High-yield Mccj25 recombinant strain, fermentation method and application

Abstract

The invention belongs to the technical field of genetic engineering and microbial fermentation, particularly relates to a recombinant strain capable of efficiently producing microrhin Mccj25, and further discloses a method for producing microrhin Mccj25 through fermentation of the recombinant strain and application of the recombinant strain. A recombinant strain capable of producing Mccj25 at high yield is constructed on the basis of a genetic engineering means, an Escherichia coli F-750 recombinant strain capable of producing Mccj25 at high yield is preferably obtained by modifying an mcjABCD expression element and a chassis strain, and fermentation experiment determination shows that the recombinant strain can realize high-level expression of Mccj25, and the expression quantity reaches 6 g / L or above.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and microbial fermentation, and particularly relates to a recombinant strain capable of efficiently producing microcin Mccj25, and further discloses a method and application of producing microcin Mccj25 by fermentation. Background Art

[0002] With the widespread use of antibiotics, antibiotic resistance has become a major concern when using drugs. Currently, many countries have completely banned the use of antibiotics as growth promoters in animal feed, making the search for alternatives to antibiotics increasingly urgent.

[0003] Bioactive peptides can significantly inhibit or even kill pathogenic microorganisms in a relatively short period of time, which is conducive to the rapid control of infection. Compared with many conventional antibiotics, active peptides have lower toxicity and fewer side effects, and are not easy to cause drug resistance. In addition, bioactive peptides can regulate the function of the immune system, promote the improvement of the body's immunity, and help prevent and control infectious diseases. Given that active peptides have good results in combating drug-resistant strains, they are expected to serve as an alternative to antibiotics and be used to treat infections caused by drug-resistant bacteria.

[0004] Microcin J25 (Mccj25) is a lasso peptide composed of 21 amino acids produced by Escherichia coli. This unique lasso structure not only gives it the general characteristics of antimicrobial peptides, but also has outstanding advantages such as good thermal stability, high acid resistance, and insensitivity to protease hydrolysis. As a biologically active polypeptide, Mccj25 can interact with specific bacterial proteins, destroy the integrity of bacterial cell membranes, and thus kill pathogenic bacteria. It mainly acts on Gram-negative bacteria, including pathogenic Escherichia coli, Salmonella, and Shigella. Its bactericidal mechanism is different from that of general antibiotics and is not easy to develop drug resistance. In addition, the Mccj25 polypeptide can also regulate the body's immunity, maintain a normal balance of intestinal flora, and improve the absorption efficiency of nutrients.

[0005] However, since the Mccj25 polypeptide is limited in natural acquisition and its synthesis requires a high cost, how to achieve large-scale production of Mccj25 active polypeptide still faces huge challenges in terms of efficiency and economy. It has been reported that a large amount of active polypeptides can be produced in a short period of time by fermentation through a prokaryotic expression system. Compared with traditional chemical synthesis or animal expression, this type of fermentation method has lower production costs and higher efficiency, and is more economical in large-scale production of active polypeptides. Therefore, a strain that can produce high-yield active polypeptide Mccj25 has been developed in this field, which has positive significance for the development and promotion of Mccj25 and the safe replacement of antibiotics. Summary of the invention

[0006] To this end, the technical problem to be solved by the present invention is to provide a recombinant strain F-750 with a high yield of microcin Mccj25, the recombinant strain has good Mccj25 fermentation performance and can effectively increase the expression level of Mccj25.

[0007] The second technical problem to be solved by the present invention is to provide a process for fermenting high-yield Mccj25 by strain F-750, wherein the fermentation process has high production efficiency and can effectively reduce the production cost of Mccj25 polypeptide.

[0008] In order to solve the above technical problems, the present invention provides a recombinant strain with high Mccj25 production, wherein the recombinant strain has the following characteristics (a)-(c):

[0009] (a) mcjABCD was transformed into three expression cassettes mcjA, mcjBC, and mcjD, and the promoter and RBS were optimized and transformed respectively;

[0010] (b) introducing mcjA and mcjBC expression cassettes into an E. coli expression plasmid;

[0011] (c) The mcjD expression cassette was integrated into the genome of the original E. coli strain.

