M-MLV reverse transcriptase mutant as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biology, in particular to an M-MLV reverse transcriptase mutant and a preparation method and application thereof. The invention provides an M-MLV reverse transcriptase mutant as well as a preparation method and application thereof. The M-MLV reverse transcriptase mutant fuses the structural characteristics of a plurality of mutant variants, and has better performance in the aspects of reverse transcription activity and thermal stability. Particularly, the M-MLV reverse transcriptase mutant Super RT with the amino acid sequence shown as SEQ ID NO.01 has high continuous synthesis capacity and can be used for carrying out a good reverse transcription reaction on a long-chain RNA template; the method has the advantages that the cDNA can be synthesized in a complex reaction environment, and the synthesis of the full-length cDNA can be completed in a relatively short time even in the presence of common inhibitors such as guanidine salt, heparin and salt.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an M-MLV reverse transcriptase mutant and a preparation method and application thereof. Background Art

[0002] The discovery of reverse transcriptase proved that genetic information is not a one-way process from DNA to RNA to protein, but can also be transferred from RNA to DNA in the opposite direction. The ability to reverse transcribe mature mRNA into cDNA is essential for obtaining information in various biomedical settings, including diagnosis, prognosis, biotechnology, and forensic biology. Therefore, reverse transcriptase has become a ubiquitous tool in molecular biology.

[0003] Reverse transcriptase was first discovered in Moloney murine leukemia virus (MMLV). It is a DNA polymerase that uses RNA as a template. It consists of 671 amino acids and consists of four subdomains (finger domain, palm domain, thumb domain and connector domain) and a ribonuclease H (RNase H) active domain. It has RNase H activity and does not have 3'-5' exonuclease activity. It can be used for reverse transcription to synthesize cDNA. One of the main challenges in the process of reverse transcription and cDNA synthesis is the interference of RNA secondary structure. Although higher reaction temperature can remove the secondary structure of template RNA, too high temperature usually leads to a sharp decrease in wild-type (WT) MMLV reverse transcription activity. The activity of reverse transcriptase is also affected by many other factors. For example, the presence of inhibitors in the reaction system (such as cell lysates and related reagents) and the low-volume reaction system will have a negative impact on the reverse transcription activity of WT RT.

[0004] Current studies have shown that E69K, E302R, T306K, W313F, L435G / K, N454K (Arezi et al (2009) Nucleic Acids Res. 37(2): 473-481, US Pat. No. 7,078,208, and Baranauskas et al 2012 Prot Engineering 25(10): 657-668), L52P, Y64R, K152M, H204R, M289L, T306K and other sites can improve thermal stability (CN1430670); L139P, D200N, T330P, P448A, D449G, L603W, E607K and other sites can improve the full-length reverse transcription capacity and the ability to resist cell lysate inhibition and higher thermal stability, and still have high reaction activity when the reaction system is less than 1 nanoliter; in addition, D52 Changes in sites such as 4N / A can reduce or eliminate the activity of RNase H (CN110637084A); changes in sites such as Y64W / R, K152R, Q190F, T197A / E, V223H / L / F, Y133A / H, and F309N / R can improve the fidelity of reverse transcription; and changes in sites such as Y133A, T197E, and F309N have also been shown to reduce the activity of terminal transferase (CN1430670; U.S. application Nos. 60 / 189,454; 09 / 808,124).

[0005] In existing studies, the reverse transcriptases with various performance improvements are mainly obtained through random mutation and site-directed mutation. Random mutation is to randomly mutate the amino acids in the domain of M-MLV, and then screen them by different methods. This method can screen out a variety of MMLV mutants with improved performance, but the technical process is cumbersome, the capacity of the mutation library is huge (up to 107), and there are a large number of invalid mutations, which makes screening extremely difficult. Site-directed mutagenesis, this method is more purposeful, mainly through amino acid mutations in key active site amino acids such as nucleic acid binding sites and metal ion binding sites to change the activity of the enzyme. However, this method lacks analysis of the overall structure of the enzyme and cannot improve the performance of the enzyme from multiple aspects. Generally, there is a balance between the activity and stability of the reverse transcriptase, that is, mutations in amino acid sites that increase enzyme activity may lead to reduced protein stability, while mutations in amino acid sites that increase protein stability may reduce enzyme activity. Therefore, it is of great significance to provide a reverse transcriptase that has both high temperature stability and high activity.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a M-MLV reverse transcriptase mutant with high reverse transcription efficiency, high temperature resistance and strong anti-inhibition ability, as well as a preparation method and application thereof.

