Sheep-derived A2-type mannheimia haemolytica strain, vaccine and application

Abstract

The invention relates to the technical field of pathogenic bacteria and vaccines thereof, in particular to a sheep-derived A2-type mannheimia haemolytica strain, a vaccine and application. The invention discloses a sheep-derived A2 type mannheimia haemolytica strain, and the preservation number of the sheep-derived A2 type mannheimia haemolytica strain is CGMCC According to the bacterial strain, due to gene frame-shift mutation, protein translation is terminated in advance, so that the protein truncation of the colicin transporter is caused. The characteristics can be utilized to realize the specificity test of the strain and be used for evaluating the immune effect of the vaccine. The aluminum hydroxide gel vaccine is prepared by optimizing a fermentation process and a concentration process and performing vaccine compatibility after inactivation. Safety tests show that the vaccine has good safety to sheep. Efficacy tests prove that the vaccine has a good protection effect on challenge after mice and sheep are immunized, and the protection rate can reach 80% or above. According to the technical scheme, the technical problem that the mannheimia haemolytica A2 type vaccine for sheep is lacked in the prior art can be solved, and the mannheimia haemolytica A2 type vaccine has a good popularization prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogenic bacteria and vaccines thereof, and in particular to a sheep-derived A2 type hemolytic Mannheimia strain, a vaccine and application thereof. Background Art

[0002] Mannheimia haemolytica is one of the most important pathogens of sheep respiratory diseases, and vaccines are currently the most effective means. In 1960, Mannheimia haemolytica was divided into 17 capsule serotypes based on the difference in capsule surface antigens using the indirect hemagglutination test, of which type A (arabinose fermentation) Mannheimia haemolytica includes 12 serotypes (A1, A2, A5, A6, A7, A8, A9, A12, A13, A14, A16 and A17). Among the 12 type A serotypes, the most common and prevalent serotypes in sheep are A1 and A2 serotypes, followed by type A6.

[0003] Sheep fibrinous pneumonia caused by Mannheimia haemolytica type A2 is one of the main serotypes of Mannheimia haemolytica in sheep. It can infect sheep of all ages and even cause death, which is a serious threat to the sheep breeding industry. Although there are reports of the isolation of natural isolates of Mannheimia haemolytica type A2, the development process of Mannheimia haemolytica vaccine in sheep is very complicated. It not only requires the strain itself to have good immunogenicity and virulence, but also involves many technical difficulties such as strain isolation and cultivation, sequencing identification, production process, immune-attack protection of this type of animal, and replacement of animal testing. Therefore, there is still no commercial vaccine on the market. Therefore, in view of the shortage of Mannheimia haemolytica type A2 vaccine for sheep, it is urgent to develop a sheep-derived Mannheimia haemolytica type A2 strain suitable for vaccine preparation. Summary of the invention

[0004] The present invention aims to provide a sheep-derived A2-type hemolytic Mannheimia strain to solve the technical problem of the lack of a sheep-derived Mannheimia A2-type hemolytic Mannheimia vaccine in the prior art.

[0005] In order to achieve the above object, the present invention adopts the following technical scheme:

[0006] A sheep-derived A2 hemolytic Mannheimia strain, whose preservation number is CGMCC NO.32899.

[0007] Furthermore, the colicin transporter gene in the strain is mutated, and the mutated gene encoding sequence is a truncated protein as shown in SEQ ID NO.10.

[0008] Furthermore, the sequence of the colicin transporter gene is shown in SEQ ID NO.9.

[0009] Furthermore, the strain was isolated from sick sheep with goat bronchial symptoms; the samples collected from the sick sheep were first plated on a blood agar plate containing 4.0% calf serum and cultured in a constant temperature incubator at 37°C for 18 to 24 hours, and then a single colony was picked and PCR was performed using hemolytic Mannheimia A2 type specific primers to screen positive strains; the sequences of the hemolytic Mannheimia A2 type specific primers are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0010] Furthermore, its LD for mice 50 8.6×10 7 CFU.

[0011] The technical solution also provides an application of a sheep-derived A2 type hemolytic Mannheimia strain in the preparation of a vaccine.

[0012] The technical scheme also provides a Mannheimia vaccine containing a sheep-derived A2-type hemolytic Mannheimia strain. The sheep-derived A2-type hemolytic Mannheimia strain is fermented and cultured to obtain a fermentation bacterial liquid; the fermentation bacterial liquid is inactivated by formaldehyde to obtain an inactivated antigen bacterial liquid; the inactivated antigen bacterial liquid is mixed with an aluminum hydroxide gel adjuvant to obtain an inactivated vaccine; the volume ratio of the inactivated antigen bacterial liquid to the aluminum hydroxide gel adjuvant is 5:1.

[0013] Furthermore, the number of sheep-derived A2 hemolytic Mannheimia strains in the inactivated vaccine was ≥ 2.0 × 10 10 CFU / ml.

[0014] Furthermore, mice were immunized with 0.1 ml of inactivated vaccine and then 8.6 × 10 8 The mice were challenged with CFU sheep-derived A2 hemolytic Mannheimia strain, and the survival rate of mice was ≥80%;

[0015] Sheep were immunized with 2.0 ml of inactivated vaccine and then 1.0 × 10 10 When sheep were challenged with CFU sheep-derived A2 hemolytic Mannheimia strain, the survival rate was ≥80%.