[0012] The present invention provides a recombinant strain F-750 for producing microcin Mccj25, which is based on an Escherichia coli recombinant engineering strain, and is obtained by inserting an mcjD expression frame into the genome of the original Escherichia coli strain through a gene editing method, and simultaneously introducing a plasmid containing mcjA and mcjBC expression frames into the Escherichia coli chassis.

[0013] Specifically, the original strain of Escherichia coli is Escherichia coli MC4100.

[0014] Specifically, the gene editing method is CRISPR-Cas9.

[0015] Specifically, the mcjD expression frame is integrated into the genome of the MC4100 strain, and the mcjA and mcjBC are expressed by a plasmid.

[0016] Specifically, the mcjA, mcjBC, and mcjD expression frames are expressed by different promoters, RBS, etc. after expression element optimization.

[0017] As a preferred recombinant strain, the recombinant strain with high production of Mccj25 described in the present invention is Escherichia coli F-750, which is classified and named Escherichia coli, and is deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration, with a deposit number of CGMCC No.32623 and a deposit date of November 14, 2024.

[0018] The present invention also discloses a method for constructing a recombinant strain of the high-yield Mccj25, comprising the following steps:

[0019] (1) The mcjD expression cassette with the homology arms of the target gene was obtained by gene synthesis and overlapping PCR technology, and then introduced into the genome of the original Escherichia coli strain using CRISPR-Cas9 gene editing to obtain the chassis strain;

[0020] (2) Using overlapping PCR technology, the mcjA and mcjBC expression cassettes were obtained and the expression plasmids were constructed;

[0021] (3) Introducing the constructed expression plasmid into the new chassis strain to obtain.

[0022] Specifically, the method for constructing the recombinant strain with high yield of Mccj25 comprises the following steps:

[0023] Gene synthesis was performed based on the initial gene sequence of the Mccj25 gene cluster, and three gene fragments, mcjA, mcjBC, and mcjD, were obtained by PCR technology;

[0024] The selected different types of promoters and RBS were designed into primers and synthesized, and the three gene fragments of mcjA, mcjBC and mcjD were used as templates for amplification, thereby obtaining mcjA, mcjBC and mcjD expression cassettes with different expression elements;

[0025] The mcjD expression cassette fragment with the homology arms of the target gene was constructed by PCR and overlapping PCR techniques, and introduced into the original strain of Escherichia coli using CRISPR-Cas9 gene editing to obtain the chassis strain and prepare the competent cells;

[0026] Specifically, in step (2), the obtained mcjA and mcjBC expression cassettes are cloned into expression plasmids, respectively introduced into DH5α competent cells, positive transformants are selected for expansion culture, plasmids are extracted, and the correctly identified recombinant plasmids are stored at 20°C for future use;

[0027] Specifically, in step (3), the plasmid constructed in step (2) is simultaneously introduced into the competent chassis obtained in step (1) to obtain an engineered Escherichia coli strain that produces Mccj25.

[0028] The present invention also discloses an Escherichia coli F-750, which is classified and named as Escherichia coli, and is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with a deposit number of CGMCC No.32623 and a deposit date of November 14, 2024.

[0029] The invention also discloses the application of the high-yield Mccj25 recombinant strain F-750 or the Escherichia coli F-750 in the fermentation production of Mccj25.

[0030] The present invention also discloses a method for producing Mccj25 by fermentation, comprising the step of inoculating the high-yield Mccj25 recombinant strain F-750 into a suitable fermentation medium for fermentation culture.

[0031] Specifically, the fermentation method for producing Mccj25 includes the following conditions: fermentation temperature 36-38°C, ventilation ratio 0.5-1vvm ， Rotation speed 350-400rpm, tank pressure 0.03-0.05Mpa, pH 6.9-7.1.

[0032] Specifically, in the method for producing Mccj25 by fermentation, the fermentation medium comprises the following components in mass concentrations: yeast extract 10-70 g / L, magnesium sulfate 0.5-5 g / L, dipotassium hydrogen phosphate 0.5-5 g / L, citric acid 0-2 g / L, glucose 1-10 g / L, defoaming agent 0.1-1 g / L, and initial pH 6.5-7.5.

[0033] The invention constructs a recombinant strain capable of high-yield Mccj25 based on genetic engineering means. The recombinant strain of the invention respectively transforms the mcjA, mcjBC, mcjD promoters and RBS sequences in Mccj25, inserts the optimized mcjD expression frame into the Escherichia coli MC4100 genome by means of CRISPR-Cas9, obtains a recombinant chassis for efficiently expressing the Mccj25 polypeptide, and introduces the constructed mcjA and mcjBC expression plasmids into the chassis strain to achieve high-level expression of Mccj25.

