Lentivirus for inhibiting expression of NEDD4L gene as well as construction method and application of lentivirus

Abstract

The invention discloses a lentivirus for inhibiting NEDD4L gene expression, the lentivirus is obtained by knocking down the human NEDD4L gene expression by using an RNA interference technology, the target sequence of the lentivirus for inhibiting the human NEDD4L gene expression comprises shRNA-NEDD4L-1, shRNA-NEDD4L-2 and shRNA-NEDD4L-4, the nucleotide sequence of the shRNA-NEDD4L-1 is SEQ ID NO.1, the nucleotide sequence of the shRNA-NEDD4L-2 is SEQ ID NO.2, the nucleotide sequence of the shRNA-NEDD4L-4 is SEQ ID NO.4, the nucleotide sequence of the shRNA-NEDD4L-2 is SEQ ID NO.3, the nucleotide sequence of the shRNA-NEDD4L-4 is SEQ ID NO.4, the nucleotide sequence of the The invention further discloses a construction method and application of the lentivirus for inhibiting NEDD4L gene expression, and the problem that an existing endocrine treatment method can promote endocrine resistance to ER + patients, and consequently the treatment effect is poor is solved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a lentivirus for inhibiting the expression of a human NEDD4L gene. The present invention also relates to a construction method and application of the lentivirus. Background Art

[0002] Despite decades of laboratory, epidemiological and clinical research, the incidence and mortality of breast cancer are still increasing year by year. Its overall cancer mortality rate ranks fifth (6.9%) and ranks first among female cancer mortality rates (15.5%). Breast cancer has become a major public health issue in today's society, seriously threatening women's health.

[0003] About 70% of breast cancer patients are estrogen receptor-positive (ER+). The ER signaling pathway plays a key role in the occurrence and development of breast cancer. Therefore, endocrine therapy is a very effective treatment for ER+ breast cancer, and commonly used drugs include tamoxifen. However, its effectiveness is limited by primary and acquired drug resistance. It is urgent to study methods to reverse endocrine resistance in ER+ breast cancer.

[0004] Existing studies have shown that neural precursor cell expressed developmentally down-regulated 4 like (NEDD4L) is an inhibitory molecule for primary breast cancer. NEDD4L inhibits the function of tumor-initiating cells (TIC) by targeting and degrading NOTCH1. However, the role of NEDD4L in tamoxifen resistance in ER+ breast cancer remains unknown.

[0005] RNA interference (RNAi) refers to the phenomenon of highly conserved, highly efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA) in the evolutionary process. It is a mechanism of post-transcriptional gene silencing. There are many types of RNAi expression vectors. Compared with other expression systems, the lentiviral expression system has the advantages of high infection efficiency, long infection time, stable infection effect, can accommodate larger gene fragments, and is not easy to induce host immune response. It has become a hot spot in the current research of vectors in gene therapy and transgenic animals.

[0006] So far, no studies have shown that the NEDD4L gene is associated with tamoxifen resistance in ER+ breast cancer, nor is there any literature indicating the role of inhibiting NEDD4L expression in reversing tamoxifen resistance. Summary of the invention

[0007] The first objective of the present invention is to provide a lentivirus for inhibiting the expression of the NEDD4L gene, thereby solving the problem that the existing tamoxifen therapy may induce tamoxifen resistance in ER+ patients, resulting in poor treatment effect.

[0008] The second object of the present invention is to provide a method for constructing the above-mentioned lentivirus The third object of the present invention is to provide the application of the above-mentioned lentivirus.

[0009] The first technical solution adopted by the present invention is: a lentivirus for inhibiting the expression of NEDD4L gene, wherein the lentivirus is obtained by knocking down the expression of human NEDD4L gene using RNA interference technology, and the target sequence of the lentivirus for inhibiting the expression of human NEDD4L gene includes shRNA-NEDD4L-1, shRNA-NEDD4L-2 and shRNA-NEDD4L-4; The nucleic acid sequence of shRNA-NEDD4L-1 is SEQ ID NO.1: GGAGCGACCCTATACATTTAA; The nucleic acid sequence of shRNA-NEDD4L-2 is SEQ ID NO.2: GAAGATCCACGTTTGAAATTT; The nucleic acid sequence of shRNA-NEDD4L-4 is SEQ ID NO.4: TCCCTTACTCCAGAGAATTTA.

