A strain of Morchella liumei, Meizai 5, and its application

Abstract

The present invention provides a strain of Morchella esculenta, Meizai No. 5, and its applications, relating to the technical field of strain selection and breeding. The strain, Meizai No. 5, was subjected to spaceflight-induced genetic variation, followed by subculture to select for stably inherited traits, and was obtained through fruiting screening tests. The strain, Meizai No. 5, exhibits rapid mycelial growth in both the original and cultivated species, as well as in nutrient bags; strong frost and bacterial resistance; early and abundant primordium formation; high density of young mushrooms; and a high survival rate. The commercial mushrooms are dark reddish-brown to blackish-brown, have a pointed conical shape, a short, white stipe, are not easily brittle, and have a high yield per mu, thus offering broad application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of strain breeding, and in particular to a Morchella liumei strain Meizai No. 5 and applications thereof. Background Art

[0002] Morchella sextelata is an important edible and medicinal fungus that has attracted widespread attention worldwide due to its attractive appearance, short cultivation cycle, delicious taste, and high economic value. Identifying high-quality, high-yielding, and stable strains has long been a pursuit of researchers in this field, and its application is enormous.

[0003] Creating genetic variation and improving genetic characteristics through breeding to cultivate new varieties of morels with stable genetic traits, high quality and high yield has always been a focus of technical personnel in this field and has great application value.

[0004] Space breeding, also known as space breeding, is a process in which crop seeds / strains are sent on a "business trip" to space in a returning spacecraft. The seeds / strains are exposed to special environmental conditions such as cosmic rays, microgravity, and high vacuum to cause genetic mutations in a very small number of these seeds / strains. After returning to land, they are screened and cultivated by scientists for multiple generations to eventually form new varieties with stable characteristics. Summary of the Invention

[0005] The object of the present invention is to provide a strain of Morchella oxysporum Meizai No. 5 and an application thereof. The strain of Morchella oxysporum Meizai No. 5 has the characteristics of fast growth rate of mycelium in the original strain, cultivated strain and nutrient bag, strong frost resistance and resistance to foreign bacteria, early occurrence of primordia, large number of primordia, high density of young mushrooms, high survival rate, dark reddish brown to black brown, pointed conical shape, short white stipe, not easy to break and high yield per mu.

[0006] The embodiment of the present invention is achieved as follows:

[0007] A strain of Morchella liumei, Meizai No. 5, with the deposit number CGMCC No. 41344, was deposited in the General Microbiology Center of the China Culture Collection Administration on June 25, 2024, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] An application of the above-mentioned Liumei Morchella strain Meizai No. 5 in Morchella cultivation and production.

[0009] The beneficial effects of the embodiments of the present invention are:

[0010] The present invention provides a strain of Morchella esculenta, Meizai No. 5, and its uses. The strain, Meizai No. 5, was subjected to spaceflight-induced genetic variation, followed by subculture to screen for stably inherited traits, and was obtained through fruiting screening tests. The strain, Meizai No. 5, exhibits rapid mycelial growth in its original strain, cultivated strain, and nutrient bags, strong frost and bacterial resistance, early and abundant primordium formation, high juvenile mushroom density, and high survival rate. The commercial mushrooms are dark reddish-brown to black-brown, have a pointed conical shape, a short, white stipe, are not easily brittle, and have a high yield per mu, thus possessing broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0012] Figure 1 A schematic diagram of the morphology of the Liumei Morel Meizai No. 5 provided in Example 1 of the present invention;

[0013] Figure 2 Schematic diagram of the planting scene of the Liumei Morel strain Meizai No. 5 provided in the application example of the present invention. DETAILED DESCRIPTION

[0014] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0015] The following specifically describes a strain of Morchella esculenta strain Meizai No. 5 and its application according to an embodiment of the present invention.

[0016] The embodiment of the present invention provides a strain of Morchella liumei, Meizai No. 5, which has a preservation number of CGMCC No. 41344 and was deposited in the General Microbiology Center of the China Culture Collection Administration on June 25, 2024, and the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0017] The cultivation method of the strain Meizai No. 5 of the Six Sister Morel is as follows:

[0018] S1. Collect spore prints from fresh Morchella oleracea and dry them for later use.

[0019] S2. Obtain a pure cultured single-spore strain of Morchella liumei by single-spore isolation.