[0034] The recombinant strain with high Mccj25 production of the present invention is preferably a recombinant strain of Escherichia coli F-750 with high Mccj25 production, obtained by modifying the mcjABCD expression element and the chassis strain. The recombinant strain is classified and named Escherichia coli, and is deposited in the General Microbiological Center of the China National Microbiological Culture Collection Administration with a deposit number of CGMCC No.32623 and a deposit date of November 14, 2024. The recombinant strain is capable of achieving high-level expression of Mccj25, and the expression amount reaches more than 6 g / L, as determined by fermentation experiments.

[0035] The high-yield Mccj25 recombinant strain of the present invention, especially the constructed Escherichia coli F-750 recombinant strain, has a fermentation product that has a strong inhibitory effect on Salmonella SK226, Escherichia coli AZ1, etc., and has no inhibitory effect on probiotics such as Lactobacillus plantarum, Bacillus subtilis, yeast, etc., and can be used for antibacterial and antiseptic treatment in the food or breeding industry, and for regulating immunity.

[0036] The high-yield Mccj25 recombinant strain of the present invention has the advantages of short fermentation cycle and high product content, and the entire fermentation process is easy to control and the fermentation level is stable. It has been verified by amplified fermentation that it is very suitable for industrial fermentation of Mccj25 peptide. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0038] Figure 1 The gel electrophoresis results of the PCR identification product of the mcjD integrated strain; where: M is a nucleic acid marker, and lanes 1 and 2 are the vector construction verification results;

[0039] Figure 2 The content profile of Mccj25 in the supernatant of 3L tank fermentation of the genetically engineered strain;

[0040] Figure 3 This is a diagram showing the antibacterial effect of the fermentation liquid of the genetically engineered strain F-750;

[0041] Figure 4 This is the MIC test chart of F-750 fermentation broth. The test tube concentrations from left to right are: 60ug / ml, 30ug / ml, 15ug / ml, 7.5ug / ml, 3.75ug / ml, 1.9ug / ml, 0.94ug / ml, 0.47ug / ml, and 0.23ug / ml. DETAILED DESCRIPTION

[0042] The present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments, without departing from the essence and scope of the present invention, also belong to the protection scope of the present invention.

[0043] Example 1

[0044] This example is used to construct a recombinant strain that can efficiently express Mccj25.

[0045] mcjABCD target gene acquisition

[0046] According to the original gene sequence of the mcjABCD gene cluster in NCBI (such as SEQ ID No. 1), the relevant genes were synthesized and amplified by PCR to obtain three target gene fragments mcjA, mcjBC, and mcjD; the specific PCR amplification reaction system is shown in Table 1 below.

[0047] Table 1 PCR amplification system

[0048] Primer F 2μL Primer R 2μL DNA template 2μL PrimerStar Enzyme 25μL ddH2O 19μL

[0049] The specific amplification program was set as follows: pre-denaturation: 95°C for 5 min; denaturation: 95°C for 15 s; annealing: 56°C for 45 s; extension: 72°C for 15 s; reaction for 30 cycles; extension: 72°C for 10 min.

[0050] The PCR products were subjected to agarose gel electrophoresis and then recovered using a small amount of DNA recovery kit to obtain the target gene fragments mcjA, mcjBC, and mcjD, respectively.

[0051] Expression element screening

[0052] According to the E. coli expression element library, a promoter and RBS of appropriate strength were selected, designed and synthesized in the form of primers, and the above gene fragments mcjA, mcjBC, and mcjD were used as templates to obtain the expression element-target gene connection fragment by PCR. The specific PCR amplification reaction system is shown in Table 2.

[0053] Table 2 PCR amplification system

[0054]

[0055]

[0056] The specific amplification program was set as follows: pre-denaturation: 95°C for 5 min; denaturation: 95°C for 15 s; annealing: 56°C for 45 s; extension: 72°C for 15 s; reaction for 30 cycles; extension: 72°C for 10 min.

[0057] The PCR products were subjected to agarose gel electrophoresis, and the PCR products, namely the mcjA, mcjBC and mcjD expression cassettes, were recovered using a small amount of DNA recovery kit.