[0016] The technical solution also provides a method for preparing a Mannheimia vaccine containing a sheep-derived A2-type hemolytic Mannheimia strain, comprising the following steps performed in sequence:

[0017] S1: fermenting and culturing the sheep-derived A2 hemolytic Mannheimia strain to obtain a fermentation liquid;

[0018] Preferably, the fermentation culture is divided into three steps:

[0019] S1-1 Primary seed propagation: A2-type hemolytic Mannheimia strain from sheep is inoculated in tryptone soy broth medium for culture; then streaked on a tryptone soy agar plate for culture; then the formed colonies are inoculated on the slant of the tryptone soy agar plate and cultured to form primary seeds;

[0020] Further preferably, the primary seeds are stored at 2-8°C, the storage period of the primary seeds is no more than 7 days, and the subculture shall not exceed 3 generations;

[0021] Further preferably, the culture is carried out in a tryptone soy broth medium at 37°C and 120 r / min for 10 h; the culture is carried out on a tryptone soy agar plate at 37°C for 18 h; the culture is carried out on a tryptone soy agar plate slant at 37°C for 10 h;

[0022] S1-2 Secondary seed propagation: Use tryptone soy broth medium containing bovine lysed whole blood to re-dissolve the primary seeds, and then use tryptone soy broth medium containing bovine lysed whole blood to culture the bacteria; after the bacteria pass the purity test, obtain the secondary seed solution;

[0023] Further preferably, the secondary seed solution is stored at 2-8°C, and the secondary seed solution with a shelf life of no more than 4 days is used;

[0024] Further preferably, the culture conditions are 37° C., 120 r / min, and culture for 12 h; the volume percentage of bovine lysed blood in the tryptone soy broth medium is 0.2%;

[0025] S1-3 Preparation of fermentation liquid: culturing the secondary seed liquid with tryptone soy broth medium containing bovine lysed whole blood to obtain fermentation liquid;

[0026] Further preferably, the volume percentage of bovine lysed blood in the tryptone soy broth medium is 0.2%; the volume percentage of the secondary seed solution added to the tryptone soy broth medium is 1-2%;

[0027] Further preferably, the culture conditions are 37°C, 120r / min, and culture for 10h;

[0028] S2: The fermented bacterial liquid is concentrated and inactivated to obtain an inactivated antigen bacterial liquid;

[0029] Preferably, the fermentation bacterial solution is concentrated by centrifugation and resuspended in phosphate buffer; then formaldehyde is added to obtain an inactivated antigen bacterial solution after inactivation treatment;

[0030] Further preferably, the fermented bacterial liquid is concentrated 10 times and then formaldehyde is added to inactivate it; the volume percentage of formaldehyde is 0.15%;

[0031] Further preferably, the centrifugation conditions are: 9000 r / min, 4°C, centrifugation for 20 min, and then collecting the bacterial precipitate; the pH value of the phosphate buffer is 7.2-7.4;

[0032] Further preferably, the inactivation condition is inactivation at 37°C for 18 to 24 hours, during which the mixture is shaken intermittently 10 to 12 times, and shaken once every 2 hours, with each shaking operation lasting 1 minute and a rotation speed of 120 r / min;

[0033] S3: mixing the inactivated antigenic bacteria solution with the aluminum hydroxide gel adjuvant to prepare an inactivated vaccine;

[0034] Preferably, the volume ratio of the inactivated antigenic bacterial solution to the aluminum hydroxide gel adjuvant is 5:1; first stir the inactivated antigenic bacterial solution at 50-100 r / min for 5 minutes, then add the aluminum hydroxide gel adjuvant and stir for 15-20 minutes to obtain the inactivated vaccine.

[0035] In summary, the principle and beneficial effects of this technical solution are:

[0036] In view of the shortage of sheep hemolytic Mannheimia A2 vaccine, Chongqing Aolong Biological Products Co., Ltd. isolated a sheep hemolytic Mannheimia A2 strain (Mh-AL2 strain) from the clinic. It has strong toxicity to mice, LD 50 8.6×10 7 CFU, with good immune protection effect. At the same time, the whole genome sequencing and analysis of the Mh-AL2 strain was completed, and it was found that it has unique properties (different from all strains reported by NCBI). After the 204th deoxyribonucleotide of the colicin transporter gene of the strain, the protein translation was terminated prematurely due to a gene frameshift mutation, resulting in truncation of the colicin transporter protein. The nucleic acid sequence of the colicin transporter gene of the Mh-AL2 strain is SEQ ID NO.9, and the protein sequence is SEQ ID NO.10, which can be used for the specific identification of the strain.

[0037] Through a series of process optimization, a vaccine preparation method for the Mh-AL2 strain was established. By optimizing the fermentation process, concentration process, and vaccine compatibility after inactivation, an aluminum hydroxide gel vaccine was prepared. A series of test methods were established, and animal safety and efficacy tests were passed. Safety tests showed that the vaccine was safe for sheep. Efficacy tests proved that the vaccine had a good protective effect on mice and sheep after immunization, and the protection rate of mice and sheep against virus infection could reach more than 80%, proving that it has good safety and protective efficacy for alternative animals and original animals, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the Gram staining result of the isolate in Example 1.

[0039] Figure 2 This is the Wright staining result of the isolate in Example 1.

[0040] Figure 3 The PCR identification results of Mannheimia haemolytica capsule serotype A2 in Example 1 (M: DNA Marker; -: standard negative; + standard positive; 1-6: samples).

[0041] Figure 4 This is the biochemical identification result of the hemolytic Mannheimia Mh-AL2 strain in Example 1.

[0042] Figure 5 These are typical clinical symptoms (mice clumping together) of the mice in the control group after immunization and challenge in Example 3.