[0008] Specifically, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a M-MLV reverse transcriptase mutant. Compared with the amino acid sequence of a wild-type M-MLV reverse transcriptase, the amino acid sequence of the reverse transcriptase mutant has one or more of the following mutations: Y133K, T306H, T330G, L435R.

[0009] Preferably, compared with the amino acid sequence of the wild-type M-MLV reverse transcriptase, the amino acid sequence of the reverse transcriptase mutant has one of the following mutation combinations: Mutation combination 2: Y133K, T330G; Mutation combination 3: T306H, T330G; Mutation combination 6: Y133K, T306H, L435R; Mutation combination 8: Y133K, T330G, L435R; Mutation combination 10: Y133K, T306H, T330G, L435R; Mutation combination 18: Y133K, T306H, T330G.

[0010] Preferably, the amino acid sequence of the wild-type M-MLV reverse transcriptase is shown in SEQ ID NO.02.

[0011] Preferably, the amino acid sequence of the M-MLV reverse transcriptase mutant is as shown in SEQ ID NO.01.

[0012] The M-MLV reverse transcriptase mutant provided by the present invention (especially the M-MLV reverse transcriptase mutant Super RT having the amino acid sequence shown in SEQ ID NO.01) incorporates the structural characteristics of multiple mutant variants, has the advantages of high temperature resistance, strong anti-inhibition ability, strong continuous synthesis ability, etc., overcomes the reverse transcription difficulties caused by the complex secondary structure of RNA, inhibitors inhibiting reverse transcription and other problems, and has broad application prospects and market promotion value.

[0013] In a second aspect, the present invention provides a coding gene having a nucleotide sequence encoding the M-MLV reverse transcriptase mutant.

[0014] In a third aspect, the present invention provides a biological material, which is a recombinant plasmid or a recombinant bacterium. The biological material has the encoding gene and can obtain the M-MLV reverse transcriptase mutant based on the expression of the encoding gene.

[0015] In a fourth aspect, the present invention provides a method for preparing the M-MLV reverse transcriptase mutant, comprising the following steps: using the biological material to express the M-MLV reverse transcriptase mutant.

[0016] In a fifth aspect, the present invention provides the use of the M-MLV reverse transcriptase mutant in the preparation of a high temperature resistant reagent; the high temperature resistant reagent has biological activity at 65°C.

[0017] In a sixth aspect, the present invention provides the use of the M-MLV reverse transcriptase mutant in a reverse transcription reaction.

[0018] Preferably, a reverse transcription inhibitor is present in the reverse transcription reaction, and the reverse transcription inhibitor is selected from at least one of guanidine salt, heparin or salt.

[0019] Beneficial effects: The present invention provides a M-MLV reverse transcriptase mutant and a preparation method and application thereof. The M-MLV reverse transcriptase mutant incorporates the structural features of multiple mutant variants, and has good performance in terms of reverse transcription activity and thermal stability. In particular, the M-MLV reverse transcriptase mutant Super RT, whose amino acid sequence is shown in SEQ ID NO.01, has a high continuous synthesis ability and can perform a good reverse transcription reaction on a long-chain RNA template; and has a strong anti-inhibition ability, which can ensure the synthesis of cDNA in a complex reaction environment, and can complete the synthesis of full-length cDNA in a relatively short time even in the presence of common inhibitors such as guanidine salts, heparin and salts. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0021] Figure 1 Schematic diagram of reverse transcriptase mutant plasmid construction.

[0022] Figure 2 The figure is the SDA-PAGE test result of the reverse transcriptase mutant protein sample; wherein, lanes 1-18 are the mutant protein samples tested, and M is the protein molecular weight standard.

[0023] Figure 3It is an agarose gel electrophoresis diagram for detecting the reverse transcription activity of reverse transcriptase mutants; wherein, lanes 1-18 are PCR detection of reverse transcription products of different reverse transcriptase mutants, and M is a DNA molecular weight standard.

[0024] Figure 4 The results of reverse transcriptase thermal stability test; the upper figure is the electrophoresis test result of cDNA PCR obtained by reverse transcription of mutant No. 10 at different temperatures, and the lower figure is the Maxima control.

[0025] Figure 5 The figure is a schematic diagram of electrophoresis for detecting the processivity of mutant No. 10; lanes 1-3 are the detection results of the 3 kb, 6 kb, and l2 kb positions corresponding to mutant No. 10, and lanes 4-6 are the detection results of the 3 kb, 6 kb, and l2 kb positions corresponding to Maxima. DETAILED DESCRIPTION

[0026] The present invention obtains a reverse transcriptase variant by one or more amino acid mutations, and the reverse transcriptase exhibits changes in one or more activities and has significantly improved performance.