[0020] S3. The pure cultured monospore strain is carried into space for cultivation to obtain a spaceborne strain.

[0021] S4. Activate and systematically screen returned spaceborne bacterial strains to obtain single-hyphae strains.

[0022] S5. Subculture the mycelium of a single strain and select strains containing the mating types Mat1-1 and Mat1-2, with the fastest mycelial germination, neat margins, dense sclerotia, and minimal pigmentation. Complete the initial domestication process and preserve the domesticated strains.

[0023] S6. After conducting multiple, multi-site, fruiting screening tests on the domesticated strain, a strain of Morchella liumei (Six-sister) was identified. It exhibits rapid mycelial growth in both the original and cultivated varieties, as well as in nutrient bags; is resistant to freezing and other bacteria; develops early and abundant primordia; produces dense young mushrooms with a high survival rate; and produces commercial mushrooms that are dark reddish-brown to black-brown, have a pointed conical shape, a short, white stipe, are resistant to brittleness, and offer high yields per mu. This achieved the goal of domesticating and breeding a superior strain. This strain was named "Meizai No. 5."

[0024] The strain of the Six Sister Morel, Meizai No. 5, has the following morphological characteristics: its mycelium is thick, grows rapidly, has neat ends, and has bifurcations less than 45 degrees; it can fill a 9 cm culture dish after 3 to 4 days of cultivation at 18°C, and be covered with light yellow granular sclerotia after 10 days. The cap of a mature fruiting body is conical to oblong, reddish brown to dark brown, with a pointed top, 7 to 12 cm long, and 4 to 10 cm wide; the ribs are dense, the longitudinal ribs of the cap are very obvious, the cap has 20 to 25 longitudinal veins, and 9 to 14 transverse veins; the flesh is 2 to 4 mm thick; the stipe is smooth and white, and the junction of the cap and the stipe is not obviously concave, 4 to 6 cm long, and 2 to 4 cm wide. The fruiting bodies grow in clusters or scattered. The mushroom has obvious fruiting tides, good commercial quality, and high yield. Figure 1 shown.

[0025] The strain No. 5 of Morchella liumei was amplified and sequenced using the universal primers ITS4 / ITS5 for fungi to obtain the nucleotide sequence of the molecular fragment as shown in SEQ ID NO: 1, which is as follows:

[0026] .

[0027] The nucleotide sequence SEQ ID NO:1 was aligned with the GenBank database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome#) and showed 100% homology with the Morchella siliqua gene accession number (MG589676). Therefore, the strain Meizai 5 was identified as Morchella siliqua.

[0028] Furthermore, genetic testing revealed that compared to the commonly available Liumei Morchella, the Liumei Morchella strain Meizai No. 5 contained a first specific DNA fragment of approximately 455 bp and a second specific DNA fragment of approximately 362 bp. The nucleotide sequence of the first specific DNA fragment is shown in SEQ ID NO: 2, as follows:

[0029] TATAGAAATCGCAAAGGCACATACCTGGTAGGGCTGAAGCACACACATGATCTCGAGTTTTGAGAATTATGCCAAACTGAAAGTTTATCTCCTTGAAGAGATATGCATGCATGTAACTTGCCTAGTTATATGTATATACGTCCCAAATTATAAAATAATAGTTATGGATAGGTATAGCAGGTACTTTAAATTACTTGTTGGGAGATGTGGACGTAGAATTTAGATGAA AGCGCTTCTATATGCGGTATCAATAATCTATTCATCAATGTCCTCTCCATTTTTTCCTTTCTTGATGCGCTCCTCCATCCGCTGTTTAGCCTTTTCCTTGGCTCCATTCAACCATTCGTCGTACTTCCCTTCCTTCAAATTCGAAGCGACAACGTTTTTCAGCACCTCATGAGTAAATCCGACAAAATTGTGTCTTCTAAGCTCGTTCTCCCAAGTCCACCTCCACC.