[0043] Figure 6 This is a picture of the lung lesions of mice that became ill and died after immunization with the virus in Example 3.

[0044] Figure 7 This is a picture of the spleen lesions of mice that became ill and died after immunization with the virus in Example 3.

[0045] Figure 8 This is a diagram of pathological changes in the lungs of sheep that became ill after immunization and challenge with the virus in Example 5.

[0046] Fig. 9 This is a diagram of pathological changes in the chest cavity of sheep that became ill after immunization and challenge with the virus in Example 5. DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used can be obtained from commercial sources.

[0048] Example 1: Isolation and identification of sheep-derived hemolytic Mannheimia Mh-AL2 strain

[0049] (1) Reagents and equipment

[0050] TSB medium and TSA agar medium were purchased from Zhonghai Biotechnology Co., Ltd.; bovine whole blood with lysed blood cells was purchased from Hohhot Caoyuan Lvye Bioengineering Materials Co., Ltd.; calf serum was purchased from Inner Mongolia Aopsay Biotechnology Co., Ltd.; DNA Marker was purchased from Beijing Solebow Technology Co., Ltd.; agarose was purchased from Oxoid Company; bacterial DNA extraction kit and 2×Taq PCR MasterMixⅡ were purchased from Tiangen Biochemical Technology (Beijing Co., Ltd.).

[0051] The gel imaging system was purchased from Bio-Rad Laboratories-Segart; the conventional gradient PCR instrument and nucleic acid electrophoresis instrument were both purchased from Bio-Rad; the ultracentrifuge was purchased from Eppendorf, Germany; the vortex mixer (model XW-80A) was purchased from Shanghai Qingpu Huxi Instrument Factory; and the ultrapure water instrument (model Milli-Q) was purchased from Millipore, France.

[0052] (2) Sample collection and isolation of sheep hemolytic Mannheimia

[0053] 23 deep nasal swabs were collected from sick goats with goat bronchial symptoms at a goat farm in Dazu District, Chongqing. A sample was collected from the deep nasal cavity of each sick goat using a nasal swab and placed in a 5.0 ml saline centrifuge tube for later pathogen molecular detection and bacterial isolation and identification. All collected samples were placed in a refrigerated sampling box and transported to this laboratory.

[0054] The collected samples were spread on TSA (trypticase soy agar) plates containing 4.0% calf serum and cultured in a 37°C constant temperature incubator for 18 to 24 hours. Then, a single colony was picked and inoculated into TSB medium containing 4.0% calf serum and cultured at 37°C with constant temperature shaking (160r / min) for 16 to 18 hours for bacterial proliferation.

[0055] After the sample was inoculated on a whole blood agar plate and cultured for 18 hours, the colonies that showed β-hemolysis on the plate were selected and purified. After purification, smooth and shiny grass-green hemolytic colonies were found. Gram-negative short rods with blunt ends (such as Figure 1 ), Swiss stain microscopy revealed bipolar densely stained short rods (such as Figure 2 ).

[0056] (3) Extraction and identification of bacterial genomes

[0057] The above-mentioned colonies were taken and the bacterial genome was extracted using the Tiangen Bacterial DNA Extraction Kit, and then serotype-specific PCR amplification was performed. Using its genomic DNA as a template, the hemolytic Mannheimia Mh was first identified using the Lkt primer (Alexander et al., 2008), and then the PCR method for identifying Mh capsule serotypes A1, A2, and A6 established by Klima et al. (Klima et al., 2017) was referred to, and the Hyp, Core2, and TupA target genes were amplified, respectively. The specific primer information is detailed in Tables 1 and 2. As a result, a total of 6 strains were identified as hemolytic Mannheimia A2 (such as Figure 3 ).

[0058] Table 1 Sequence information of universal primer Lkt of Mannheimia haemolytica

[0059]

[0060] Table 2: Primer sequence information for identification of serotypes of Mannheimia haemolytica

[0061]

[0062]

[0063] (4) Pathogenicity test

[0064] The six A2-type isolated strains were inoculated into TSB medium containing 4.0% calf serum and cultured at 37°C with shaking (160 r / min) for 16 h. The bacteria were counted and diluted in 10-fold gradients to prepare 2.0×10 7 ~2.0×10 9 CFU / ml of bacterial solution, 0.5ml of each dilution was taken and inoculated into 5 Kunming mice by intraperitoneal injection, and sterilized TSB medium was set as a control. After inoculation, the mice were isolated and raised, and the incidence and death of the mice were observed, and the median lethal dose was calculated according to the Reed-Muench method. The dead mice were dissected, the pathological changes of each tissue were observed, and the tissue samples were taken aseptically to isolate and identify hemolytic Mannheimia.

[0065] Healthy Kunming mice were challenged with 6 clinically isolated strains of Mannheimia haemolytica. The number of mice that died at each dilution was counted, and the LD of each isolate against mice was calculated according to the Reed-Muench method. 50 The specific results of strains 1 to 6 were: 8.9×10 7 CFU, 8.6×10 7 CFU, 8.6×10 8 CFU, 8.3×10 8 CFU, 8.8×108 CFU, 7.6×10 8 CFU. The results of the median lethal dose showed that the second isolate had the strongest virulence, with an LD 50 8.6×10 7 CFU can be used as a subsequent vaccine candidate strain and named Mh-AL2 strain.