[0027] The present invention also provides a specific method for obtaining the reverse transcriptase mutant and expressing and purifying it, comprising the following steps: (1) Plasmid construction: The wild-type M-MLV reverse transcriptase (WT MMLV) sequence was obtained by gene synthesis based on gene CCA64130.1. The pET 28b (+) vector and the synthesized WT-MMLV (nucleotide sequence as shown in SEQ ID NO.03) were digested with restriction endonucleases Nhe I and EcoR I, and then ligated and inserted into the plasmid pET 28b (+) by T4 DNA ligase, so that the expression frame of WT MMLV was consistent with the histidine purification tag 6xHis purification tag on the vector. The construction of reverse transcriptase mutants used pET 28b-M-MLV as a template, designed primers at the preselected mutation position, and used Hieff Mut™ MultiSite-Directed Mutagenesis Kit to introduce the mutation point. The mutant expression vector was obtained according to the construction method of pET 28b-M-MLV, and the obtained mutants were sequenced and confirmed. A total of 18 mutant plasmids were obtained.

[0028] (2) Construction of recombinant expression strains: The constructed expression plasmids numbered 1-18 and wild-type pET28b-M-MLV (numbered 19) were mixed with Escherichia coli competent cells DH5a, incubated on ice for 15 min, heat-shocked at 42°C for 90 s, centrifuged and coated on Kana plates, and cultured at 37°C overnight; single clones were picked and cultured in 4 ml LB (Kana) at 30°C~40°C and 150~220 rpm in a shaker.

[0029] (3) Screening of mutants: The constructed recombinant expression strain was cultured at 30℃~40℃ until the OD value was 0.4~0.6, then IPTG with a final concentration of 0.2mM~0.8mM was added, and the expression was induced for 10~18 hours (h) at 150rpm~220rpm at 15~17℃; the cells were collected by centrifugation at 5000g for 10 minutes (min) at 4℃; the cells were fully resuspended with B-PER bacterial protein extraction reagent and allowed to stand, and then centrifuged at low temperature to obtain the supernatant, which was the crude extract of mutant enzymes; different crude extracts of mutant enzymes were detected by SDS-PAGE electrophoresis to observe whether the target protein was expressed; the crude extracts of mutant enzymes with protein expression were screened for reverse transcription activity at different temperatures: mouse liver total RNA was used as a template for reverse transcription reaction; the following reaction components were added to the reaction tube containing 1 ug of total RNA: 5X RT Buffer 4μL, Thermo Scientific RiboLockRNase Inhibitor (#EO0381) 0.5μL (20 U), dNTP Mix(10 mM each (#R0191)), 1μL Random Hexamer (#SO142), and 1μL crude extract of mutant enzyme, add Nuclease-free Water to the total volume to 20μL, react at 37℃~45℃; after the reaction is completed, incubate at 75℃~85℃ for 15s~30s to terminate the reaction, take 2μL reverse transcription product as template, use high-fidelity enzyme Kapa Hifi and specific primers of β-actin gene for PCR amplification, and then use 0.8% agarose gel electrophoresis to detect the amplification; if there is PCR amplification band, it is considered that the crude extract of mutant enzyme has reverse transcription activity.

[0030] (4) Protein induction expression: The mutant enzyme bacteria identified as positive were cultured at a ratio of 1:100 (1 ml bacterial solution, 100 ml LB containing kanamycin) at 37°C, 150 rpm~220 rpm, until the OD060 value was about 0.6~0.8; IPTG with a final concentration of 0.2 mM~0.8 mM was added to each bottle of LB culture medium, and the culture was induced at 15°C~17°C for about 10~18 h. After induction, the bacteria were collected by centrifugation at 5000g for 10 min-20 min at 4°C.

[0031] (5) Protein purification: Resuspend in 5-10 mL Binding / Wash Buffer, add 0.2 mg / mL lysozyme, 20 μg / mL DNase, 1 mM MgCl2, final concentration 1 mM PMSF (protease inhibitor), sonicate, centrifuge at 10000g~12000g for 20min~30min, collect the supernatant at 4℃, filter with 0.22um filter membrane and transfer to a new tube. Purify with nickel affinity resin, add equal volume of 100% glycerol to the purified solution, mix well, and store at 20℃. Ni affinity chromatography buffers are: equilibration buffer: 10~30 mM Tris-HCl, pH 7.5, 300~500 mM NaCl, 0.05% (v / v) NP-40, 5% glycerol; wash buffer: 10~30 mM imidazole, 10~30 mM Tris-HCl, pH7.5, 300~500 mM NaCl, 0.01% (v / v) NP-40, 5% glycerol: gradient elution buffer: 50~200 mM imidazole, 10~30 mM Tris-HCl, pH 7.5, 300~500 mM NaCl, 0.Ol% (v / v) NP-40, 5% glycerol.