[0010] The first technical solution adopted by the present invention is also characterized in that: Preferably, the forward oligonucleotide sequence targeting shRNA-NEDD4L-1 is SEQ ID NO.5: 5'-CCGGGGAGCGACCCTATACATTTAACTCGAGTTAAATGTATAGGGTCGCTCCTTTTTG-3'; The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-1 is SEQ ID NO.6: 5′-AATTCAAAAAGGAGCGACCCTATACATTTAACTCGAGTTAAATGTATAGGGTCGCTCCCCGG-3′; The forward oligonucleotide sequence of the targeting shRNA-NEDD4L-2 is SEQ ID NO.7: 5′-CCGGGAAGATCCACGTTTGAAATTTCTCGAGAAATTTCAAACGTGGATCTTC TTTTTG-3′; The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-2 is SEQ ID NO.8: 5′-AATTCAAAAAGAAGATCCACGTTTGAAATTTCTCGAGAAATTTCAAACGTGGATCTTCCCGG-3′; The forward oligonucleotide sequence of the targeting shRNA-NEDD4L-4 is SEQ ID NO. 11: 5′-CCGGTCCCTTACTCCAGAGAATTTACTCGAGTAAATTCTCTGGAGTAAGGGATTTTTG-3′; The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-4 is SEQ ID NO. 12: 5′-AATTCAAAAATCCCTTACTCCAGAGAATTTACTCGAGTAAATTCTCTGGAGTAAGGGACCGG-3′.

[0011] The second technical solution adopted by the present invention is: a method for constructing a lentivirus for inhibiting the expression of the NEDD4L gene, which specifically comprises the following steps: Step 1: Design interference target sequences based on human NEDD4L gene, and select the above shRNA sequence based on gene knockout efficiency; Step 2: synthesizing complementary forward and reverse oligonucleotide single strands according to the shRNA sequence in step 1, and annealing the forward and reverse oligonucleotide single strands to form double-stranded DNA fragments with sticky ends; Step 3, the pLKO.1-TRC lentiviral knockdown vector plasmid was double-digested with Agel and EcoRI to form a pLKO.1-TRC lentiviral vector fragment with sticky ends; Step 4, the double-stranded DNA fragment in step 2 and the pLKO.1-TRC lentiviral vector fragment in step 3 are connected using T4 DNA ligase to obtain a pLKO.1-TRC-NEDD4L-shRNA recombinant plasmid; Step 5: Transform the pLKO.1-TRC-NEDD4L-shRNA recombinant plasmid into competent Escherichia coli bacteria, and obtain a lentiviral vector containing the shRNA sequence that inhibits the expression of the human NEDD4L gene after single colony culture.

[0012] The second technical solution adopted by the present invention is also characterized in that: Preferably, step 5 is as follows: using bacterial streak separation technology, the transformed Escherichia coli is smeared on an agarose plate containing ampicillin antibiotics, and cultured overnight at 37°C for 14 hours; picking a single colony, inoculating it in a liquid LB medium containing ampicillin, and shaking and culturing at 200 rpm at 37°C for 14 hours; extracting the plasmid, detecting the concentration, and verifying it by sequencing to obtain a lentiviral vector containing a shRNA sequence that inhibits the expression of the human NEDD4L gene.

[0013] Preferably, the method further comprises step 6, verifying the knockdown efficiency of the shRNA plasmid in the breast cancer cell line MCF-7.

[0014] Preferably, step 6 is as follows: using a transfection reagent to co-transfect the lentiviral packaging plasmid and the sh-RNA lentiviral vector into HEK-293T cells, collecting the cell culture supernatant after 72 hours, and transfecting it into MCF-7 breast cancer cells; using puromycin to screen out virus-infected cells, and using real-time fluorescence quantitative PCR to detect the expression level of NEDD4L mRNA in each stable cell line; using immunoblotting to detect the expression level of NEDD4L protein in each stable cell line.

[0015] The third technical solution adopted by the present invention is: use of a lentivirus that inhibits the expression of the NEDD4L gene in constructing a stably transfected breast cancer cell model that inhibits the messenger RNA and protein expression levels of the human NEDD4L gene.

[0016] The fourth technical solution adopted by the present invention is: use of a lentivirus that inhibits the expression of the NEDD4L gene in the preparation of a breast cancer therapeutic drug that uses the NEDD4L gene as a therapeutic target.