[0066] Based on the above bacterial isolation, serotype PCR identification and pathogenicity studies, a strain (Mh-AL2) with strong proliferation ability and virulence was selected as a vaccine candidate. The Mh-AL2 strain was inoculated into 100 ml of TSB medium containing 4.0% calf serum at a ratio of 2.0%, and cultured overnight at 120 r / min at 37°C for about 18 hours. The colony count on a TSA plate containing 4.0% calf serum was about 4.0×10 9 CFU / ml, packaged, freeze-dried, and stored in a -80℃ refrigerator as the original strain. At the same time, a Mh-AL2 strain was sent to a genetic company for whole genome sequencing.

[0067] The specific deposit information of Mh-AL2 strain is as follows:

[0068] Deposit number: CGMCC NO.32899;

[0069] Name of depository: General Microbiology Center of China Microbiological Culture Collection Administration;

[0070] Address of the depository: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, 100101, China; Tel: 010-64807355);

[0071] Classification and nomenclature: Mannheimia haemolytica;

[0072] Collection date: 2024.12.02.

[0073] (5) Research on Mh-AL2 strain

[0074] (5.1) Biochemical identification

[0075] Biochemical identification of the hemolytic strain of Mannheimia spp. Mh-AL2 was performed on the following test items: raffinose, fructose, indigo matrix, urea, maltose, dulcitol, lactose, sucrose, simon's citrate, mannitol, mannose, sorbitol, hydrogen sulfide, galactose, glucose, OF, OF+paraffin, nitrate, VP test, xylose, arabinose. The test results are detailed in Figure 4Mannheimia haemolytica can decompose and utilize sucrose, mannitol, sorbitol, maltose, galactose, glucose, lactose, xylose, arabinose, raffinose and fructose, but cannot decompose and utilize dulcitol and simon's citrate. OF test is fermentation type, hydrogen sulfide is negative, and VP test is negative. The results of biochemical culture test showed that the culture characteristics of the isolated bacteria Mh-AL2 strain were consistent with those of Mannheimia haemolytica.

[0076] (5.2) Whole genome sequencing and analysis

[0077] The genome of Mh-AL2 bacterial strain is carried out sequencing analysis (full genome sequencing and analysis), find that after 204 positions of deoxyribonucleotides of colicin transporter gene of this bacterial strain, protein translation causes colicin transporter albumen brachymemma due to gene frameshift mutation and premature termination. Colicin transporter albumen is a kind of virulence factor, and its sequence deletion has no scientific research report at present on the influence of Mannheimia, but follow-up experimental study of the present invention has proved that this strain can be used for vaccine production, produces good immune effect.In addition, can also utilize this specific natural gene mutation, can be used for the specificity identification of this strain.

[0078] In addition, in the prevention and control strategy based on immunization, traditional vaccines have played an important role in blocking the transmission and spread of Mannheimia haemolytica-related diseases within and between animal groups. However, in practice, it was found that vaccinated animals and infected animals could not be distinguished. Both vaccination and natural infection will produce antibodies. Researchers cannot distinguish whether the antibodies are produced due to vaccination or natural infection, and thus cannot determine the effectiveness of vaccine immunity. In addition, the same group of animals contains both immunized animals and susceptible and infected animals, making it difficult to achieve animal isolation and prevention and control. In order to effectively detect whether the antibodies are produced by vaccine immunity or natural infection, strains with gene deletion characteristics are usually prepared for vaccine preparation, which is a conventional operation method in the prior art. For example, the document "Zhang Fuxian, Development of colloidal gold test strips for distinguishing animals naturally infected with brucellosis from animals immunized with vaccines, Chinese Animal Husbandry and Veterinary Medicine, 2009" mentioned: BP26 protein was used as a detection antigen (T line) to develop a colloidal gold rapid test strip; the established test strip was used to detect the Brucella infection serum of mice, and mice infected with bovine Brucella S19 and immunized with the BP26-deficient vaccine strain YZ_2 could be successfully identified. Since the BP26-deficient vaccine strain YZ_2 does not contain BP26 protein, the mice immunized with the vaccine do not contain anti-BP26 antibodies. However, BP26 protein exists in natural bovine Brucella, and the antibodies produced by natural immunity contain anti-BP26 antibodies. Therefore, the identification of natural immunity and specific vaccine immunity can be achieved by the missing gene (protein). This technical solution discovered a colicin transporter gene-deficient strain with high virulence that can be used for animal immunization. At the same time, due to the natural deletion of this gene (protein), it is possible to distinguish between natural immunity and specific vaccine immunity based on this point, which can more effectively evaluate the effectiveness of vaccines and achieve effective distinction and isolation of immune animals, susceptible animals and infected animals.

[0079] More specifically, the nucleotide sequence of the colicin transporter gene of the Mh-AL2 strain is shown in SEQ ID NO.9 (the underline indicates the nucleotide sequence used for translation into protein):

[0080] ATGTCTATCAAAAAAGTAACTTTAGCTAGTTTGATTTTATTGGGTTTAACGGCGTGTAGTAGTGGTGG TTCGGGCAGTAGCTCAAACAATGTGGCAAAACGAATACTAAACCGCAAACTACTCAGCAACAAACCGATAAAGCGG CAGCAGAAAAGCAGCAAAAGACAAGGCAGCGAAAGAGAAAGCAGAAGCAGAACGTTTAG

[0081] The amino acid sequence corresponding to the nucleotide sequence of SEQ ID NO.9 of the colicin transporter gene of the Mh-AL2 strain is shown in SEQ ID NO.10:

[0082] MSIKKVTLASLILLGLTACSSGGSGSSSNNVAK RILNRKLLSNKPIKRQQKKQQKTRQRKRKQKQNV*.