[0032] The preparation method of the high-performance M-MLV reverse transcriptase described in the present invention, and its further preferred technical scheme is, step (3) screening of mutants: culturing the constructed recombinant expression strain at 37°C and 200 rpm to an OD value of 0.6, then adding IPTG with a final concentration of 0.4 mM, and inducing expression at 16°C and 200 rpm; collecting the bacteria by centrifugation; fully resuspending the bacteria with B-PER bacterial protein extraction reagent and standing at room temperature for 15 minutes, shaking and mixing for 1 minute, and then centrifuging to obtain the supernatant, which is the crude extract of the mutant enzyme; performing SDS-PAGE electrophoresis on different crude extracts of the mutant enzyme to observe whether the target protein is expressed.

[0033] The crude extracts of mutant enzymes identified as positive for protein expression were screened for reverse transcription activity at different temperatures (37℃~70℃): mouse liver total RNA was used as a template for reverse transcription reaction; the following reaction components were added to the reaction tube containing 1 ug of total RNA: 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25℃), 350 mM KCl, 12 mMMgCl2, 50 mM DTT) 4μL, Thermo Scientific RiboLock RNase Inhibitor (#EO0381) 0.5μL (20 U), dNTP Mix (10 mM each (#R0191)), 1μL Random Hexamer (#SO142), and 1μL crude extract of mutant enzymes ... The total volume was made up to 20 μL with water, and the reaction was carried out at different reaction temperatures of 37°C ~ 60°C. After the reaction was completed, the reaction was terminated by incubation at 75°C ~ 80°C for 15s ~ 30s, and 2 μL of the reverse transcription product was taken as a template for PCR amplification, and then the amplification was detected by 0.8% agarose gel electrophoresis. The observation of PCR amplification bands indicated that the crude extract had reverse transcription activity.

[0034] The method for preparing the high-performance M-MLV reverse transcriptase of the present invention is further preferably characterized in that, in the expression of the reverse transcriptase mutant in step (3): the mutant with a positive screening result is cultured in liquid LB to an OD value of 0.6, IPTG with a final concentration of 0.4 mM is added, and the culture is carried out at 16°C and 200 rpm for 16 h to induce protein expression; the culture solution after IPTG induction is centrifuged at 5000g for 10 min to collect the bacteria.

[0035] The method for preparing the high-performance M-MLV reverse transcriptase of the present invention further has a preferred technical solution that, in the purification of the reverse transcriptase mutant in step (4): the induced bacterial solution is centrifuged at 5000g for 10 min to collect the bacterial cells; resuspended in 8 mL Binding / Wash Buffer, 0.2 mg / mL lysozyme, 20 μg / mL DNase, 1 mM MgCl2, final concentration 1 mM PMSF (protease inhibitor) are added, ultrasonicated, centrifuged at 10000g for 20 min, supernatant is collected at 4°C, filtered with a 0.22um filter membrane, and transferred to a new tube. Purify with a Ni affinity chromatography purification column and collect in a single tube step by step, and perform SDS-PAGE electrophoresis detection.

[0036] The preparation method of the high-performance M-MLV reverse transcriptase of the present invention, and its further preferred technical scheme is that the following method is used to detect the activity of the M-MLV reverse transcriptase: the activity of the reverse transcriptase is determined by the isotope method; the system is as follows: 50Mm Tris-HCl, pH8.0, 20Mm NaCl, 10 mM MgCl2, 8mM DTT, 50 uM [3H] dTTP, luM template-primer mixture, the template-primer mixture consists of poly (A) and 16 units of oligo T, 1 pmol enzyme; add water to 30μL and incubate at 37°C for 10 min, add 20μL 0.5M EDTA to terminate the reaction; then determine the content of polydeoxyribonucleic acid by acid precipitation method, and determine the activity of the enzyme by the content of polydeoxyribonucleic acid; under 37°C, use Poly(A)-oligo (dT) as template / primer, and incorporate 1 within 10 min. The amount of enzyme required to convert nmol [3H]dTTP into acid-insoluble substances is defined as 1 activity unit.