[0017] The beneficial effects of the present invention are: The shRNA knockdown lentivirus designed in the present invention for the human NEDD4L gene can significantly reduce the expression levels of NEDD4L messenger RNA and protein in breast cancer cells, and significantly increase the sensitivity of breast cancer cells to tamoxifen, which is of great significance for reversing tamoxifen resistance in breast cancer, and also provides a research basis for further studying the function of NEDD4L in reversing tumor resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is a schematic diagram of the pLKO.1-TRC lentiviral vector map; Figure 2 This is the gel electrophoresis image of double-enzyme-digested pLKO.1-TRC lentiviral vector; Figure 3 This is the result of shRNAs inhibiting NEDD4L mRNA expression; Figure 4This is the result of shRNAs inhibiting NEDD4L protein expression; Figure 5 This is the result of tamoxifen-induced cell proliferation after inhibiting NEDD4L expression; Figure 6 is the result of tamoxifen-induced cell cycle arrest after inhibition of NEDD4L expression; Figure 7 This is a graph showing the results of tamoxifen-induced cell apoptosis after inhibiting NEDD4L expression. DETAILED DESCRIPTION

[0019] The technical solution of the present invention will be clearly and completely described below in conjunction with the accompanying drawings.

[0020] According to the basic principle of RNA interference technology, the present invention provides a shRNA knockdown lentivirus for inhibiting the expression of human NEDD4L gene, such as Figure 1 The gel electrophoresis diagram is shown in Figure 2 As shown, it is used to inhibit the expression level of a specific gene messenger RNA and protein in breast cancer cells; at the same time, the sensitivity of breast cancer cells to tamoxifen after knocking down the gene is detected. The present invention provides a basis for in-depth research on the biological function of NEDD4L protein and its function in reversing tamoxifen resistance in breast cancer.

[0021] The shRNA sequences that inhibit the expression of human NEDD4L gene (NCBI gene ID: 23327) include shRNA-NEDD4L-1, shRNA-NEDD4L-2, shRNA-NEDD4L-3 and shRNA-NEDD4L-4. The specific sequences are: shRNA-NEDD4L-1(SEQ ID NO.1):GGAGCGACCCTATACATTTAA; shRNA-NEDD4L-2 (SEQ ID NO.2): GAAGATCCACGTTTGAAAATTT; shRNA-NEDD4L-3 (SEQ ID NO.3): GCGGTCAAAGACATCTTTAAA; shRNA-NEDD4L-4 (SEQ ID NO. 4):TCCCTTACTCCAGAGAATTTA.

[0022] Furthermore, an oligonucleotide sequence targeting the shRNA sequence of the human NEDD4L gene was synthesized and annealed to form a DNA double-strand with sticky ends.

[0023] The forward oligonucleotide sequence targeting shRNA-NEDD4L-1 was: 5′-CCGGGGAGCGACCCTATACATTTAACTCGAGTTAAATGTATAGGGTCGCTCCTTTTTG-3′ (SEQ ID NO. 5); The reverse oligonucleotide sequence for targeting shRNA-NEDD4L-1 was: 5′-AATTCAAAAAGGAGCGACCCTATACATTTAACTCGAGTTAAATGTATAGGGTCGCTCCCCGG-3′ (SEQ ID NO. 6); The forward oligonucleotide sequence targeting shRNA-NEDD4L-2 was: 5′-CCGGGAAGATCCACGTTTGAAATTTCTCGAGAAATTTCAAACGTGGATCTTC TTTTTG-3′ (SEQ ID NO. 7); The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-2 was: 5′-AATTCAAAAAGAAGATCCACGTTTGAAATTTCTCGAGAAATTTCAAACGTGGATCTTCCCGG-3′ (SEQ ID NO. 8); The forward oligonucleotide sequence targeting shRNA-NEDD4L-3 was: 5′-CCGGGCGGTCAAAGACATCTTTAAACTCGAGTTTAAAGATGTCTTTGACCGCTTTTTG-3′ (SEQ ID NO. 9); The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-3 was: 5′-AATTCAAAAAGCGGTCAAAGACATCTTTAAACTCGAGTTTAAAGATGTCTTTGACCGCCCGG-3′ (SEQ ID NO. 10); The forward oligonucleotide sequence targeting shRNA-NEDD4L-4 was: 5′-CCGGTCCCTTACTCCAGAGAATTTACTCGAGTAAATTCTCTGGAGTAAGGGATTTTTG-3′ (SEQ ID NO. 11); The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-4 was: 5′-AATTCAAAAATCCCTTACTCCAGAGAATTTACTCGAGTAAATTCTCTGGAGTAAGGGACCGG-3′ (SEQ ID NO. 12); The present invention also provides a method for constructing a shRNA knockdown lentiviral plasmid of a human NEDD4L gene, which specifically comprises the following steps: Step 1, designing the shRNA sequence specifically targeting the human NEDD4L gene as described above; Step 2, synthesizing and preparing the double-stranded DNA fragment expressed by the above shRNA sequence; Step 3: Construction of shRNA knockdown plasmid of human NEDD4L gene and packaging of lentivirus.

