Desulfurization vibrio and application thereof in repairing sulfate and halogenated hydrocarbon pollution

Abstract

The invention relates to the field of environmental bioremediation, in particular to a novel Desulfovibrio Co strain and application of the novel Desulfovibrio Co strain in reduction of sulfate type oxidized sulfide and degradation and conversion of 1, 1, 1-trichloroethane. The desulfurization vibrio Co strain is preserved in China General Microbiological Culture Collection Center (CGMCC) on February 24, 2024, the address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, the postcode is 100101, and the preservation number is CGMCC No.41182. The desulfurization vibrio Co strain can be used for preparing the desulfurization vibrio Co strain.

Description

Technical Field

[0001] The invention relates to the field of environmental bioremediation, and in particular to a strain of Desulfovibrio and its application in remediating sulfate (sulfate-oxidized sulfide) and halogenated hydrocarbon pollution (1,1,1-trichloroethane). Background Art

[0002] Sulfate, sulfite and thiosulfate (collectively referred to as sulfate oxidized sulfides in this article) are an important class of inorganic compounds, which are widely used in chemical synthesis and industrial production activities such as fertilizers, pesticides, metal smelting, and petroleum refining. The widespread use of sulfate oxidized sulfides in industrial production has led to their ubiquitous presence in the environment. These compounds can react with a variety of harmful heavy metal ions to form stable salts, which in turn aggravates the environmental pollution load. Sulfate reduction refers to the biochemical reaction process in which sulfate-reducing bacteria reduce sulfate oxidized sulfides to hydrogen sulfide under anaerobic conditions. It is an important part of the earth's sulfur cycle. This reaction process is widely present in environmental media such as marine sediments, wetlands, swamps, and groundwater. Halogenated hydrocarbons are also a common class of organic compounds in sediments and groundwater environments. The emission of halogenated hydrocarbons caused by industrial and agricultural production brings relatively serious pollution to the environment. The most serious halogenated hydrocarbon pollution in my country's groundwater environment is chlorinated alkanes, including trichloroethane and dichloroethane. Halogenated hydrocarbons are degraded and transformed mainly by reduction and dehalogenation reactions in anaerobic environments, and this reaction is mainly driven by a type of specialized organic halogen-respiring bacteria. The coexistence of sulfate and halogenated hydrocarbon pollution in anaerobic environments such as groundwater is common. When sulfate-reducing bacteria and organic halogen-respiring bacteria exert catalytic reduction activities respectively, the two different microbial populations will compete for carbon sources and electron donors under coexistence conditions, affecting the degradation efficiency of the two pollutants.

[0003] In addition to catalyzing the reduction of sulfate, sulfate-reducing bacteria often have more diverse metabolic activities. In anaerobic environments, sulfate-reducing bacteria are not only directly involved in the conversion of sulfur, but are also closely related to the degradation of organic matter. Sulfate-reducing bacteria use sulfate as an electron acceptor to oxidize organic matter and produce mineral products such as carbon dioxide, which not only contributes to the degradation of organic matter in anaerobic environments, but also indirectly affects the global carbon cycle. In addition, while reducing sulfate, sulfate-reducing bacteria can also degrade some organic pollutants such as aromatic compounds and halogenated hydrocarbons through cometabolism, converting them into more easily degradable, low-toxic compounds or low-halogenated compounds. Sulfate-reducing bacteria can degrade and transform halogenated hydrocarbons while reducing sulfate. This process overcomes the problem of reduced degradation efficiency of the bacterial community caused by competition for nutrients, and plays an important role in pollutant removal and environmental remediation.