[0083] The sequence of SEQ ID NO.10 is compared with the colicin transporter protein of wild-type hemolytic Mannheimia (partial sequence of the protein is shown in XLP99204.1 and XLQ01425.1 sequences of Gene bank, etc.). The protein of this scheme is consistent with the unmutated colicin transporter protein in only the 1-33 amino acid residues (see the double underlined part of SEQ ID NO.10). It can be seen that in the Mh-AL2 strain, the colicin transporter gene not only causes the early termination of protein translation due to the frameshift mutation, but also causes a large number of amino acid residue mutations. The protein expressed by the mutated gene and the original protein are almost two different proteins with different antigenic properties. When distinguishing antibodies produced by natural immunity and vaccine immunity, we can use the colicin transporter protein (preferably, excluding the first 1-33) as an antigen, contact with the serum of naturally immune animals or vaccine immune animals, and achieve the identification of the two animals through the interaction of antigen and antibody. The colicin transporter protein fragment used as an antigen can be achieved by artificial synthesis or induced expression of corresponding transgenic engineering bacteria. Using strains with missing genes (proteins) to identify antibodies produced by natural immunity and vaccine immunity is a conventional method in the existing technology and is also one of the major application values ​​of gene-deficient bacterial strains. The main difficulty is how to obtain gene-deficient strains with good immune effects. The results of this technical solution solve the above-mentioned difficult problems.

[0084] It is also important to emphasize here that compared with artificially prepared gene-deficient strains, natural gene-deficient bacterial strains are more advantageous in terms of preparation difficulty (lower difficulty and lower cost) because they avoid complex transgenic operations and the introduction of exogenous nucleic acid vectors. In addition, natural gene-deficient strains have better genetic stability and better strain safety (transgenic operations have safety issues), and are more suitable for the production of corresponding vaccines.

[0085] Example 2: Preparation of sheep-derived Mannheimia hemolytica Mh-AL2 strain vaccine

[0086] In this example, the inactivated Mannheimia hemolytica vaccine is prepared using the Mannheimia hemolytica Mh-AL2 strain isolated and obtained in the above Example 1, which specifically includes the following steps.

[0087] (1) Preparation of inactivated vaccines

[0088] (1.1) Fermenting and culturing the sheep-derived type A hemolytic Mannheimia strain Mh-AL2 to obtain a fermentation solution, specifically:

[0089] (1.1.1) Primary seed propagation: Take 200μl of the lyophilized strain of the sheep-derived type A hemolytic Mannheimia Mh-AL2 strain, inoculate it into 10ml TSB medium (tryptone soy broth medium), incubate it at 37℃, 120r / min for 10h, then use an inoculation loop to dip the bacterial solution and streak it onto a TSA plate (tryptone soy agar plate), and continue to incubate it at 37℃ for 18h. Select typical colonies under an optical microscope, inoculate several TSA plate slopes, and incubate them at 37℃ for 10 hours as primary seeds. Store at 2-8℃, use for no more than 7 days, and subculture for no more than 3 generations.

[0090] (1.1.2) Secondary seed propagation: Take a primary seed and reconstitute it with 4.0 ml of TSB medium containing 0.2% bovine lysed whole blood. Rinse the bacterial moss on the slope of the TSA plate and inoculate it into 200 ml of TSB medium containing 0.2% bovine lysed whole blood. Incubate at 37°C, 120 r / min for 12 hours. After passing the purity test, store it at 2-8°C as a secondary seed with a usage period of no more than 4 days.

[0091] (1.1.3) Preparation of fermentation liquid: The fermentation liquid is cultured in a fermenter to culture the hemolytic Mannheimia bacteria liquid. The TSB medium is sterilized at 116°C for 30 minutes. When the temperature of the medium is cooled to about 37°C, bovine lysed blood is added to make the bovine lysed blood content in the medium reach 0.2% (v / v). Secondary seed liquid is added at 1% to 2% (v / v) of the total amount of the medium, mixed evenly, and cultured at 37°C and 120 r / min for 12 hours.

[0092] After the bacterial liquid culture is completed, it shall be tested for purity according to the appendix of Part III of the current "Pharmacopoeia of Veterinary Medicine of the People's Republic of China" and it should be pure; at the same time, samples shall be taken for live bacteria count.

[0093] (1.2) Concentrating and inactivating the fermented bacterial solution obtained in the previous step to obtain an inactivated antigen bacterial solution, specifically:

[0094] (1.2.1) Concentration of fermentation broth: The fermentation broth was concentrated by centrifugation at 9000 rpm and 4°C for 20 min. The bacterial precipitate was then collected and resuspended in sterile PBS (phosphate buffered saline) at pH 7.2-7.4 to prepare a 10-fold concentrated broth.

[0095] (1.2.2) Inactivation of fermented bacterial solution: add formaldehyde solution at 0.15% (v / v) of the concentrated bacterial solution, inactivate at 37°C for 18-24 hours, and shake intermittently 10-12 times (shake once every 2 hours, 1 min / time, 120 r / min) to prepare inactivated antigenic bacterial solution. Inactivation test is carried out according to the Appendix of the third volume of the current "Pharmacopoeia of the People's Republic of China", and there should be no sterile growth.