[0024] In step 1, multiple target sequences were designed for the human NEDD4L gene, and the optimal shRNA sequence was selected by verifying the knockdown efficiency.

[0025] Step 2 specifically comprises synthesizing two complementary single-stranded oligonucleotide sequences according to the shRNA sequence in step 1, and synthesizing the two RNA single-strands into a double-stranded DNA fragment with sticky ends through annealing.

[0026] Specifically, step 3 is to perform double restriction digestion of the pLKO.1-TRC lentiviral plasmid vector with Agel and EcoRI to form a pLKO.1-TRC lentiviral vector fragment with sticky ends; the double-stranded DNA fragment in step 2 is connected to the pLKO.1-TRC lentiviral vector fragment with sticky ends by T4 DNA ligase, and transformed into Escherichia coli competent bacteria, and the transformed Escherichia coli is smeared on an agarose plate containing ampicillin antibiotics using bacterial streak separation technology, and cultured overnight at 37°C for 14 hours; a single colony is picked and inoculated into a liquid LB culture medium containing ampicillin, and cultured at 200 rpm at 37°C for 14 hours; the plasmid is extracted, the concentration is detected, and the knockdown plasmid containing the pLKO.1-TRC lentiviral vector and the shRNA sequence that inhibits the expression of the human NEDD4L gene is obtained by sequencing verification.

[0027] Also includes the steps: Step 4: Verify the knockdown efficiency of the above shRNA knockdown plasmid in human breast cancer cells.

[0028] The present invention also provides the use of the above-mentioned shRNA knockdown lentivirus for inhibiting the expression of human NEDD4L gene in the preparation of a drug for improving the tamoxifen sensitivity of breast cancer by targeting the human NEDD4L gene as a therapeutic target in breast cancer.

[0029] The relationship between NEDD4L expression and tamoxifen resistance in ER+ breast cancer is further determined by the following examples and experimental figures: Example 1 This example provides a shRNA knockdown lentivirus for inhibiting the expression of human NEDD4L gene (NCBI gene ID: 23327), and the preparation method thereof is as follows: (1) The target sequence for the human NEDD4L gene is designed as shown in Table 1; Table 1 Four interference target sequences of NEDD4L

[0030] (2) Synthesize complementary oligonucleotide single strand required for shRNA expression: According to the target sequence designed in step (1), two reverse complementary shRNA oligonucleotide single strands targeting the human NEDD4L gene were synthesized, and the corresponding forward and reverse oligonucleotide sequences are shown in Table 2; Table 2 Forward and reverse nucleotide sequences of 4 shRNAs targeting human NEDD4L gene expression

[0031] (3) Annealing the complementary forward and reverse shRNA single strands to form DNA fragments with sticky ends Use DEPC water to prepare the synthesized forward and reverse shRNA oligonucleotide single strands into a solution with a final concentration of 10 μM. Take 10 μL of each forward and reverse shRNA solution, mix them thoroughly in an EP tube, transfer them to a beaker containing 100°C boiling water, and wait for it to cool naturally to room temperature to obtain shRNA double-stranded DNA fragments with sticky ends; (4) Double restriction digestion of pLKO.1-TRC lentiviral vector plasmid and purification of the vector fragment; Prepare the double enzyme digestion system according to the following ratio, mix well and place it in a 37°C water bath for 4 hours; Table 3 Configuration of pLKO.1-TRC lentiviral vector double restriction enzyme digestion system

[0032] After the reaction, the obtained enzyme digestion products were separated at 180V in 1% agarose gel electrophoresis, and the gel containing the target vector fragment was cut out under UV gel imager, and the vector fragment was purified and recovered using gel DNA recovery kit (Sangong, B610353-0100); (5) The double-stranded shRNA fragment was connected with the pLKO.1-TRC lentiviral vector fragment, transformed, and the plasmid was extracted and sequenced; the enzyme connection system was prepared according to the following ratio, mixed, placed in a PCR instrument, and reacted at 20°C for 2 hours to obtain the connection product; Table 4 Enzyme ligation system configuration

[0033] The ligation product was transformed into competent E. coli DH5α, evenly spread on an agarose plate containing ampicillin antibiotics, inverted and cultured at 37°C for 14 hours, and a single colony was picked and inoculated into liquid agarose medium containing ampicillin, cultured at 200 rpm and 37°C for 14 hours. The plasmid was extracted using a plasmid extraction kit (Sangong, B515109-0100) and sent to a sequencing company for DNA sequencing identification.