[0030] The nucleotide sequence of the second specific DNA fragment is as shown in SEQ ID NO: 3, and is as follows:

[0031] TATACTATTACCCCGACCCCGACTCCGAATGCCAGTATTTAACTTTATAACCGACCCCGACTCAATCACTCTGCCACATAGCGTAACCCCTCGCGCCCCTCCCTCGCAACCCTCATCTCCGCCGCCACCACATCCATCTCCCTATCCAGGGCTACCAGGAGCGCCTCCCTCACTGCCCACA CCACCCCCTCCCCTCCCAGAAGTGCAAAACCCTCATTCTCACTCTCATACAGCGGCCTCTTTCGCCTTTGCTGTAATGCTCGCCGCAACACACATCTGTGGGTCGGGGCCGGGGACTTTGTCGGTGGCGATGAGCTGGCAGAAGCGCAGGAAGACGGTGTGGTAGTGGCATGCAAGGAGACT.

[0032] The first and second specific DNA fragments were obtained by PCR amplification of the six-sister Morchella strain Meizai 5 using specific primers. Specifically, conventional fungal whole genome sequencing (WGS) extraction, amplification, and group sequencing methods were used for whole genome sequencing and assembly. Furthermore, shallow whole genome sequencing (Shallow Whole Genome Sequencing) was performed on the unloaded six-sister Morchella strain and the six-sister Morchella strain Meizai 5, referring to Wei Chuanzheng et al. (2023). Conventional genome data were then spliced ​​to select the specific target fragment contained in the six-sister Morchella strain Meizai 5. Finally, primer design was performed using http: / / www.primer3plus.com / to obtain two pairs of specific primers, including Primer_MZ5_1L and Primer_MZ5_1R, and Primer_MZ5_2L and Primer_MZ5_2R, whose nucleotide sequences are shown in SEQ ID NOs: 4 to 7, respectively. Specifically,

[0033] Primer_MZ5_1L: 5'-AACGTTTCATAGAGTGGCGTT-3';

[0034] Primer_MZ5_1R: 5'-GGTGGTGGAGGTGGACTTG-3';

[0035] Primer_MZ5_2L:5'-CCTTGCATGCCCACTACCA-3';

[0036] Primer_MZ5_2R: 5'-CGTCGATGTACACGAGCGA-3'.

[0037] During PCR amplification, Primer_MZ5_1L / Primer_MZ5_1R and Primer_MZ5_2L / Primer_MZ5_2R primer sets were added to the amplification system respectively, and after the reaction, detection was performed by 2% agarose gel electrophoresis.

[0038] Wherein, the amplification system is:

[0039] PCR Buffer 1×, MgCl2 1.50 mM, dNTPs Mix 0.25 mM, specific primers 1.00 mM each, rTaq Polymerase 1.5 U, template DNA 50 ng;

[0040] The reaction conditions are:

[0041] Pre-denaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 60 s, 53°C for 40 s, and 72°C for 30 s; final extension at 72°C for 10 min.

[0042] Sequencing of the PCR amplification products was performed by Beijing Biotech Biotechnology Co., Ltd., Shanghai Sangon Bioengineering Technology Service Co., Ltd., and Yingjun Biotechnology Co., Ltd. Sequencing was performed using an ABI3730 DNA sequencer, using the same primers as the PCR amplification primers. Only the Meizai No. 5 strain was able to produce the first and second specific DNA fragments. Neither the uninfected strain nor the commonly available Morchella spp. (Six Sister Morels) could produce the first and second specific DNA fragments.

[0043] The embodiment of the present invention also provides an application of the above-mentioned Liumei Morchella strain Meizai No. 5 in Morchella cultivation and production.

[0044] The cultivation conditions of the strain Meizai 5 of the Six Sister Morel are as follows:

[0045] The soil temperature during cultivation is 5~16℃, and the soil temperature during the mycelium culture period is controlled at 8~20℃; the soil temperature during primordium differentiation and young mushroom growth period is controlled at 8~13℃, the relative humidity of the air is 80%~95%, and the light intensity is 400~800Lux.

[0046] After repeated testing, we developed a suitable nutrient pack for the strain of Morchella liumei, Meizai No. 5. The nutrient pack includes the following components in percentage by weight:

[0047] Wheat kernels 28%~43%, corn cobs 55%~70%, slaked lime 1%~2%.

[0048] Its water content is 60%~65% and pH is 6.5~7.5. This nutrient pack can effectively promote the growth of strains, improve yield and strain quality.