[0058] Chassis strain construction

[0059] In this example, the starting strain Escherichia coli MC4100 (purchased from Zhili Zhongte Biotechnology Co., Ltd.) was selected for the construction of the recombinant strain.

[0060] Construction of integration fragment: According to the Escherichia coli MC4100 genome data (GCA_000499485.1), the homologous sequences UP and DOWN ends at both ends of the integration site sequence were designed and amplified by PCR. Two sets of primers, integration site-UP-F, integration site-UP-R and integration site-DOWN-F, integration site-DOWN-R, were used to perform PCR amplification using the Escherichia coli MC4100 genome as a template to obtain the UP and DOWN ends of the homologous fragments. The UP end, mcjD expression frame, and DOWN end were connected by overlapping PCR.

[0061] The PCR product was subjected to agarose gel electrophoresis, and then the PCR product was recovered by a small amount of DNA recovery kit to obtain the integrated fragment UP-mcjD expression frame-DOWN. The gel electrophoresis results of the mcjD integrated strain PCR identification product are shown in the attached Figure 1 shown.

[0062] Integration fragments were electroporated into competent E. coli cells

[0063] The above-constructed integration fragment and the gRNA plasmid that recognizes the integration site were further transformed into MC4100 competent cells carrying the cas9 plasmid by electroporation at the same time, and evenly spread on a kanamycin and spectinomycin double-resistant plate, inverted and cultured at 37°C for about 12 hours, and after the transformants grew, they were picked for verification.

[0064] After PCR verification, the correct transformant is used for plasmid loss. It is inoculated into a test tube containing rhamnose and sucrose to culture the plasmid. A disposable inoculation loop is used to streak an LB plate without resistance. After a single colony grows out, a dot plate is performed. If the plate without resistance growth does not grow, it means that the plasmid loss is complete and the chassis strain is successfully constructed.

[0065] Construction of mcjA and mcjBC expression plasmids

[0066] The constructed mcjA and mcjBC expression cassette fragments were further connected to the plasmid vector fragments, introduced into DH5α by electroporation, and incubated inverted on a plate at 37°C overnight. After the transformants grew out, the transformants were picked for colony PCR verification. The correct transformants were placed in a test tube, and the plasmid was extracted and stored at -20°C for later use.

[0067] Construction of Mccj25 recombinant strain

[0068] The mcjA and mcjBC expression plasmids were electroporated into the successfully constructed chassis strains, respectively, and the plates were inverted and cultured at 37°C overnight. After the transformants grew out, the transformants were picked for colony PCR verification to obtain a series of Mccj25 expression strains with different expression frames.

[0069] Example 2

[0070] This example is based on a series of Mccj25 expression strains with different expression frames obtained in Example 1 to screen for high-yield polypeptide Mccj25 strains.

[0071] A series of Mccj25 expression strains with different expression elements were constructed and initially screened by flask fermentation. The specific screening culture medium was: yeast powder 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, sorbitol 5 g / L, temperature 37°C, rotation speed 200 rpm, initial pH 7.0.

[0072] In this embodiment, the shake flask fermentation level of the strain with the highest shake flask content was screened to reach 0.3 g / L. The strain was named Escherichia coli F-750, and the strain was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC No.32623, a deposit date of November 14, 2024, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0073] Example 3

[0074] This example verifies the fermentation level of Mccj25 based on the recombinant strain F-750 screened above.

[0075] The screened and preserved recombinant strain F-750 was streaked on an LB plate and inverted for overnight culture at 37°C. An activated single colony was picked and placed in 10 mL LB medium and cultured at 37°C and 220 r / min for 12 h to obtain a seed solution.

[0076] Prepare fermentation tank culture medium, weigh 70 g / L yeast extract, 1 g / L magnesium sulfate, 1 g / L potassium hydrogen phosphate, 0.5 g / L citric acid, 1 g / L glucose, and 0.1 g / L defoaming agent, adjust the initial pH to 7.2 with sodium hydroxide, and sterilize at 121°C for 20 min.

[0077] The seed liquid obtained above was inoculated into the fermentation medium (3L tank) at a 5% inoculation rate for fermentation. During the fermentation process, the ventilation ratio was controlled to 1vvm, the rotation speed was 350rpm, the fermentation tank was 30L, and the liquid volume was 15L. The whole fermentation process was fermented for a total of 32 hours, and the fermentation liquid was collected.