[0034] Example 2 This example provides a packaging method for shRNA lentivirus targeting NEDD4L and shRNA targeting EGFP gene (negative control) using pLKO.1-TRC as a vector. The correct recombinant lentiviral plasmid sh-NEDDL and negative control sh-GFP plasmid were identified by sequencing, and the lentiviral transfection reagent LentiFit produced by Hanheng Company was used. TM Use the instructions to package the lentivirus. Taking the 6-cell culture plate as an example, the specific steps for lentivirus packaging are as follows: (1) One day in advance, mix 2×10 5 HEK-293T cells were seeded in 6-well cell culture plates with 2 mL of DMEM complete medium per well and cultured overnight in a 37°C, 5% CO2 cell culture incubator. At this time, the cell density was about 80%, which was the optimal cell density for transfection; (2) On the day of transfection, replace the culture dish with 2 mL of fresh culture medium and return it to the constant temperature incubator.

[0035] (3) Take a clean 1.5 mL new centrifuge tube, add 100 μL DMEM medium and 5 μg plasmid mixture (mass ratio of PMD.2G: PsPAX2: shRNA plasmid = 1:2:2), and mix gently with a pipette. Take another clean 1.5 mL new centrifuge tube, add 100 μL DMEM medium and 8 μL LentiFit TM , mix gently by pipetting, and leave at room temperature for 5 minutes.

[0036] (4) Mix the liquids in the two centrifuge tubes and incubate at room temperature for 20 minutes. Evenly add the transfection complex to the HEK-293T cells, shake gently, and return to the incubator to keep warm.

[0037] (5) After 6 hours of culture, the culture medium was replaced with fresh DMEM complete medium and the culture was continued for 72 hours.

[0038] (6) Collect the cell culture supernatant containing lentiviral particles, filter using a 0.45 μm disposable syringe filter, dispense into 1.5 mL EP tubes, and store at -80°C for later use.

[0039] Example 3 This example provides a method for infecting a human breast cancer cell line MCF-7 with a shRNA lentivirus containing NEDD4L, and using real-time fluorescence quantitative PCR and protein immunoblotting to detect the knockdown efficiency of the lentivirus on NEDD4L messenger RNA and protein in the cell. Taking a 6-well plate as an example, the specific steps are as follows: (1) One day in advance, add 1×10 5 MCF-7 were inoculated in a 6-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. At this time, the cell density was about 60%, which was the optimal cell density for virus infection.

[0040] (2) Replace with fresh DMEM complete medium, 1 mL per well. Add 1 mL of sh-NEDDL or sh-GFP lentiviral particles to each well, and add Polybrane with a final concentration of 10 μg / L as an infection enhancer, and continue to culture in a 37°C, 5% CO2 incubator for 24 hours.

[0041] (3) After 24 hours, replace the culture medium with fresh DMEM complete medium and add 2 μg / mL puromycin for another 7 days to kill cells that have not been successfully infected with the lentivirus. The surviving cells at this time are MCF-7 cells stably infected with the lentivirus.

[0042] (4) Identification of shRNA knockdown efficiency The stable cell lines in step (3) were divided into two parts, one for extracting total mRNA and reverse transcribed into cDNA, and the expression level of NEDD4L mRNA in each stable cell line was detected by real-time fluorescence quantitative PCR; the other for extracting total cell protein, and the expression level of NEDD4L protein in each stable cell line was detected by immunoblotting. The test results are as follows: Figure 3 and Figure 4 As shown: Compared with the sh-GFP negative control cell line, the four shRNAs designed targeting the human NEDD4L gene, sh-NEDD4L-1, shNEDD4L-2 and sh-NEDD4L-4, have ideal effects in the human breast cancer cell line MCF-7.

[0043] Example 4 This experimental example provides a method for measuring the effect of tamoxifen on cell proliferation toxicity of stably transfected cell lines transfected with various human NEDD4L shRNAs using the CCK-8 method.