[0004] Reports show that some sulfate-reducing bacteria, such as Desulfovibrio, Desulfobacter, and Desulforomonas, can cometabolize dechlorinated halogenated hydrocarbons, but only act on chlorinated olefin halogenated hydrocarbons, such as tetrachloroethylene and trichloroethylene. Among them, halogenated hydrocarbons are divided into saturated and unsaturated categories. Unsaturated halogenated hydrocarbons, such as halogenated olefins, contain carbon-carbon double bonds, are active in nature, and are easily degraded and transformed by chemical and biological reactions. Saturated halogenated hydrocarbons, such as halogenated alkanes, have each atom of the chain hydrocarbon molecule bonded to each other by a strong δ bond, are highly stable, and are not easily degraded and transformed. At present, there are no reports on sulfate reduction and cometabolism of dechlorinated alkane halogenated hydrocarbons, and no strains with the ability to cometabolize and degrade chlorinated alkanes have been found in the genus Desulfovibrio. Summary of the invention

[0005] The invention aims to provide a strain of Desulfovibrio and its application in repairing sulfate (sulfate-oxidized sulfide) and halogenated hydrocarbon pollution (1,1,1-trichloroethane).

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A strain of Desulfovibrio, Desulfovibrio sp., was deposited in the General Microbiology Center (CGMCC) of China Microorganism Culture Collection Administration on February 24, 2024, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, Deposit number: CGMCC No.41182.

[0008] The strain Co is a Gram-negative bacterium, and the similarity of its 16S rRNA gene sequence with the aminophilus strain ALA-3 of the genus Desulfovibrio is 98.95%, so the strain Co is identified as Desulfovibrio.

[0009] An application of the Desulfovibrio, the application of the strain Co in degrading sulfate-oxidized sulfides and halogenated alkanes.

[0010] The strain is used in degrading sulfate-type oxidized sulfides and halogenated alkanes in environmental systems such as water bodies and soil.

[0011] The strain Co is used in reducing sulfate-oxidized sulfides.

[0012] The sulfate oxidized sulfide is one or more of sulfate, sulfite and thiosulfate.

[0013] The strain Co is used in dechlorination and degradation of halogenated alkanes.

[0014] The halogenated alkane is 1,1,1-trichloroethane.

[0015] A bacterial agent for degrading pollutants, the bacterial agent contains the Desulfovibrio Co strain.

[0016] The bacterial agent is one or more of the culture, bacterial suspension, concentrate and separation liquid of the strain.

[0017] The culture of the strain is prepared by adding a carbon source, an electron donor and an electron acceptor to an anaerobic inorganic salt medium, inoculating the Desulfovibrio Co strain and culturing at pH 7.2, 37°C and in the dark; wherein the carbon source and the electron donor are lactate; and the electron acceptor is sulfate, sulfite or thiosulfate.

[0018] The obtained culture is centrifuged, the precipitate is collected and resuspended to obtain a resuspended liquid; the liquid phase is a separation liquid; the culture is concentrated to obtain a concentrate.

[0019] An application of the bacterial agent for degrading pollutants, wherein the bacterial agent is used in degrading sulfate-based oxidized sulfides and halogenated alkanes.

[0020] The advantages of the present invention are:

[0021] The Co strain obtained by the invention is a strain of desulfurizing vibrio screened from the bottom mud of polluted rivers.

[0022] The strain Co is a Gram-negative bacterium. The similarity of 16S rRNA gene sequence with strain ALA-3 of aminophilus species in Desulfovibrio is 98.95%, and strain Co is identified as Desulfovibrio.

[0023] Strain Co can degrade sulfate, sulfite and thiosulfate into hydrogen sulfide under the growth conditions of 37℃ and pH 7.2, and can tolerate up to 20mM sulfate. In addition, the strain can also degrade most of the added 88μmol 1,1,1-trichloroethane into 1,1-dichloroethane. These degradation abilities of strain Co provide an important bacterial resource for the in situ remediation of sulfate and 1,1,1-trichloroethane contaminated sites. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The cell morphology of strain Co under a scanning electron microscope provided in an embodiment of the present invention;

[0025] Figure 2 The degradation curve of the strain Co provided in the embodiment of the present invention for sodium sulfate;

[0026] Figure 3 The degradation curve of the strain Co provided in the embodiment of the present invention for sodium sulfite;

[0027] Figure 4 The degradation curve of the strain Co provided in the embodiment of the present invention for sodium thiosulfate;

[0028] Figure 5 This is the degradation curve of 1,1,1-trichloroethane by the strain Co provided in the embodiment of the present invention. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further explained below in conjunction with specific embodiments, but it should not be understood as limiting the present invention.