[0078] Example 4

[0079] In this example, the target peptide content was detected in the fermentation broth of the recombinant strain F-750 described in Example 3 above.

[0080] The fermentation broth in Example 3 was collected and separated by gradient elution at a flow rate of 1 mL / min through a Shim-pack Scepter C18 chromatographic column at 33° C. and 280 nm wavelength ultraviolet light. The specific operation steps are as follows.

[0081] Mobile phase A: Measure 1000 mL of ultrapure water, add 1 mL of TFA, filter with a 0.22 μm filter membrane, and degas by ultrasonication for 3 min.

[0082] Mobile phase B: Measure 900 mL of acetonitrile, add 100 mL of ultrapure water, use a pipette to transfer 0.85 mL of TFA into the acetonitrile-water solution, filter with a 0.22 μm organic filter membrane, and degas by ultrasonication for 3 min.

[0083] Preparation of standard solution: weigh 0.1 g of pure antimicrobial peptide Mccj25 into a 100 mL volumetric flask, add purified water to the scale, shake and mix, and filter through a 0.22 μm filter membrane.

[0084] After the chromatographic column is balanced, set the following gradient elution program. Add purified water to prepare 0.8 g / L, 0.4 g / L, 0.2 g / L, 0.1 g / L, 0.05 g / L, and 0.025 g / L standard sample solutions in turn. After passing through a 0.22 μm filter membrane, inject the sample for detection with an injection volume of 10 μL. Start the gradient elution program shown in Table 3 below for gradient elution. Draw the surface curve based on the peak area at each concentration.

[0085] Table 3 Gradient elution program

[0086]

[0087]

[0088] Take 1 mL of the supernatant of the fermentation broth collected in Example 3 after sufficient centrifugation, filter it through a 0.22 μm filter membrane, and then start gradient elution. Record the chromatogram and the peak area at the corresponding time, and then compare it with the external standard curve.

[0089] In this embodiment, the peak graph results of the pure Mccj25 are as follows: Figure 2 In A, the peak graph of the F-750 fermentation broth detected at 280 nm is as follows Figure 2 B. After calculation, the content of Mccj25 detected in the fermentation broth of this example is 6.5 g / L.

[0090] Example 5

[0091] This example is based on the antibacterial experiment conducted on the fermentation broth of the recombinant strain F-750 in the aforementioned Example 3, and specifically uses the agar diffusion method to determine the antibacterial activity of the antimicrobial peptide Mccj25.

[0092] Using Escherichia coli AZ1 as the indicator bacteria, first pour a layer of 2% LB agar into the sterilized culture dish, wait for it to solidify, and then add 0.1 mL of diluted AZ1 bacterial solution (OD 600 =0.1-0.2), and spread evenly with a sterile coating rod. Use a sterile puncher to punch holes in the culture dish, with the center of each hole at least 25 mm apart. Use a micropipette to draw an appropriate amount of antibacterial agent F-750 fermentation liquid (Example 3 fermentation liquid) into the agar hole, cover the culture dish, and culture it upright in a constant temperature incubator at 37°C for 18-20 hours. Observe the antibacterial zone as shown in the attached figure. Figure 3 , record the results in Table 4 below.

[0093] Table 4 Antibacterial test results

[0094] Indicator bacteria Diameter of inhibition zone / mm Lactobacillus plantarum - Saccharomyces cerevisiae - Bacillus subtilis - Escherichia coli AZ1 27.55±0.33 salmonella 18.25±0.52

[0095] It can be seen that the fermentation product of the recombinant bacteria F-750 of the present invention has a strong inhibitory effect on Salmonella SK226, Escherichia coli AZ1, etc., but has no inhibitory effect on probiotics such as Lactobacillus plantarum, Bacillus subtilis, and yeast, and can be used for antibacterial, preservation, and immune regulation in food or aquaculture.

[0096] Example 6

[0097] This example is based on the MIC experiment conducted on the fermentation broth of the recombinant strain F-750 in Example 3 above.

