.
[0114] The results of the above various verification experiments show that for the serotypes with different inserted ligand peptides and different insertion strategies, although their sequences all contain the RGD motif, the effects are quite different. For example, the serotype mutants 1-4 with longer inserted peptides all have significantly better effects than the mutants 5-8 with shorter peptides. In addition, the best mutant for targeting mouse muscle is mutant 4, followed by mutants 2 and 3. In the gastrocnemius, quadriceps femoris, triceps brachii, biceps brachii, and abdominal muscles, the infection effects of mutant 4 are 53.84 times, 55.76 times, 257.58 times, 12.63 times, and 54.47 times that of AAV9 respectively. The effects in the biceps brachii and abdominal muscles are better than those of the control MyoAAV 4A, which may be related to the previously developed low hepatotropism backbone (109 with the same backbone has a similar trend). In the heart tissue, the effect of mutant 4 is inferior to those of mutant 2 and mutant 3 (10.16 times and 10.36 times that of AAV9 respectively) and the control MyoAAV 4A, indicating that it has stronger muscle specificity. In the mouse liver, the characteristics of the low hepatotropism backbone are particularly obvious. The different targeting peptides using this backbone are all significantly lower than AAV9 and MyoAAV 4A based on the AAV9 backbone. The liver expressions of mutants 1-4 are 0.02 times, 0.01 times, 0.01 times, and 0.01 times that of AAV9 respectively. The mRNA effects of the above serotype mutants on muscles and livers are basically consistent with the results of in vivo imaging and WB, corroborating each other. In addition, for the targeting effects on different tissues such as the brain, lung, and kidney, except for a few serotypes slightly higher than AAV9 (for example, mutant 2 in the brain is 1.85 times higher than AAV9, and mutant 5 in the kidney is 1.82 times that of AAV9), the rest are basically lower than AAV9. Especially in the brain and kidney, the differences among different serotypes are not obvious.
[0115] To further illustrate the potential clinical use value of the serotypes of the present invention, the mutant and control serotype viruses were intravenously injected into cynomolgus monkeys in an equal - mixture manner, and finally the expression strength relationship of different serotypes in muscle and liver tissues was determined by NGS analysis. Significantly different from the mouse results, the best mutant 4 serotype in mouse muscle is not good in cynomolgus monkeys. Instead, the mutant 3 serotype has the best effect among many mutant individuals. The existence of this difference may be due to species differences. In addition, consistent with the mouse results, the serotype mutants 1-4 with longer inserted peptides all have significantly better effects than the mutants 5-8 with shorter peptides, which is also one of the innovative points of the present invention. Another point consistent with the mouse results is the liver tropism of different serotypes. 109 and other mutants using the low hepatotropism backbone show the characteristics of low hepatotropism compared with AAV9 and MyoAAV 4A using the AAV9 backbone, and the trends of the results at 2 weeks and 4 weeks are consistent.
[0116] In summary, by using polypeptides containing the RGD motif existing in nature, such as peptide segments in certain viruses or peptide segments in certain integrin ligands, and using different construction strategies, peptide segments that can better match and be compatible with the pre-developed low liver tropism AAV backbone were screened, and multiple serotype mutants with better muscle targeting than AAV9 were obtained. It was verified at the mRNA and protein expression levels that they had good effects in muscle tissues such as gastrocnemius, quadriceps femoris, triceps brachii, biceps brachii, and abdominal muscles, and had lower liver tropism and good specificity. These mutants can be further evaluated for their clinical application value and safety, providing more useful and optional vector tools for gene therapy of muscle diseases and benefiting a large number of patients.
[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. An adeno-associated virus capsid protein mutant, characterized in that, Its amino acid sequence is as shown in SEQ ID No.
3.
2. A nucleic acid encoding the adeno-associated virus capsid protein mutant according to claim 1.
3. The nucleic acid according to claim 2, wherein, A nucleotide sequence as shown in SEQ ID No.
11.
4. An expression vector, characterized in that, It comprises the nucleic acid according to claim 2 or 3.
5. A host cell, characterized in that, It comprises the expression vector according to claim 4.
6. A host cell, characterized in that, It expresses the adeno-associated virus capsid protein mutant according to claim 1.
7. A recombinant adeno-associated virus, characterized in that, It comprises the adeno-associated virus capsid protein mutant according to claim 1.
8. The recombinant adeno-associated virus according to claim 7, wherein It further comprises a heterologous target gene.
9. The recombinant adeno-associated virus according to claim 8, wherein The heterologous target gene encodes any one of gene products of interfering RNA, aptamer, endonuclease, and guide RNA.
10. A method for preparing recombinant adeno-associated virus, characterized in that, It comprises introducing at least the following components into a host cell: 1) the nucleic acid according to claim 2 or 3 or the expression vector according to claim 4, 2) an adeno-associated virus helper plasmid, and 3) a plasmid containing two terminal inverted repeats.
11. rAAV prepared by the method according to claim 10.
12. A pharmaceutical composition comprising the recombinant adeno-associated virus according to any one of claims 7-9 or the rAAV according to claim 11, and a pharmaceutically acceptable carrier.
13. Use of the adeno-associated virus capsid protein mutant according to claim 1, the expression vector according to claim 4, the host cell according to claim 5 or 6, the recombinant adeno-associated virus according to any one of claims 7-9, and the rAAV according to claim 11 in the preparation of a preparation for delivering a gene product to cells or tissues of a subject, characterized in that, The cell is a muscle cell or a heart cell; the tissue is a muscle tissue or a heart tissue.
14. The application according to claim 13, wherein The preparation is a drug.
Citation Information
Patent Citations
Adeno-associated virus vector targeting cardiac vascular endothelium and application thereof
CN111850045A
New-type adeno-associated virus capsid protein with high muscle affinity and use thereof
WO2023124740A1