[0030] Example 1: Isolation, purification and identification of strains

[0031] (1) Prepare basal culture medium:

[0032] The components of anaerobic inorganic salt culture medium are: NaCl 1.0g / L, MgCl2·6H2O 0.5g / L, KH2PO40.2g / L, NH4Cl 0.3g / L, KCl 0.3g / L, CaCl2·2H2O 0.015g / L, FeCl2·4H2O1.5mg / L, CoCl2·6H2O 190μg / L, MnCl2·4H2O 100μg / L, ZnCl2 70μg / L, H3BO36μg / L, Na2MoO4·2H2O 36μg / L, NiCl2·6H2O 24μg / L, CuCl2·2H2O 2μg / L, Na2SeO3·5H2O 6μg / L, Na2WO4·2H2O 8μg / L, resazurin indicator 0.025% (w / v), L-cysteine ​​24mg / L, dithiothreitol 38.5mg / L, NaHCO3 2.52g / L (30mM), adjust the pH to 7.2-7.3. After high-pressure sterilization at 121℃ for 15 minutes, add multivitamins. The final concentrations of various vitamins in the culture medium are as follows: biotin 20μg / L, folic acid 20μg / L, pyridoxine hydrochloride 100μg / L, riboflavin 50μg / L, thiamine 50μg / L, pantothenic acid 50μg / L, niacin 50μg / L, vitamin B12 50μg / L, p-aminobenzoic acid 50μg / L, lipoic acid 50μg / L.

[0033] (2) Enrichment of sulfate-reducing anaerobic degrading bacteria:

[0034] 80 mL of the anaerobic inorganic salt medium described in step (1) above was dispensed into a 120 mL serum bottle, 20 mM sodium lactate was added as a carbon source and electron donor, and 5 mM Na2SO4 was added as an electron acceptor, and the headspace gas was N2 / CO2 (80 / 20, v / v). In an anaerobic glove box, 3 mL of sediment slurry suspension (collected from Xihe, Shenyang, Liaoning) was inoculated and the serum bottle was sealed with a blue rubber stopper and an aluminum cap to establish an enrichment culture system. The culture was kept static at pH 7.2 and 37°C in the dark, and the formation process of hydrogen sulfide was monitored by a methylene blue spectrophotometer. After the mass balance was calculated, after sodium sulfate was completely converted into hydrogen sulfide, the culture was repeatedly transferred to the enrichment system of step (2) at an inoculum amount of 3% (v / v), and the number of transfers was 5 times.

[0035] (3) Isolation of sulfate-reducing anaerobic degrading bacteria:

[0036] 9 mL of the inorganic culture medium described in step (1) above was dispensed into a 20 mL culture bottle, the headspace gas was N2 / CO2 (80 / 20, v / v), and after sealing with a blue rubber stopper and an aluminum cap, 5 mM Na2SO4 was added through a microinjector. 1 mL of the enriched culture solution of the sulfate-reducing anaerobic degrading bacteria was transferred from the 120 mL serum bottle in step (2) above to the culture bottle to establish a 10 -1 Repeat the above 10-fold gradient dilution operation until a 10-fold gradient dilution is established. -10 Dilution bottle. Wait for 10 -10 After the Na2SO4 in the diluted culture solution is completely degraded to hydrogen sulfide, about 50 μL of the culture solution is applied to a culture dish containing a solid culture medium of 20 mM sodium lactate and 5 mM Na2SO4 (the solid culture medium is prepared by adding 2% agar powder to the liquid culture medium in the above step (1)). The culture dish is moved into an anaerobic glove box and cultured in the dark at 37°C for 10-20 days. A single colony is picked and inoculated into a liquid culture medium containing Na2SO4 (5 mM) and 20 mM sodium lactate, and cultured at pH 7.2 and 37°C in the dark. By monitoring the degradation of Na2SO4, the Na2SO4-degrading bacteria are isolated and purified.