[0049] The features and performance of the present invention are further described in detail below with reference to the embodiments. Example

[0050] This embodiment provides a strain of Morchella liumei, Meizai 5, the cultivation process of which is as follows:

[0051] S1. Wild Morchella fruiting bodies (accession number HKAS62872) were collected from Laojun Mountain, Lijiang, Yunnan Province in August 2007 and dried for later use.

[0052] S2. In January 2019, spores obtained from the fruiting body were isolated and single spores were obtained, resulting in 100 different types of single spore strains of Morchella siliquae, numbered G1-G100. At the Kunming Institute of Botany, Chinese Academy of Sciences, conventional edible fungus breeding methods were used to hybridize and select hybrid strains that were non-antagonistic, non-sectoral, with vigorous mycelial growth, slow aging, and abundant sclerotia formation, as the intended spaceflight carrier strain (numbered G14-100). Conventional ITS molecular biological identification of edible fungi identified it as Morchella siliquae ( Morchella sextelata ).

[0053] S3. The strain was carried into space on the Shenzhou XIV manned spacecraft on June 5, 2022, and returned to the ground in the Shenzhou XIV manned spacecraft on December 4, 2022. After being uncorrelated, it was brought back to the Culture Collection Center of the Kunming Institute of Botany, Chinese Academy of Sciences for relevant research.

[0054] S4. The spaceborne strain G14-100 was activated and systematically screened to obtain 500 single-mycelial strains, numbered 100G01-100G500.

[0055] S5. Mating type genetic testing was performed on the 500 strains obtained, confirming that they contained both the Mat1-1 and Mat1-2 mating types (see Du X.H et al., 2017). Subsequently, mycelial growth rate, vigor, consistency, stability, antagonism, and salt tolerance of these 500 strains were studied in accordance with "GB / T 21125-2007 Technical Specifications for the Selection and Breeding of Edible Fungi." Those strains containing both the Mat1-1 and Mat1-2 mating types, with the fastest mycelial germination rates, neat margins, dense sclerotia, and minimal pigmentation, were selected. Multi-site, multiple-step fruiting screening was conducted, referencing the applicant's previously granted national invention patent (Patent No.: CN107409763B). A strain of Morchella liumei (Six-sister) was obtained. It exhibits rapid mycelial growth in both the original strain, cultivated strain, and nutrient bags, strong resistance to freezing and other bacteria, early and abundant primordia formation, high juvenile density, and a high survival rate. Its commercial mushrooms are dark reddish-brown to blackish-brown, have a pointed conical shape, a short, white stipe, are resistant to brittleness, and offer high yields per mu. This strain has achieved the goal of domesticating and breeding a superior strain. This strain has been named "Meizai No. 5" and has been preserved in the Kunming Culture Collection of the Chinese Academy of Sciences (KUNCC) using a 10% glycerol + distilled water method.

[0056] Application Examples

[0057] This application example uses the Liumei Morchella strain Meizai No. 5 provided in Example 1 for cultivation comparison with the strain G14-100 that has not been carried on space flight, and examines the mycelial growth rate, the number of primordia generated, the number of young mushrooms formed, the number of commercial mushrooms and the yield per unit area of ​​the original strain, cultivated strain and nutrient bag of the test strain.

[0058] The cultivar formula used in this embodiment is: 40% high-quality wheat, 58% corn cobs, 2% slaked lime, with a moisture content of 60-63% and a pH of 7.

[0059] The formula of the nutrient bag used in this embodiment is: 30% high-quality wheat, 68% corn cobs, 2% slaked lime, with a moisture content of 60-63% and a pH of 7.

[0060] When comparing cultivation, the cultivation conditions of the two strains must be kept consistent, and they should be cultivated according to the following cultivation methods:

[0061] 1) Cultivation materials: The main materials are corn cobs and wheat, and the auxiliary materials are lime, gypsum, etc.

[0062] 2) Cultivation season: October to December when soil temperature is 5-15℃.

[0063] 3) Cultivation method: field covering with soil and film mulching.

[0064] 4) Management methods: The soil temperature should be controlled between 8~20℃ during the mycelium culture period; the soil temperature should be controlled between 8~13℃ during the primordium differentiation and young mushroom growth period, the relative humidity should be 80%~95%, and the light intensity should be 400~800Lux.

[0065] 5) Harvesting standard: When the cap length is greater than 6cm, it can be harvested (e.g. Figure 2 shown).