[0098] Prepare LB liquid culture medium, take 5 ml of it and add it to the corresponding test tubes, then add the diluted antimicrobial peptide Mccj25 fermentation broth solution for gradient dilution. The peptide concentration gradient in the test tube is 60ug / ml, 30ug / ml, 15ug / ml, 7.5ug / ml, 3.75ug / ml, 1.9ug / ml, 0.94ug / ml, 0.47ug / ml, 0.23ug / ml. Cover the test tube stopper and sterilize it in a high pressure steam sterilizer at 121℃ for 20min for use. Dilute the Escherichia coli ATCC 25922 bacterial solution activated in the test tube and add it to the test tube in sequence with an inoculation volume of 1%. Cultivate it in a constant temperature shaker at 37℃ and 200rmp / min for 7 hours, observe the sample, and the bacterial growth visible to the naked eye is turbid, and the growth without visible growth is clear. The clear test tube with the lowest concentration is judged as the minimum inhibitory concentration (MIC value). See the attached MIC detection chart of F-750 fermentation broth. Figure 4 .

[0099] The results showed that the minimum inhibitory concentration of Mccj25 fermented by the recombinant strain F-750 was between 0.47 and 0.94 ug / ml, indicating that Mccj25 obtained by fermentation of strain F-750 had a very strong ability to inhibit Escherichia coli ATCC 25922.

[0100] In summary, the high-yield Mccj25 recombinant strain of the present invention has the advantages of short fermentation cycle and high product content, and the entire fermentation process is easy to control and the fermentation level is stable. It has been verified by scaled-up fermentation that it is very suitable for the industrial fermentation of Mccj25 peptide.

[0101] SEQ ID No.1:

[0102] tcagccatagaaagatataggtgtaccaatccccacaaaatactcaggcacatgtcctgcaccaccttttgtgagttg

[0103] cgatgctgatttttttatttgtataaccccctttgcaggagatggaacattattttttttaccagaagacagtttattaaaat

[0104] gaaaatgcttaatcatttttacgttccttatttgatggaaatagtatgatgatttttacagaggaacctcacgtccttctgtt

[0105] agaattttattagcacaaaatacaattgagatcaataatcattacgctttagtaatttatcaataaaatcatttagatacaa

[0106] acatccataaactaatcaatctgcaaaagtggtcaaatttagtacaaattttggatttttatacatttttctaattatttcag

[0107] aatatttagccatcaattaagaaaaaaatttagcttgtagataaattcagaagttttattattccaattgagtgtaaaggc

[0108] ataactacaggagggagtgtgcaaaatgatccgttactgcttaaccagttatagagaggatcttgttatcctggatata

[0109] attaatgatagtttcagcatagtgcctgacgcaggtagcttgctaaaagaaagagataaattgcttaaaaattccca

[0110] caactatcttacttttttgacagtgaatatcatattggaagtgtttctcgtaatagtgacacttcttttcttgaagaacgctg

[0111] gtttctaccagaacctgacaaaacattatataagtgttctctatttaaacgatttatattattactcaaagtcttttactatag

[0112] ctggaatattgaaaaaaaagggatggcatggattttcataagtaataaaaaagagaataggctatactccttgaatga

[0113] agagcatcttatccggaaagaaattagtaatctttccattatctttcatcttaaatttttaaatctgactgtcttacctattca

[0114] tacgcactaaaaagaattcttaattccagaaatattgatgctcatcttgttattggtgtaaggacacaacctttttatagc

[0115] cactcttgggtggaggttgggggacaagttatcaatgatgctcccaaatatgcgggataaattatctgttattgcagag

[0116] atatagttatggaaatatttaatgtcaagttaaatgatacttcaattagaattattttctgtaaaacgctttctgccttccgg

[0117] acagaaaataccatcgttatgctcaaaggaaaagcagtttcaaatggcaaacctgtatccacagaggagattgcca

[0118] gagtagtggaagaaaaaggtgtttcagaagtaatagaaaatttagatggtgttttctgtatcctaatttatcattttaatg

[0119] atctccttatagggaaaagcattcaatcaggccccgctctattttattgtaaaaagaatatggatatttttgtttcggataa

[0120] aatttctgatatcaaatttttgaatccagatatgacattcagtctaaatataacaatggcagaacattatctgtcaggaaa

[0121] tcgaatagcaacccaggaatcactaatcactggcatttacaaagtaaataatggtgagtttataaaaatttaataatcagt

[0122] tgaaacctgtgctacttcgtgatgagtttagtattaccaaaaagaacaattcaactatcgacagtatcattgataatattg