[0037] The method for preparing the high-performance M-MLV reverse transcriptase of the present invention, and its further preferred technical scheme is to use the following method to detect the thermal stability of M-MLV reverse transcriptase: using mouse liver total RNA as a template, reverse transcription is performed at different temperatures; the following reaction components are added to the reaction tube containing the RNA template in order: 5X RT Buffer (200mM Tris-HCl (pH 8.3 at 25℃), 350mM KCl,12mM MgCl2, 50mM DTT) 4μL, ThermoScientific RiboLock RNase Inhibitor (#EO0381) 0.5μL (20U), dNTP Mix (10mMeach (#R0191)), 1μL Random Hexamer (#SO142) and 200U purified reverse transcriptase, using Nuclease-free The total volume was made up to 20 μL with water, and the reaction was carried out at different reaction temperatures of 37°C, 42°C, 45°C, 50°C, 55°C and 65°C for 20 min. After the reaction, the reaction was terminated by incubation at 85°C for 15 s. 2 μL of the reverse transcription product was used as the qPCR template, and TaqMan fluorescence quantitative PCR was performed using Taq-HSProbe qPCR Premix and a probe targeting the β-Actin gene. The situation of reverse transcription synthesis of cDNA was determined based on the amplification curve. The commercial reverse transcriptase Maxima was used as a control.

[0038] The method for preparing the high-performance M-MLV reverse transcriptase of the present invention, and its further preferred technical scheme is to use the following method to detect the synthesis length of M-MLV reverse transcriptase cDNA: reverse transcription is performed using total RNA extracted from human blood as a template, and the following reaction components are added in sequence to a reaction tube containing the RNA template: 5X RT Buffer (200 mMTris-HCl (pH 8.3 at 25°C), 350 mM KCl, 12 mM MgCl2, 50 mM DTT) 4 μL, ThermoScientific RiboLock RNase Inhibitor (#EO0381) 0.5 μL (20 U), dNTP Mix (10 mMeach (#R0191)), 1 μL Random Hexamer (#SO142) and 200 U purified reverse transcriptase, and the total volume is supplemented to 20 μL with Nuclease-free Water, and incubated at 85°C for 10 s to terminate the reaction; according to the human HERCl gene sequence, three pairs of specific primers were designed at the positions 3 kb, 6 kb and 12 kb away from the 5' end of its cDNA, and the theoretical length of the amplified fragment was 1 kb; the reverse transcription product was used as a template, and high-fidelity Kapa HiFi polymerase and the above three pairs of primers were used for PCR amplification and agarose gel electrophoresis detection, and the synthetic length of cDNA was determined according to the electrophoresis results; commercial reverse transcriptase Maxima was used as a control.

[0039] The transcriptase variants screened by the present invention can screen out highly thermostable M-MLV reverse transcriptases within a certain range, and the heat resistance is as high as 65°C, which is higher than the commercial M-MLV reverse transcriptase reported, and has great application value.

[0040] A large amount of experimental data of the high-performance M-MLV reverse transcriptase variant of the present invention shows that when the binding force between the reverse transcriptase and the substrate is improved, the thermal stability of the reverse transcriptase is also improved accordingly. This phenomenon also provides a theoretical basis for further improving other properties of the M-MLV reverse transcriptase.

[0041] In the present study, through sequence alignment of M-MLV reverse transcriptase and protein three-dimensional structure analysis, point mutation design was performed for the reported regional amino acids that can directly participate in substrate binding and combined with the loss or reduction of RNase H activity, and multiple mutants were constructed. Through identification and screening, a mutant No. 10 (Y133K, T306H, T330G, L435R) with improved thermal stability was obtained and successfully prepared in large quantities. This study shows that mutant No. 10 has a thermal stability of up to 65°C and can synthesize cDNA up to 11 kb, which has good application prospects. (200mM Tris-HCl (pH 8.3 at 25°C), 350 mM KCl,12 mM MgCl2, 50 mM DTT)

[0042] The reaction buffer of the reverse transcriptase of the present invention can not only maintain the optimal pH and ionic strength of the reaction, but also contains additives that improve the efficiency of reverse transcription; for example, Tris HCl can provide a stable buffer environment (pH 6.0-9.0), KCl2 can not only form a high-salt environment but also is not easy to react with other biologically active substances, and can protect the activity of reverse transcriptase to the greatest extent, MgCl2 can simultaneously increase the reverse transcriptase activity and DNA polymerase activity of the reverse transcriptase, and DTT is a reducing agent that is commonly used to provide the best enzyme activity. The purpose of the present invention is to provide a reverse transcriptase mutant with high reverse transcription efficiency, high temperature resistance, and strong continuous synthesis ability.