[0037] (4) Identification of strains:

[0038] The Na2SO4-degrading strain obtained by screening through the above process has a smooth white colony. The bacteria are arc-shaped and Gram-negative (see Figure 1 The genome was extracted using a soil genomic DNA extraction kit, and PCR amplification was performed using the universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') of the bacterial 16S rRNA gene. The amplified product was submitted to a sequencing company for sequencing.

[0039] The 16S rRNA gene sequence is as follows:

[0040] TTTCAACTGGAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCGT

[0041] GCTTAACACATGCAAGTCGTGCGAGAAAGGTTCCTTCGGGGACTGAG

[0042] TAGAGCGGCGCACGGGTGAGTAACGCGTGGGTGACCTACCCAGGAG

[0043] ACCGGGATAACAGTGGGAAACTGCTGCTAATACCGGGTACGCTTCATA

[0044] TTTCACGTATGGGGGAAAGGCGGCCTCTGCTTGCAAGCTGCCACTCTT

[0045] GGATGGGCCCGCGTCTCATTAGCTTGTTGGTAGGGTAACGGCCTACCA

[0046] AGGCGACGATGAGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGG

[0047] ACTGGAACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATAT

[0048] TGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGAAG

[0049] AAGGCCTTCGGGTCGTAAACCTCTGTCAGGAGGGAAGAAACCATGGG

[0050] AGTCGAACAGGCTCTCGTGCTGACGGTACCTCCGGAGGAAGCACCGG

[0051] CTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTA

[0052] ATCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGTGCCGTAAGTCG

[0053] GATGTGAAAGCCCTCGGCTCAACCGGGGAACTGCATTCGATACTGCG

[0054] GTGCTTGAGTGTCGGAGAGGGTGGCGGAATTCCAGGTGTAGGAGTGA

[0055] AATCCGTAGATATCTGGAGGAACACCAGTGGCGAAGGCGGCCACCTG

[0056] GCCGACAACTGACGCTGAGGTGCGAAAGCGTGGGGATCAAACAGGA

[0057] TTAGATACCCTGGTAGTCCACGCTGTAAACGATGGATGCTAGGTGTCG

[0058] GGGGTTTACCCTCGGTGCCGCAGTTAACGCGTTAAGCATCCCGCCTGG

[0059] GGAGTACGGTCGCAAGGCTGAAACTCAAAGGAATTGACGGGGGCCC

[0060] GCACAAGCGGTGGAGTATGTGGTTTAATTCGATGCAACGCGAAGAAC

[0061] CTTACCTGGGTTTGACATCCCGCGAATCCCTATGAAAATAGGGAGTGC

[0062] CCTTCGGGGAGCGCGGAGACAGGTGCTGCATGGCTGTCGTCAGCTCG

[0063] TGCCGTGAGGTGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTGTT

[0064] GCCAGTTGCTACCAGGTAATGCTGGGCACTCTGGCGAGACTGCCCGG

[0065] GTCAACCGGGAGGAAGGTGGGGACGACGTCAAGTCATCATGGCCCTT

[0066] ACATCCAGGGCTACACACGTACTACAATGGCAGGTACAAAGGGTTGC

[0067] CAAGCCGCGAGGCCGCGCTAATCCCAGAAAGCCTGTCTCAGTCCGGA

[0068] TTGCAGTCTGCAACTCGACTGCATGAAGCTGGAATCGCTAGTAATCCC

[0069] GGATCAGCATGCCGGGGTGAATACGTTCCCGGGCCTTGTACACACCGC

[0070] CCGTCACACCACGAAAGCTGGTTTTACCCGAAGCCGGCGGACTAACC

[0071] GCAAGGGGGTAGCCGTCTACGGTAGGACCGGTGATTGGGGTGAAGTC

[0072] GTAACAAGGTAGCCGTAGGGGAACCTGCGGCTGGATCACCTCCTTTA

[0073] AA

[0074] The BLAST search results of the 16S rRNA gene sequence of the strain showed that the species homology with the ALA-3 strain from the Desulfovibrio aminophilus species reached 98.95%. The strain was classified into the genus Desulfovibrio and named Co, and deposited in the General Microbiological Center (CGMCC) of the China Microbiological Culture Collection Administration, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, Deposit Number: CGMCC 41182.

[0075] Example 2: Identification of the degradation performance of strain Co on sulfate