[0123] agatgatgcgggataatagaaaaatagccctattattttccggaggattggattctgcattaatttttcacacacttaaa

[0124] gaatcaggtaacaaattctgcgcttatcattttttttctgatgaatctgatgacagtgaaaagtattttgctaaggaatact

[0125] gttcaaaatatggagttgattttatatctgttaataaaaacatcaactttaatgaaaaactttatttcaatttaaatcctaata

[0126] gtccggacgaaatccctttgatatttgaacagacagatgaagaaggtgaaggtcagccccccatagacgatgattt

[0127] attatatctatgtggtcacggtggagatcatattttcggacaaaatccttcagaactttttggcattgatgcatatcgaag

[0128] tcatggcttgatgtttatgcataaaaaaatagtagaattttccaatctcaagggaaagagatataaagatatcatattttc

[0129] aaatatttccgcattcattaatacatccaacggatgttctccagcaaagcaagagcacgtatcagatatgaaacttgc

[0130] ctctgctcagttttttgcaactgattatacaggaaaaattaataaactaactccattcctgcataaaaatattatccagcat

[0131] tatgctggcttaccagtttttagtctatttaaccagcactttgatcgttatcccgttcgttatgaagcgtttcaacgatttgg

[0132] ttcagatattttctggaaaaaaccaaacggtcatcttcatcatgactaatattcagaattctatccggtaaaaaggatg

[0133] aactagtgaatacaataaaacagtcaggattaattgaaatattaggcattaaccatattgaattggaaagcattttgtat

[0134] gaaaatacgactacacgtctgacaatggaactaccatatatacttaacttataccgtctggcaaaattcattcaacttca

[0135] atccattgattataaaggttaattatggaaagaaaacagaaaaactcattatttaattatatttattcattaatggatgtaa

[0136] gaggtaaatttttattcttttccatgttattcattacatcattatcatcgataatcatatctatttcaccattgattcttgcaaag

[0137] attacagattactgtctggctcattgtcaaattttagttatgaatatctggttttacttgcctgtttatacatgttttgcgttat

[0138] atctaataaagcaagtgtttttttatttatgatactgcaaagtagtctacgtattaacatgcagaaaaaaatgtcgctaaa

[0139] gtatttgagagaattgtataacgaaaatataactaacttgagtaaaaataatgctggatatacaacgcaaagtcttaac

[0140] caggcttcaaatgacatttatattcttgtgagaaatgtttcccagaatatcctgtcacctgttatacaacttatttccactat

[0141] tgttgttgttttatctacgaaggactggttttctgccggtgtgttttttctctctatattctggtatttgtaatttttaataccagac

[0142] tgactggcagtttagcgtctctcagaaaacacagcatggatatcactcttaactcttatagtctgttatctgatactgttg

[0143] ataacatgatagcagctaaaaagaataatgcattaagacttatttctgaacgttatgaagatgctctcactcaggaaaa

[0144] caatgctcagaaaaaatactggttactcagttctaaagttcttttattgaactctttacttgctgtaatattatttggttctgt

[0145] attcatatataatattttaggtgtgctgaatggtgtagttagtatcggccacttcattatgattacatcatatatcattcttctt

[0146] tcaacgccagtggaaaatataggggcattgctaagtgagatcaggcagtcaatgtctagcctggcaggttttattca

[0147] acgtcatgccgagaataaagccacatctccttcaataccttttctcaacatggagcgaaaattaaacctgtccataag

[0148] agagctttcatttagctatagtgatgaaaaaaatacttaattcagtcagtcttgacctttttaccggaaaaatgtattca

[0149] ttaaccggacccagtggttcaggaaaatccacccttgtaaaaataatatcaggttactataaaaattactttggagaca

[0150] tttatctgaatgatatatccttacgtaatatcagtgatgaggatttgaatgatgctatttactacctaacacaagatgatta

[0151] tatttttatggatacactacgatttaatctccggctcgcaaattacgacgcgtcagaaaatgaaatatttaaagttcttaa

[0152] actggcaaatctttctgtcgtcaacaatgaaccagtgagtctggatacacaccttataaacagaggcaataactattc

[0153] aggagggcaaaaacaacgaatttcgttagcgcgactgtttttgagaaaacctgcaataattattattgatgaagccac

[0154] atcggctctggattatattaatgaatcagaaattttatcatcaataagaactcattttcctgatgcgttaattataaatatta

[0155] gtcaccgaataaatcttctggagtgttccgattgtgtttatgtattgaatgaaggaaatattgttgcttctggccatttcagggatttgatggtcagcaatgaatacatatcgggactggcttctgttatactgaataa.