[0043] By means of the above technical scheme, the present invention has at least the following advantages and beneficial effects: (1) The present invention screens for reverse transcriptase mutants that are resistant to high temperatures and have high reverse transcription efficiency. (2) The reverse transcriptase mutants with high reverse transcription efficiency screened by the present invention have significantly improved amplification efficiency under the same conditions compared with the wild-type M-MLV enzyme, and thus can significantly improve the detection efficiency. (3) The present invention screens from a plurality of mutants and ultimately screens out a mutant of a reverse transcriptase that is resistant to high temperatures, which can still maintain a high reverse transcription efficiency at a reverse transcription temperature of 65°C, and has unexpectedly excellent effects. (4) Under high temperature conditions (65°C), compared with the wild type, the reverse transcription efficiency of the reverse transcriptase mutant of the present invention is increased by about 49 times, achieving unexpected technical effects.

[0044] The sequences involved in the present invention are: Super M-MLV amino acid sequence (SEQ ID NO.01)

[0045] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIILLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPKNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFDEALRRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGHAGFCRLWIPGFAEMAAPLYPLTKGGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVIRAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAQLIALTQALRMAEGKKLNVYTNSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITENPDTSTLLIENSSPNSRLIN

[0046] Wild-type M-MLV amino acid sequence (SEQ ID NO.02)

[0047] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIILLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFDEALRRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGTAGFCRLWIPGFAEMAAPLYPLTKTGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAQLIALTQALRMAEGKKLNVYTNSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITENPDTSTLLIENSSPNSRLIN

[0048] Gene-synthesized wild-type M-MLV nucleotide sequence (SEQ ID NO.03)

[0049]

[0050] Mouse B-actin specific primers: F:TGTGACGTTGACATCCGTAAAG(SEQ ID NO.04)

[0051] R:TCAGTAACAGTCCGCCTAGAA(SEQ ID NO.05)

[0052] Primer sequences of HERCl gene (SEQ ID NO.06~11)

[0053] HERCl-3kb-F:AGCACTGTGGCAGCGGCCAG (SEQ ID NO.06)

[0054] HERCl-3kb-R: GAAGAAATGTAATGGTACCT(SEQ ID NO.07)

[0055] HERCl-6kb-F: CAGCTTCTGCCAGCTGTCCAT(SEQ ID NO.08)

[0056] HERCl-6kb-R: CGCAGCAATGGTTCCTATGT (SEQ ID NO.09)

[0057] HERCl-12kb-F: ATAGCCCTGGCGGTTTGCACT(SEQ ID NO.10)

[0058] HERCl-12kb-R: CTGGTGTAGAAGATGATCAA(SEQ ID NO.11)

[0059] The technical solutions provided by the present invention are described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used can be obtained from commercial sources.

[0060] Example 1

[0061] This example describes the M-MLV reverse transcriptase mutant and its preparation method, as follows: 1 Materials and methods

[0062] 1.1 Experimental Materials

[0063] 1.1.1 Bacterial strains, plasmids and other biological materials

[0064] DH5a and BL21 (DE3) were purchased from Novozyme Biotechnology Co., Ltd., and plasmid pET-28b was purchased from Sangon Biotechnology Co., Ltd. Mouse liver RNA was extracted using Trizol, and tomato total RNA was extracted from leaf tissue using the EasyPurePlant RNA Kit from Beijing Quanshijin Company.

[0065] 1.1.2 Reagents Restriction endonucleases, T4 DNA Ligase, KOD Site-Directed Mutagenesis Kit, Taq-HS Probe qPCR Premix, antibiotics, IPTG, etc. were purchased from Novazon Biotechnology Co., Ltd.; Nuclease-free water, high-fidelity Kapa Hifi polymerase, Maxima reverse transcriptase, and B-PER Reagent were purchased from Thermofisher Scientific, DNA Marker and protein marker were purchased from Sangon Biotechnology Co., Ltd., and primer synthesis, probe synthesis, gene synthesis and sequencing were completed by Sangon Biotechnology Co., Ltd.

[0066] 1.2 Experimental methods

[0067] 1.2.1 Bioinformatics analysis The homologous sequence search of the wild-type M-MLV reverse transcriptase gene sequence (GenBank: CCA64130.1) was performed using the BLAST function of the National Center for Biotechnology Information (NCBI). Sequence analysis and alignment were performed using DNAstar software. The three-dimensional structure analysis was performed using PyMOL MoIecuIar Graphics System software.