[0066] The cultivation comparison results are shown in Table 1.

[0067] Table 1. Comparative results of Liumei Morel cultivation

[0068] variety Time for original seed to grow fully (18℃, 0.5kg / bottle) Cultivated seeds full growth time (18℃, 1kg / bag) Time for nutrient bags to be full (ground temperature 12℃) Number of primordia (per square centimeter) Number of young mushrooms formed (pieces / square meter) Yield (kg / mu) Meizai No. 5 7 12 7 10 300 2000 G14-100 16 20 10 3 200 700

[0069] As shown in Table 1, compared with cultivation using the non-spaceborne strain G14-100, the Meizai No. 5 strain significantly shortened the time it took for the original seed, cultivated seed, and nutrient bag to reach full growth. The number of primordia formed reached 10 per square centimeter, an increase of approximately 233%. The number of young mushrooms formed reached 300 per square meter, an increase of approximately 50% compared to G14-100. The yield reached 2,000 kg per mu, almost three times that of G14-100.

[0070] In summary, the present invention provides a strain of Morchella esculenta strain Meizai 5 and its applications. The strain, Meizai 5, was subjected to spaceflight-induced genetic variation, followed by subculture to screen for stably inherited traits, and was obtained through fruiting screening tests. The strain, Meizai 5, exhibits rapid mycelial growth in its original strain, cultivated strain, and nutrient bags, strong frost and bacterial resistance, early and abundant primordium formation, high juvenile mushroom density, and high survival rate. The commercial mushrooms are dark reddish-brown to blackish-brown, have a pointed conical shape, a short, white stipe, are not easily brittle, and have a high yield per mu, thus possessing broad application prospects.

[0071] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A strain of Morchella liumei, Meizai 5, characterized by: The deposit number is CGMCC No. 41344, and it was deposited in the General Microbiology Center of China Culture Collection Administration on June 25, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. The Morchella liumei strain Meizai No. 5 according to claim 1, characterized in that The six-sister morel strain Meizai No. 5 includes a first specific DNA fragment with a size of 455bp and a second specific DNA fragment with a size of 362bp. The nucleotide sequence of the first specific DNA fragment is such as SEQ ID NO: 2, and the nucleotide sequence of the second specific DNA fragment is such as SEQ ID NO:

3.

3. The Morchella liumei strain Meizai 5 according to claim 2, characterized in that The specific DNA fragment is obtained by PCR amplification of the Morchella esculenta strain Meizai No. 5 using two pairs of specific primers; the two pairs of specific primers include Primer_MZ5_1L and Primer_MZ5_1R, and Primer_MZ5_2L and Primer_MZ5_2R, and their nucleotide sequences are shown in SEQ ID NO:4 to SEQ ID NO:7, respectively.

4. The six-sister morel strain Meizai No. 5 according to claim 3, characterized in that The amplification system for PCR amplification using the specific primers is: PCR Buffer 1×, MgCl2 1.50 mM, dNTPs Mix 0.25 mM, 1.00 mM each of the specific primers, rTaq Polymerase 1.5 U, template DNA 50 ng; The reaction conditions are: Pre-denaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 60 s, 53°C for 40 s, and 72°C for 30 s; final extension at 72°C for 10 min.

5. An application of the six-sister Morchella strain Meizai No. 5 as described in any one of claims 1 to 3 in Morchella cultivation and production.

6. The use according to claim 5, characterized in that The cultivation conditions of the six-sister morel strain Meizai No. 5 are as follows: the soil temperature during cultivation is 5~16°C, the soil temperature during the mycelium culture period is controlled at 8~20°C; the soil temperature during the primordium differentiation and young mushroom growth period is controlled at 8~13°C, the relative humidity of the air is 80%~95%, and the light intensity is 400~800Lux.

7. The use according to claim 6, characterized in that The cultivation period of the six-sister morel strain Meizai No. 5 is 90 to 130 days.

8. The use according to claim 7, characterized in that According to the percentage by weight, the nutrient pack of the Six Sister Morel strain Meizai No. 5 includes: Wheat kernels 28%~43%, corn cobs 55%~70%, slaked lime 1%~2%.

9. The use according to claim 8, characterized in that The water content of the nutrient pack is 60% to 65%, and the pH is 6.5 to 7.5.

Images