[0096] (1.3) The inactivated antigenic bacteria solution obtained in the previous step was mixed with the aluminum hydroxide gel adjuvant at a volume ratio of 5:1 to prepare an inactivated vaccine, specifically:

[0097] First add the inactivated antigen solution to the emulsification tank, stir at a low speed (50-100r / min) for 5 minutes, then slowly add aluminum hydroxide gel adjuvant (in accordance with the quality standard of aluminum hydroxide gel 3603 of the 2020 edition of the Pharmacopoeia of Veterinary Medicine, Part III), stir for 15-20 minutes to fully mix. The final vaccine contains no less than 2.0×10 Mh-AL2 strain antigen. 10 CFU / ml. According to the current "Pharmacopoeia of Veterinary Medicine of the People's Republic of China", sterility test should be carried out, and there should be no sterile growth.

[0098] (1.4) Packaging

[0099] After passing the above sterility test, quantitative packaging should be carried out. Stirring should be done at any time during packaging to ensure uniform mixing. Stoppering and sealing should be done. Labeling should be applied. Store at 2-8℃.

[0100] According to the above method steps, this embodiment uses the Mh-AL2 strain to prepare three batches of inactivated vaccines of Mannheimia ovis hemolytica (vaccine batch numbers: 2401, 2402, 2403).

[0101] Example 3: Safety and efficacy of the vaccine in BALB / c mice

[0102] (1) Safety test on mice

[0103] Ten BALB / c mice weighing 18-22 g were subcutaneously injected with 0.2 ml of the vaccine and observed for 10 days. All mice were alive and well.

[0104] (2) Immune efficacy test on mice

[0105] Thirty healthy BALB / c mice were randomly divided into three groups, each with 10 mice. The three batches of vaccines (2401, 2402, and 2403) prepared in Example 2 were inoculated subcutaneously on the back of the BALB / c mice at a dose of 0.1 ml. Ten control BALB / c mice with the same conditions were inoculated with sterilized PBS in the same way as controls. 21 days after inoculation, the 30 immunized BALB / c mice and the 10 control BALB / c mice were challenged with Mannheimia ovis-hemolytica (Mh-AL2 strain, challenge dose of 8.6×10 8 CFU), and then observed for 7 consecutive days to observe the death of BALB / c mice and determine the protection status. The test results are shown in Table 3 below. The clinical symptoms of the control group mice after the virus attack mainly included: mice clustering (such as Figure 5 ), bloody secretions were found in the eye sockets of mice. The mice that died of the disease were dissected and analyzed, and their lungs were congested and had obvious bleeding spots. Figure 6 , Splenomegaly, see Figure 7 . It can be seen from the experimental results that after the experimental BALB / c mice were challenged with Mannheimia hemolytica, the 2401 and 2403 batches of vaccines showed an immune protection effect of 9 / 10, and 2402 showed an immune protection effect of 8 / 10. After the control BALB / c mice were challenged with Mannheimia hemolytica, all 10 BALB / c mice in this group died. The above results show that the inactivated Mannheimia hemolytica vaccine prepared by the present invention can effectively protect the immune BALB / c mice against the challenge strain after inoculation of BALB / c mice, and the immune effect of each batch of inactivated vaccine is stable.

[0106] Table 3: Results of efficacy test on BALB / c mice

[0107] Vaccine batch number Immunization dose (ml) Number of BALB / c mice The number of challenge bacteria (CFU) Protection 2401 0.1ml 10 <![CDATA[8.6×10 8 ]]> 9 / 10 2402 0.1ml 10 <![CDATA[8.6×10 8 ]]> 8 / 10 2403 0.1ml 10 <![CDATA[8.6×10 8 ]]> 9 / 10 Control group 0.1ml 10 <![CDATA[8.6×10 8 ]]> 0 / 10

[0108] Example 4: Animal safety test of inactivated vaccine against Mannheimia hemolytica in sheep

[0109] In this example, three batches of inactivated sheep hemolytic Mannheimia vaccine (vaccine batch numbers: 2401, 2402, 2403) prepared in Example 2 were subjected to safety tests on healthy susceptible sheep (about 3 months old). The specific operations are as follows.

[0110] (1) Safety study of a single-dose vaccination

[0111] 20 healthy susceptible sheep were randomly divided into 4 groups as test sheep, 5 in each group, and the three batches of vaccines were inoculated into one group of test sheep through the neck muscle with a single dose of 2.0 ml (1 head), and 5 healthy susceptible sheep with the same conditions were inoculated with sterilized PBS as a control in the same way. The clinical manifestations of the test sheep and the control sheep were observed, and the body temperature was measured at the same time every day for 7 days. The observation results are shown in Table 4 below. The experimental results show that after the three batches of vaccines prepared by the Mh-AL2 strain were inoculated with a single dose, the body temperature, mental state, respiratory condition, appetite, etc. of the test sheep in each group during the observation period were normal, no redness, swelling or nodule formation was observed at the injection site, and the immunized sheep did not show clinical symptoms of sheep hemolytic Mannheimia disease, and there was no significant difference from the control group.

[0112] Table 4: Safety observations of a single dose vaccination of healthy susceptible sheep

[0113]

[0114] (2) Safety study of repeated single-dose vaccination

[0115] 20 healthy susceptible sheep were randomly divided into 4 groups as test sheep, 5 in each group, and the three batches of vaccines were inoculated into one group of test sheep through the neck muscle with a single dose of 2.0ml (1 head), and 5 healthy susceptible sheep with the same conditions were inoculated with sterilized PBS as a control in the same way. 14 days after the first inoculation, the same method was used for inoculation again. After repeated inoculation, the clinical manifestations of the immunized sheep and the control sheep were observed, and the body temperature was measured at the same time every day for 14 days. The observation results are shown in Table 5 below. The experimental results show that after the three batches of vaccines prepared by the Mh-AL2 strain were repeatedly inoculated with a single dose, the body temperature, mental state, respiratory condition, appetite, etc. of the test sheep in each group during the observation period were normal, no redness, swelling and nodule formation were found at the injection site, and the immunized sheep did not show clinical symptoms of sheep hemolytic Mannheimia disease, and there was no significant difference from the control group.