[0044] (1) Select sh-NEDD4L-1, sh-NEDD4L-2 and NEDD4L-4 stably transfected MCF-7 cell lines with high knockdown efficiency of human NEDD4L gene, inoculate them into 96-well plates, set up 8 experimental replicates in each group, 2000 cells per well, and culture them statically in an incubator at 37°C and 5% CO2 overnight; (2) Add 20 nM tamoxifen solution to each well of cells and continue culturing for 24, 48, 72, and 96 hours.

[0045] (3) In the dark, add 10 μL of CCK-8 solution to each well of cells at 0, 24, 48, 72, and 96 hours, and continue culturing for 4 hours.

[0046] (4) After 4 hours of incubation, the absorbance was measured at 450 nm and statistical analysis was performed. Figure 5 As shown in Figure 2, knocking down NEDD4L in human breast cancer MCF-7 cells significantly enhanced the inhibitory effect of tamoxifen on cell proliferation. Figure 5 As shown: In the human breast cancer cell line MCF-7, sh-NEDD4L-1, shNEDD4L-2 and sh-NEDD4L-4 significantly enhanced the inhibitory effect of tamoxifen on cell proliferation compared with the sh-GFP negative control cell line.

[0047] Example 5 This example provides flow cytometry to detect the effect of tamoxifen on cell cycle arrest in stably transfected cell lines transfected with various human NEDD4L shRNAs.

[0048] (1) Take the above-mentioned MCF-7 stable cell line infected with sh-NEDD4L lentivirus and inoculate it into a 6-well plate, with 2×10 cells per well. 5 The cells were cultured overnight in a 37°C, 5% CO2 incubator. (2) Add tamoxifen at a final concentration of 20 nM to each well of cells and incubate at 37°C in a 5% CO2 incubator for 24 hours; (3) Wash the cells twice with PBS. After washing, centrifuge and discard the supernatant, add pre-cooled 70% ethanol to the centrifuge tube, and then centrifuge in a 4°C centrifuge for 15 minutes.

[0049] (4) After centrifugation, wash the cells twice with 1 mL of PBS, then add 100 μL of PI staining solution and incubate in the dark for 10 minutes.

[0050] (5) Flow cytometry: Flow cytometry was used to detect the cell cycle. 10,000 cells were counted for each cell line and the results were analyzed using the cell cycle fitting software Modfit. Figure 6As shown, left side: flow cytometry detection of cell cycle diagram; right side: statistical graph of the proportion of cells in the division phase in each group; after knocking down NEDD4L in human breast cancer MCF-7 cells, the effect of tamoxifen on cell cycle arrest was significantly enhanced.

[0051] Example 6 This example provides flow cytometry to detect the apoptotic effect of stably transfected cell lines transfected with various human NEDD4L shRNAs on tamoxifen-induced cells.

[0052] (1) Take the above-mentioned MCF-7 stable cell line infected with sh-NEDD4L lentivirus and inoculate it into a 6-well plate, with 2×10 cells per well. 5 The cells were cultured overnight in a 37°C, 5% CO2 incubator. (2) Add tamoxifen at a final concentration of 50 nM to each well of cells and culture in a 37°C, 5% CO2 incubator for 24 hours; (3) Wash the cells twice with PBS. After washing, centrifuge and discard the supernatant, add pre-cooled 70% ethanol to the centrifuge tube, and then centrifuge in a 4°C centrifuge for 15 minutes.

[0053] (4) After centrifugation, wash the cells twice with 1 mL of PBS, then add 100 μL of PI and Annexin V staining solution and incubate in the dark for 10 minutes.

[0054] (5) Flow cytometry: Detect cell apoptosis using flow cytometry, and count 10,000 cells for each cell line. Figure 7 As shown, left side: flow cytometry detection of cell apoptosis; right side: statistical graph of the proportion of apoptotic cells in each group. After knocking down NEDD4L in human breast cancer MCF-7 cells, tamoxifen-induced breast cancer cell apoptosis was significantly enhanced.

[0055] The present invention designs 4 shRNAs targeting human NEDD4L gene knockdown through experiments at the molecular biology and cell biology levels. Real-time fluorescence quantitative PCR and immunoblotting experiments detect the knockdown effects of the 4 shRNAs targeting human NEDD4L gene knockdown on the NEDD4L gene in the human breast cancer cell line MCF-7.