[0068] 1.2.2 The gene sequence of wild-type M-MLV reverse transcriptase (GenBank: CCA64130.1) was obtained by gene synthesis. The synthetic sequence includes the NheI restriction site added at the 5' end and the TAA stop codon and EcoRI restriction site added at the 3' end. The pET-28b (+) vector and the synthesized WT-MMLV were digested and recovered with restriction endonucleases Nhe I and EcoR I, and then connected and inserted into the plasmid pET-28b (+) by T4 DNA ligase. The connected plasmid was transformed into competent cells DH5a, and the recombinant plasmid pET28b-M-MLV was extracted after amplification, and the sequence was confirmed to be correct by sequencing. The N-terminus of the reverse transcriptase produced after the plasmid was induced to express was fused with a 6xHis purification tag. The construction of reverse transcriptase mutants used plasmid pET28b-M-MLV as the original template, designed specific primers at the pre-selected mutation site, and introduced directed point mutations using the Hieff Mut™ Multi Site-Directed Mutagenesis Kit. The constructed mutant plasmid sequences were confirmed by sequencing.

[0069] 1.2.3 Screening of mutants

[0070] The constructed mutant and wild-type pET28b-M-MLV were cultured at 37°C until the OD value was 0.6, and then IPTG with a final concentration of 0.4 mM was added, and the cells were cultured at 16°C and 200 rpm to induce expression for 16 h; the cells were collected by centrifugation at 5000g for 10 min at 4°C; the cells were fully resuspended with B-PER bacterial protein extraction reagent and allowed to stand, and then centrifuged at low temperature to obtain the supernatant, which was the crude extract of the mutant enzyme; different crude extracts of the mutant enzymes were detected by SDS-PAGE electrophoresis to observe whether the target protein was expressed; the crude extracts of the mutant enzymes with protein expression were screened for reverse transcription activity at different temperatures: mouse liver total RNA was used as a template for reverse transcription reaction; the following reaction components were added to the reaction tube containing 1 ug of total RNA: 5X RTBuffer 4μL, Thermo Scientific RiboLock RNase Inhibitor (#EO0381) 0.5μL (20 U), dNTP Mix (10 mM each (#R0191)), 1 μL Random Hexamer (#SO142), and 1 μL crude extract of the mutant enzyme were added, and the total volume was supplemented to 20 μL with Nuclease-free Water, and the reaction was carried out at 42°C. After the reaction was completed, the reaction was terminated by incubation at 85°C for 15s, and 2 μL of the reverse transcription product was taken as a template. PCR amplification was performed using the high-fidelity enzyme Kapa Hifi and specific primers of the β-actin gene (SEQ ID NO.04~05), and then the amplification was detected by 0.8% agarose gel electrophoresis. If there was a PCR amplification band, the crude extract of the mutant enzyme was considered to have reverse transcription activity.

[0071] 1.2.4 Protein induction expression and purification

[0072] The mutant enzyme bacteria identified as positive were cultured at a ratio of 1:100 (1 ml bacterial solution, 100 ml LB containing kanamycin) at 37°C and 200 rpm until the OD060 value was about 0.6; IPTG with a final concentration of 0.4 mM was added to each bottle of LB medium, and the expression was induced at 16°C for 16 hours. After induction, the bacteria were collected by centrifugation at 5000g for 10 min at 4°C. Resuspended in 5 mL Binding / Wash Buffer, 0.2 mg / mL lysozyme, 20 μg / mL DNase, 1 mM MgCl2, and a final concentration of 1 mM PMSF (protease inhibitor) were added, sonicated, and centrifuged at 10000g~12000g for 20 minutes. The supernatant was collected at 4°C. Purified with nickel affinity resin, the purified solution was mixed with an equal volume of 100% glycerol, and stored at -20°C. Ni affinity chromatography buffers are: equilibration buffer: 10 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.05% (v / v) NP-40, 5% glycerol; wash buffer: 10 mM imidazole, 10 mM Tris-HCl, pH7.5, 500 mM NaCl, 0.01% (v / v) NP-40, 5% glycerol: gradient elution buffer: 100 mM imidazole, 20 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.01% (v / v) NP-40, 5% glycerol.

[0073] 2 Results

[0074] 2.1 Construction of M-MLV mutant clones

[0075] A total of 18 mutants and 1 wild-type M-MLV were obtained through mutant plasmid construction. The mutants were screened according to protein expression and reverse transcriptase activity. The results showed that mutants 2, 3, 6, 8, 10, and 18 successfully expressed reverse transcriptase protein and had reverse transcriptase activity. The main mutation points were Y133K, T306H, T330G, L435R and their combinations, as shown in Table 1 for details.

[0076] Table 1 List of reverse transcriptase mutant combinations

[0077] The sequence of wild-type M-MLV reverse transcriptase was obtained by gene synthesis and connected to the vector pET-28b to form a recombinant expression vector. The site mutation of the M-MLV reverse transcriptase mutant was based on the principle of site-directed mutagenesis, and was introduced one by one through specific mutation primers. The resulting recombinant expression vector (pET28b-M-MLV) produced a fusion protein with a 6xHis affinity purification tag (His Tag) at the N-terminus after induced expression. A total of 18 reverse transcriptase mutants were constructed.