[0116] Table 5: Safety observation results of single-dose repeated vaccination

[0117]

[0118] (3) Safety test of a single overdose vaccination

[0119] 20 healthy susceptible sheep were randomly divided into 4 groups as test sheep, 5 in each group, and the three batches of vaccines were inoculated into one group of test sheep through the neck muscle with an overdose of 4.0 ml (2 doses) at one time, and 5 healthy susceptible sheep with the same conditions were inoculated with sterilized PBS in the same way as the control. The clinical manifestations of the immunized sheep and the control sheep were observed, and the body temperature was measured at the same time every day for 7 days. The observation results are shown in Table 6 below. The experimental results show that after the three batches of vaccines prepared by the Mh-AL2 strain were inoculated with an overdose at one time, the body temperature, respiratory condition, mental state, appetite, etc. of the immunized sheep in each group during the observation period were normal, no redness, swelling or nodule formation was observed at the injection site, and the immunized sheep did not show clinical symptoms of sheep hemolytic Mannheimia disease, which was not significantly different from the control group.

[0120] Table 6: Observation results of safety trial of one overdose vaccination

[0121]

[0122] As shown in Tables 4 to 6 above, the results of a single-dose inoculation test, a single-dose repeated inoculation test, and an overdose inoculation test of three batches of sheep hemolytic Mannheimia inactivated vaccines (2401, 2402, and 2403) prepared by the present invention using the Mh-AL2 strain on healthy susceptible sheep all show that during the observation period, the body temperature, mental state, respiratory condition, appetite, etc. of each group of test sheep were normal, no redness, swelling, or nodule formation was observed at the injection site, and no clinical symptoms of sheep hemolytic Mannheimia disease appeared, which was not significantly different from the control group. It can be seen that the inactivated vaccine prepared by the sheep hemolytic Mannheimia Mh-AL2 strain of the present invention has good safety, no redness, swelling, or nodule formation was observed at the injection site, and the body temperature, respiratory condition, mental state, appetite, etc. of each group of test sheep were normal, and can be further used for clinical applications.

[0123] Example 5: Immunization efficacy of inactivated vaccine against Mannheimia hemolytica in sheep

[0124] This example uses three batches of inactivated sheep hemolytic Mannheimia vaccines (vaccine batch numbers: 2401, 2402, 2403) prepared in Example 2 to conduct efficacy tests on healthy susceptible sheep (about 3 months old).

[0125] 20 healthy susceptible sheep were randomly divided into 4 groups, 5 in each group, and the three batches of vaccines were inoculated into one group of test sheep through the neck muscle at a dose of 1 dose (2.0 ml). Another 5 healthy susceptible sheep with the same conditions were inoculated with sterile PBS in the same way as the control. 21 days after inoculation, 15 immunized sheep and 5 control sheep were challenged with sheep hemolytic Mannheimia (Mh-AL2 strain, challenge dose of 1.0×10 10CFU), and then observe for 7 consecutive days to observe the clinical symptoms of immune sheep and control sheep, measure body temperature at the same time every day, and on the 7th day after the challenge, autopsy the immune sheep and control sheep to observe and record the pathological changes in the lungs. The infected sheep in the control group had congestion in the lungs and obvious bleeding spots. Figure 8 ; Large pleural effusion, see Fig. 9 At the same time, lung tissue was collected for bacterial isolation and PCR identification, and the incidence and protection of sheep were analyzed and determined. The test results are shown in Table 7 below.

[0126] Table 7: Results of efficacy tests on test sheep

[0127]

[0128] Note: “-” indicates that the corresponding symptom does not occur for this item, and “+” indicates that the corresponding symptom occurs for this item.

[0129] From the results in Table 7 above, it can be seen that after the test sheep were challenged with Mannheimia hemolytica, the vaccines in batches 2401 and 2402 showed an immune protection effect of 5 / 5, and 2403 showed an immune protection effect of 4 / 5. No obvious pathological changes occurred in the organs of the immune-protected test sheep, and the lungs were normal after autopsy. After the sheep in the control group were challenged with Mannheimia hemolytica, all 5 sheep in the group became ill, and the lungs after autopsy had obvious Mannheimia lesions. The above results show that the inactivated Mannheimia hemolytica vaccine prepared by the present invention can effectively protect the immunized sheep against the attacking strain after inoculation, without potential safety risks, and the immune effect of each batch of inactivated vaccines is stable.

[0130] The above is only an embodiment of the present invention, and the common knowledge such as the known specific technical solutions and / or characteristics in the solution is not described in detail here. It should be pointed out that for those skilled in the art, without departing from the technical solution of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A sheep-derived strain of Mannheimia hemolytica type A2, characterized in that: Its accession number is CGMCC NO.32899.

2. The sheep-derived A2 hemolytic Mannheimia strain according to claim 1, characterized in that: The colicin transporter gene in the strain is mutated, and the mutated gene encoding sequence is a truncated protein as shown in SEQ ID NO.

10.

3. The sheep-derived A2 hemolytic Mannheimia strain according to claim 2, characterized in that: The sequence of the colicin transporter gene is shown in SEQ ID NO.

9.