[0056] The optimal sequences were obtained as sh-NEDD4L-1, shNEDD4L-2 and sh-NEDD4L-4. Furthermore, sh-NEDD4L-1, shNEDD4L-2 and sh-NEDD4L-4 can significantly enhance the proliferation toxicity, cell cycle arrest and apoptosis of tamoxifen on breast cancer cells.

[0057] Breast cancer is the most commonly diagnosed cancer that endangers the health of women worldwide. The cancer statistics released by GLOBOCAN in 2020 show that breast cancer in women has become the cancer with the highest incidence, and its mortality rate should not be underestimated. According to statistics, the incidence of breast cancer has been increasing with age, and has a strong correlation with age factors, which means that breast cancer is more harmful to older women. The incidence of breast cancer is higher in developed areas, but due to the large population base in underdeveloped areas, about half of the world's breast cancer diagnoses occur in underdeveloped areas. Underdeveloped areas and older women account for a considerable proportion of the world's population. Research and development on the prevention, diagnosis, treatment and prognosis of breast cancer is necessary and necessary for the world. There are many factors that cause breast cancer, among which the most important factors are genetics, hormone exposure, ionizing radiation, low parity, high breast density and a history of atypical hyperplasia. Bad living habits are also a possibility of inducing breast cancer. Breast cancer is usually diagnosed through clinical examination and imaging examination or pathological evaluation.

[0058] Ubiquitination modification is an important form of post-translational regulation of proteins. Neural Precursor Cell Expressed Development Down-regulated 4-Like (NEDD4-L) is an E3 ubiquitin ligase of the HECT family. Existing studies have shown that NEDD4L is an inhibitory molecule of primary breast cancer. In ER+ and triple negative breast cancer (TNBC) cell lines, NEDD4L inhibits the function of tumor-initiating cells (TICs) by targeting and degrading NOTCH1, and NEDD4L expression is significantly positively correlated with a better recurrence-free prognosis in breast cancer patients. In breast cancer stem cells (BCSCs), NEDD4L inhibits the expression of breast cancer stem transcription factor SOX2 by mediating ubiquitination degradation of phosphorylated FOXO1, thereby inhibiting the activation of BCSCs. However, the mechanism of action of NEDD4L in endocrine resistance of ER+ breast cancer remains unknown.

[0059] In order to further study the mechanism of action of NEDD4L in regulating endocrine resistance of ER+ breast cancer, full preparation is made for subsequent experiments. It is necessary to carry out efficient and accurate knockdown of the NEDD4L gene. RNA interference has high selectivity and specificity, and can achieve precise positioning. The loading efficiency of shRNA is much higher than that of siRNA, and it can be continuously synthesized by host cells, with a more lasting effect, and it is less likely to be off-target than siRNA, which is an ideal knockdown tool. Therefore, in subsequent experiments, the present invention designs shRNA sequences for the NEDD4L gene, and further constructs and transfects them, in order to achieve a higher knockdown rate and expected sequence.

[0060] In view of this, the applicant proposed the present invention based on the basic principles of RNA interference technology, and designed shRNA sequences, namely shRNA-NEDD4L-1, shRNA-NEDD4L-2 and shRNA-NEDD4L-4 sequences, which can greatly inhibit the expression of human NEDD4L gene and enhance the sensitivity of breast cancer cells to tamoxifen treatment, providing a beneficial approach for the treatment of breast cancer and other related cancers.

[0061] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

Claims

1. A lentivirus for inhibiting NEDD4L gene expression, characterized in that: The lentivirus is obtained by knocking down the expression of the human NEDD4L gene using RNA interference technology, and the target sequence of the lentivirus for inhibiting the expression of the human NEDD4L gene includes shRNA-NEDD4L-1, shRNA-NEDD4L-2 and shRNA-NEDD4L-4; The nucleic acid sequence of the shRNA-NEDD4L-1 is SEQ ID NO.1: GGAGCGACCCTATACATTTAA; The nucleic acid sequence of the shRNA-NEDD4L-2 is SEQ ID NO.2: GAAGATCCACGTTTGAAATTT; The nucleic acid sequence of the shRNA-NEDD4L-4 is SEQ ID NO.4: TCCCTTACTCCAGAGAATTTA.