[0156] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A recombinant strain with high yield of Mccj25, characterized in that: The recombinant strain has the following characteristics (a)-(c): (a) mcjABCD was transformed into three expression cassettes mcjA, mcjBC, and mcjD, and the promoter and RBS were optimized and transformed respectively; (b) introducing mcjA and mcjBC expression cassettes into an E. coli expression plasmid; (c) The mcjD expression cassette was integrated into the genome of the original E. coli strain.

2. The recombinant strain of high-yield Mccj25 according to claim 1, characterized in that The original strain of Escherichia coli includes Escherichia coli MC4100; Preferably, the mcjD expression cassette is integrated into the genome of the MC4100 strain, and the mcjA and mcjBC are expressed by a plasmid; Preferably, the expression elements in the expression frames of mcjA, mcjBC and mcjD are all modified.

3. The recombinant strain of high-yield Mccj25 according to claim 1 or 2, characterized in that: The recombinant strain is Escherichia coli F-750, which is classified and named Escherichia coli, and is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with a deposit number of CGMCC No.32623 and a deposit date of November 14, 2024.

4. A method for constructing a recombinant strain with high Mccj25 production according to any one of claims 1 to 3, characterized in that: The steps include: (1) The mcjD expression cassette with the homology arms of the target gene was obtained by gene synthesis and overlapping PCR technology, and introduced into the original strain of Escherichia coli using CRISPR-Cas 9 gene editing to obtain the chassis strain; (2) Using overlapping PCR technology, the mcjA and mcjBC expression cassettes were obtained and the expression plasmids were constructed; (3) Introducing the constructed expression plasmid into the chassis strain to obtain the product.

5. The method for constructing a recombinant strain with high yield of Mccj25 according to claim 4, characterized in that: The steps include: Gene synthesis was performed based on the initial gene sequence of the mcjABCD gene cluster in Mccj25, and three gene fragments, mcjA, mcjBC, and mcjD, were obtained by PCR technology. The selected different types of promoters and RBS were designed into primers and synthesized, and the three gene fragments of mcjA, mcjBC and mcjD were used as templates for amplification, thereby obtaining mcjA, mcjBC and mcjD expression cassettes with different expression elements; Plasmids with mcjA and mcjBC expression cassettes were constructed by overlapping PCR technology; The mcjD expression cassette fragment with the homology arms of the target gene was constructed by PCR and overlapping PCR techniques, and introduced into the original strain of Escherichia coli using CRISPR-Cas9 gene editing to obtain the chassis strain and prepare the competent cells; The plasmid carrying the mcjA and mcjBC expression frames was introduced into the chassis strain obtained above to obtain an Escherichia coli engineered strain that produces Mccj25.

6. An Escherichia coli F-750, which is classified and named Escherichia coli, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with a deposit number of CGMCC No.32623 and a deposit date of November 14, 2024.

7. Use of the high-yield Mccj25 recombinant strain according to any one of claims 1 to 4 or the Escherichia coli F-750 according to claim 6 in the fermentation production of Mccj25.

8. A method for producing Mccj25 by fermentation, characterized in that: The method comprises the steps of inoculating the high-yield Mccj25 recombinant strain according to any one of claims 1 to 4 or the Escherichia coli F-750 according to claim 6 into a suitable fermentation medium for fermentation culture.

9. The method for producing Mccj25 by fermentation according to claim 8, characterized in that: The conditions of the fermentation culture step include: fermentation temperature 36-38°C, ventilation ratio 0.5-1vvm ， Rotation speed 350-400rpm, tank pressure 0.03-0.05Mpa, pH 6.9-7.

1.

10. The method for producing Mccj25 by fermentation according to claim 8 or 9, characterized in that: The fermentation medium comprises the following components in mass concentrations: 10-70 g / L yeast extract, 0.5-5 g / L magnesium sulfate, 0.5-5 g / L dipotassium hydrogen phosphate, 0-2 g / L citric acid, 1-10 g / L glucose, 0.1-1 g / L defoaming agent, and an initial pH of 6.5-7.5.

Images