[0076] 20 mM sodium lactate was added to the 80 mL anaerobic inorganic salt basal medium described in step (1) as a carbon source and electron donor, and 5 mM Na2SO4 was added as an electron acceptor. 1% (v / v) Co pure bacteria was inoculated and cultured at pH 7.2 and 37°C in the dark. S was detected using an ultraviolet spectrophotometer (UH5300 UV / VIS). 2-Generate a curve to represent the sulfate reduction process. The UV spectrophotometer parameters are as follows: measure absorbance / transmittance, select Abs as the data mode, and wavelength 480nm. Determination process: Prepare solution 1: a mixed solution of hydrochloric acid (50mM) and copper sulfate (5mM) as the measurement group, and solution 2: hydrochloric acid (50mM) as the control group. Add 0.1mL of culture supernatant to 3.9mL of solution 1 and solution 2 respectively, mix them immediately, and quickly measure the absorbance of solution 1 at 480nm when solution 2 is the substrate control, and subtract the measurement result of solution 1 from the measurement result of solution 2. According to the measured S 2- concentration to detect sulfate reduction (see Figure 2 ).

[0077] The analysis results showed that the Co strain could completely reduce 5mM Na2SO4 to hydrogen sulfide in about 15 days.

[0078] Example 3: Identification of the degradation performance of strain Co on Na2SO3

[0079] 20 mM sodium lactate was added to the 80 mL anaerobic inorganic salt basal medium described in step (1) as a carbon source and electron donor, and 5 mM Na2SO3 was added as an electron acceptor. 1% (v / v) Co pure bacteria was inoculated and cultured at pH 7.2 and 37°C in the dark. S was quantitatively monitored under the above UV spectrophotometric conditions. 2- Concentration (see Figure 3 ).

[0080] The analysis results showed that the Co strain could completely degrade 5mM Na2SO3 into hydrogen sulfide in about 15 days.

[0081] Example 4: Identification of the degradation performance of strain Co on Na2S2O3

[0082] 20 mM sodium lactate was used as the carbon source and electron donor, and 5 mM Na2S2O3 was added as the electron acceptor. 1% (v / v) Co pure culture was inoculated and cultured at pH 7.2 and 37°C in the dark. The S 2- Concentration (see Figure 4 ).

[0083] The analysis results showed that the Co strain could completely degrade 5mM Na2S2O3 into hydrogen sulfide in about 20 days.

[0084] Example 5: Ability of strain Co to degrade 1,1,1-trichloroethane (1,1,1-TCA)

[0085] 6 μL (liquid phase concentration 0.52 mM) 1,1,1-TCA was added to the 80 mL inorganic salt basal medium described in step (1) above through a microinjector, with 20 mM sodium lactate as a carbon source and electron donor, and 5 mM sodium sulfate as an electron acceptor. The Co strain was inoculated at a concentration of 1% (v / v), and was cultured at pH 7.2 and 37°C in the dark for 40 days to remove the rubber plug adsorption in the system, and 50-60% of the 1,1,1-TCA in the culture system was reduced and degraded to 1,1-dichloroethane (1,1-DCA).