2. The lentivirus for inhibiting NEDD4L gene expression according to claim 1, characterized in that: The forward oligonucleotide sequence of the targeting shRNA-NEDD4L-1 is SEQ ID NO. 5: 5′-CCGGGGAGCGACCCTATACATTTAACTCGAGTTAAATGTATAGGGTCGCTCCTTTTTG-3′; The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-1 is SEQ ID NO.6: 5′-AATTCAAAAAGGAGCGACCCTATACATTTAACTCGAGTTAAATGTATAGGGTCGCTCCCCGG-3′; The forward oligonucleotide sequence of the targeting shRNA-NEDD4L-2 is SEQ ID NO.7: 5′-CCGGGAAGATCCACGTTTGAAATTTCTCGAGAAATTTCAAACGTGGATCTTC TTTTTG-3′; The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-2 is SEQ ID NO.8: 5′-AATTCAAAAAGAAGATCCACGTTTGAAATTTCTCGAGAAATTTCAAACGTGGATCTTCCCGG-3′; The forward oligonucleotide sequence of the targeting shRNA-NEDD4L-4 is SEQ ID NO. 11: 5′-CCGGTCCCTTACTCCAGAGAATTTACTCGAGTAAATTCTCTGGAGTAAGGGATTTTTG-3′; The reverse oligonucleotide sequence of the targeting shRNA-NEDD4L-4 is SEQ ID NO. 12: 5′-AATTCAAAAATCCCTTACTCCAGAGAATTTACTCGAGTAAATTCTCTGGAGTAAGGGACCGG-3′.

3. The method for constructing a lentivirus for inhibiting NEDD4L gene expression according to any one of claims 1 or 2, characterized in that: The specific steps include: Step 1, designing an interference target sequence according to the human NEDD4L gene, and selecting the shRNA sequence according to the gene knockout efficiency; Step 2: synthesizing complementary forward and reverse oligonucleotide single strands according to the shRNA sequence described in step 1, and annealing the forward and reverse oligonucleotide single strands to form double-stranded DNA fragments with sticky ends; Step 3, the pLKO.1-TRC lentiviral knockdown vector plasmid was double-digested with Agel and EcoRI to form a pLKO.1-TRC lentiviral vector fragment with sticky ends; Step 4, ligating the double-stranded DNA fragment in step 2 with the pLKO.1-TRC lentiviral vector fragment in step 3 using T4 DNA ligase to obtain a pLKO.1-TRC-NEDD4L-shRNA recombinant plasmid; Step 5: transform the pLKO.1-TRC-NEDD4L-shRNA recombinant plasmid into competent Escherichia coli bacteria, and culture a single colony to obtain a lentiviral vector containing the shRNA sequence that inhibits the expression of the human NEDD4L gene.

4. The method for constructing a lentivirus for inhibiting NEDD4L gene expression according to claim 3, characterized in that: Step 5 is as follows: using bacterial streak separation technology, the transformed Escherichia coli is smeared on an agarose plate containing ampicillin antibiotics, and cultured overnight at 37°C for 14 hours; a single colony is picked and inoculated into a liquid LB medium containing ampicillin, and cultured at 200 rpm at 37°C for 14 hours; the plasmid is extracted, the concentration is detected, and a lentiviral vector containing a shRNA sequence that inhibits the expression of the human NEDD4L gene is obtained by sequencing verification.

5. The method for constructing a lentivirus for inhibiting NEDD4L gene expression according to claim 3, characterized in that: Also includes the steps: Step 6: Verify the knockdown efficiency of the shRNA plasmid in the breast cancer cell line MCF-7.

6. The method for constructing a lentivirus for inhibiting NEDD4L gene expression according to claim 5, characterized in that: The step 6 is specifically as follows: using a transfection reagent to co-transfect the lentiviral packaging plasmid and the sh-RNA lentiviral vector into HEK-293T cells, collecting the cell culture supernatant after 72 hours, and transfecting it into MCF-7 breast cancer cells; using puromycin to screen out virus-infected cells, and using real-time fluorescence quantitative PCR to detect the expression level of NEDD4L mRNA in each stable cell line; using immunoblotting to detect the expression level of NEDD4L protein in each stable cell line.

7. Use of the lentivirus for inhibiting NEDD4L gene expression according to any one of claims 1 or 2 in constructing a stably transfected breast cancer cell model that inhibits the messenger RNA and protein expression levels of the human NEDD4L gene.

8. Use of the lentivirus for inhibiting NEDD4L gene expression according to any one of claims 1 or 2 in the preparation of a drug for treating breast cancer using the NEDD4L gene as a therapeutic target.

Images