4. The sheep-derived A2 hemolytic Mannheimia strain according to claim 1, characterized in that: The strain is isolated from sick goats with goat bronchial symptoms; the samples collected from the sick goats are first smeared on a blood agar plate containing 4.0% calf serum, and cultured in a constant temperature incubator at 37°C for 18 to 24 hours, and then a single colony is picked, and PCR is performed using hemolytic Mannheimia A2 type specific primers to screen positive strains; the sequences of the hemolytic Mannheimia A2 type specific primers are shown in SEQ ID NO.5 and SEQ ID NO.

6.

5. The sheep-derived A2 hemolytic Mannheimia strain according to claim 1, characterized in that: Its LD in mice 50 8.6×10 7 CFU.

6. Use of a sheep-derived A2 hemolytic Mannheimia strain according to any one of claims 1 to 5 in the preparation of a vaccine.

7. A Mannheimia vaccine comprising a sheep-derived A2-type hemolytic Mannheimia strain according to any one of claims 1 to 5, characterized in that: The sheep-derived A2 hemolytic Mannheimia strain is fermented to obtain a fermentation solution; the fermentation solution is inactivated with formaldehyde to obtain an inactivated antigen bacterial solution; the inactivated antigen bacterial solution is mixed with an aluminum hydroxide gel adjuvant to obtain an inactivated vaccine; the volume ratio of the inactivated antigen bacterial solution to the aluminum hydroxide gel adjuvant is 5:

1.

8. The Mannheimia vaccine of sheep-derived A2-type hemolytic Mannheimia strain according to claim 7, characterized in that: The number of sheep-derived Mannheimia hemolytica type A2 in the inactivated vaccine is ≥ 2.0 × 10 10 CFU / ml.

9. The Mannheimia vaccine of sheep-derived A2-type hemolytic Mannheimia strain according to claim 8, characterized in that: Mice were immunized with 0.1 ml of inactivated vaccine and then 8.6 × 10 8 The mice were challenged with CFU sheep-derived A2 hemolytic Mannheimia strain, and the survival rate of mice was ≥80%; Sheep were immunized with 2.0 ml of inactivated vaccine and then 1.0 × 10 10 When sheep were challenged with CFU sheep-derived A2 hemolytic Mannheimia strain, the survival rate was ≥80%.

10. A method for preparing a Mannheimia vaccine containing a sheep-derived A2-type hemolytic Mannheimia strain according to any one of claims 1 to 5, characterized in that: The method includes the following steps in sequence: S1: fermenting and culturing the sheep-derived A2 hemolytic Mannheimia strain to obtain a fermentation liquid; Preferably, the fermentation culture is divided into three steps: S1-1 Primary seed propagation: A2-type hemolytic Mannheimia strain from sheep is inoculated in tryptone soy broth medium for culture; then streaked on a tryptone soy agar plate for culture; then the formed colonies are inoculated on the slant of the tryptone soy agar plate and cultured to form primary seeds; Further preferably, the primary seeds are stored at 2-8°C, the storage period of the primary seeds is no more than 7 days, and the subculture shall not exceed 3 generations; Further preferably, the culture is carried out in a tryptone soy broth medium at 37°C and 120 r / min for 10 h; the culture is carried out on a tryptone soy agar plate at 37°C for 18 h; the culture is carried out on a tryptone soy agar plate slant at 37°C for 10 h; S1-2 Secondary seed propagation: Use tryptone soy broth medium containing bovine lysed whole blood to re-dissolve the primary seeds, and then use tryptone soy broth medium containing bovine lysed whole blood to culture the bacteria; after the bacteria pass the purity test, obtain the secondary seed solution; Further preferably, the secondary seed solution is stored at 2-8°C, and the secondary seed solution with a shelf life of no more than 4 days is used; Further preferably, the culture conditions are 37° C., 120 r / min, and culture for 12 h; the volume percentage of bovine lysed blood in the tryptone soy broth medium is 0.2%; S1-3 Preparation of fermentation liquid: culturing the secondary seed liquid with tryptone soy broth medium containing bovine lysed whole blood to obtain fermentation liquid; Further preferably, the volume percentage of bovine lysed blood in the tryptone soy broth medium is 0.2%; the volume percentage of the secondary seed solution added to the tryptone soy broth medium is 1-2%; Further preferably, the culture conditions are 37°C, 120r / min, and culture for 10h; S2: The fermented bacterial liquid is concentrated and inactivated to obtain an inactivated antigen bacterial liquid; Preferably, the fermentation bacterial solution is concentrated by centrifugation and resuspended in phosphate buffer; then formaldehyde is added to obtain an inactivated antigen bacterial solution after inactivation treatment; Further preferably, the fermented bacterial liquid is concentrated 10 times and then formaldehyde is added to inactivate it; the volume percentage of formaldehyde is 0.15%; Further preferably, the centrifugation conditions are: 9000 r / min, 4°C, centrifugation for 20 min, and then collecting the bacterial precipitate; the pH value of the phosphate buffer is 7.2-7.4; Further preferably, the inactivation condition is inactivation at 37°C for 18 to 24 hours, during which the mixture is shaken intermittently 10 to 12 times, and shaken once every 2 hours, with each shaking operation lasting 1 minute and a rotation speed of 120 r / min; S3: mixing the inactivated antigenic bacteria solution with the aluminum hydroxide gel adjuvant to prepare an inactivated vaccine; Preferably, the volume ratio of the inactivated antigenic bacterial solution to the aluminum hydroxide gel adjuvant is 5:1; first stir the inactivated antigenic bacterial solution at 50-100 r / min for 5 minutes, then add the aluminum hydroxide gel adjuvant and stir for 15-20 minutes to obtain the inactivated vaccine.

Images