[0086] The detection method of 1,1,1-TCA / 1,1-DCA is as follows: 1,1,1-TCA and its degradation products are determined by gas chromatography (Agilent 7890B) in series with a flame ionization detector (FID) and an Agilent DB-624 capillary column (60m×0.32mm×1.8μm). The gas chromatography parameters are as follows: injection port temperature 200℃; temperature program: 60℃, hold for 2min; then heat to 200℃ at a rate of 25℃ / min, hold for 1min; carrier gas is helium, column flow rate 3mL / min; FID detector temperature 300℃; fuel gas is hydrogen, flow rate 30mL / min, combustion aid is synthetic air, flow rate 350mL / min, tail gas is nitrogen, flow rate 25mL / min. Manual injection is adopted, and qualitative and quantitative analysis of the parent compound and degradation products is carried out based on the retention time and peak area at 5.7min and 5.0min (see Figure 5 ).

[0087] In summary, the Desulfovibrio Co strain provided by the present invention can completely reduce 5mM Na2SO4 and 5mMNa2SO3 to hydrogen sulfide in about 15 days; completely reduce 5mM Na2S2O3 to hydrogen sulfide in about 20 days; and dechlorinate and reduce 50-60% of the 88μmol 1,1,1-TCA initially added to the system to 1,1-DCA in about 30 days.

[0088] The strain is prepared into a bacterial agent according to the above description, for example, a carbon source, an electron donor and an electron acceptor are added to an inorganic salt culture medium, and the sulfate-reducing Desulfovibrio coli Co strain is inoculated and cultured at pH 7.2, 37°C and protected from light for 10-20 days; wherein the carbon source and the electron donor are lactate; 20 mM sodium lactate is added to each 80 mL of inorganic salt culture medium, and the Co strain is inoculated at a 1% (v / v) inoculation amount; the obtained culture is centrifuged to collect the precipitate and resuspended to obtain a resuspended liquid; the liquid phase is a separation liquid; the culture is concentrated to obtain a concentrate, that is, a bacterial agent. Applying it to the environment or soil has good application prospects for the bioremediation of sulfate-oxidized sulfides and 1,1,1-TCA contaminated sites.

[0089] The above-described embodiments are preferred application cases of the present invention, but do not impose any form of limitation on the present invention. In actual application, without departing from the scope of the technical solution of the present invention, the above-disclosed technical contents can be used to make slight changes or modifications to equivalent embodiments with equivalent changes.

Claims

1. A strain of Desulfovibrio, characterized in that: Desulfovibrio sp., the strain was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC) on February 24, 2024, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, Deposit Number: CGMCCNo.41182.

2. An application of Desulfovibrio according to claim 1, characterized in that: The strain Co is used in degrading sulfate-based oxidized sulfides and halogenated alkanes.

3. The use of Desulfovibrio according to claim 2, characterized in that: The strain Co is used in reducing sulfate-oxidized sulfides.

4. The use of Desulfovibrio according to claim 3, characterized in that: The sulfate oxidized sulfide is one or more of sulfate, sulfite and thiosulfate.

5. The use of Desulfovibrio according to claim 2, characterized in that: The strain Co is used in dechlorination and degradation of halogenated alkanes.

6. The use of Desulfovibrio according to claim 5, characterized in that: The halogenated alkane is 1,1,1-trichloroethane.

7. A bacterial agent for degrading pollutants, characterized in that: The bacterial agent contains the Desulfovibrio Co strain described in claim 1.

8. The microbial agent for degrading pollutants according to claim 5, characterized in that: The bacterial agent is one or more of the culture, bacterial suspension, concentrate and separation liquid of the strain.

9. An application of the pollutant-degrading bacterial agent according to claim 7, characterized in that: The bacterial agent is used in degrading sulfate oxidized sulfides and halogenated alkanes.

Images