[0078] 2.2 Screening of M-MLV reverse transcriptase mutants

[0079] The 18 mutants were screened by protein expression and reverse transcription activity identification, with wild-type M-MLV as a control. The results showed that 6 mutants successfully expressed M-MLV reverse transcriptase protein ( Figure 2 ); Under 37°C conditions, the reverse transcription products of the wild type and mutants 2, 3, 6, 8, 10, and 18 showed specific bands after PCR, indicating reverse transcription activity ( Figure 3 ).

[0080] Example 2

[0081] Performance testing of M-MLV reverse transcriptase mutants

[0082] 1. Reverse transcriptase thermal stability test

[0083] Reverse transcription was performed at 37°C-70°C using mouse liver total RNA as template. The following reaction components were added to the reaction tube containing RNA template in order: 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25°C), 350 mM KCl, 12 mM MgCl2, 50 mM DTT) 4 μL, Thermo Scientific RiboLock RNaseInhibitor (#EO0381) 0.5 μL (20 U), dNTP Mix (10 mM each (#R0191)), 1 μL RandomHexamer (#SO142) and 200 U purified reverse transcriptase. The total volume was made up to 20 μL with Nuclease-free Water. The reaction was performed at different reaction temperatures of 37°C, 42°C, 45°C, 50°C, 55°C, 60°C, 65°C, and 70°C for 20 min. min; after the reaction, incubate at 85℃ for 15s to terminate the reaction; use 2μL of reverse transcription product as PCR template, use reverse transcriptase variant 10 and PCR identification for β-Actin gene, and judge the situation of reverse transcription synthesis of cDNA according to electrophoresis bands; use commercial reverse transcriptase Maxima as control ( Figure 4 ).

[0084] 2. Reverse transcriptase cDNA synthesis length detection

[0085] Total RNA extracted from human blood was used as a template for reverse transcription. The following reaction components were added to the reaction tube containing the RNA template in order: 4 μL of 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25°C), 350 mM KCl, 12 mM MgCl2, 50 mM DTT), 0.5 μL (20 U) of Thermo Scientific RiboLock RNase Inhibitor (#EO0381), dNTP Mix (10 mM each (#R0191)), 1 μL of Random Hexamer (#SO142) and 200 U of purified reverse transcriptase. The total volume was made up to 20 μL with Nuclease-free Water and incubated at 85°C for 15 s to terminate the reaction. According to the human HERCl gene sequence, three pairs of specific primers (SEQ ID NO. 06~11) were designed at 3 kb, 6 kb and 12 kb away from the 5' end of its cDNA. ), the theoretical length of the amplified fragment was 1 kb; the reverse transcription product was used as a template, high-fidelity Kapa hifi polymerase and the above three pairs of primers were used for PCR amplification and agarose gel electrophoresis detection, and the synthetic length of cDNA was determined according to the electrophoresis results; the commercial reverse transcriptase Maxima was used as a control ( Figure 5 ).

[0086] 3 Results

[0087] 3.1 Reverse transcriptase thermal stability test results

[0088] According to the observation of the PCR electrophoresis of the reverse transcription products at different temperatures, the electrophoresis bands of mutant No. 10 did not change significantly under the conditions of 55℃~65℃, indicating that the cDNA amount of mutant No. 10 was basically the same at 55℃~65℃. However, under the same conditions, the electrophoresis bands of the commercial reverse transcriptase Maxima in the control group were quite different, and the electrophoresis bands were significantly weaker than those of mutant No. 10. This result shows that mutant No. 10 still has a high reverse transcription activity at 65℃ ( Figure 4 ).

[0089] 3.2 Reverse transcriptase cDNA synthesis length detection results

[0090] The electrophoresis test results were used to determine the length of the synthesized cDNA. The results showed that the cDNA length obtained by reverse transcription of mutant No. 10 could reach up to 12 kb, while the synthesis length of the control group commercial reverse transcriptase Maxima was only 6~7 kb. This result shows that mutant No. 10 can synthesize longer cDNA ( Figure 5 ).

[0091] Example 3

[0092] Detection of mouse β-actin gene using reverse transcription reaction system

[0093] Mouse liver total RNA was used as template and the RNA was divided into two groups according to the original and 10 -1 , 10 -3 , 10 -5 , 10 -6 , 10 -7 and 10 -8 The following reaction components were added to the reaction tube containing the diluted RNA template in order: 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25°C), 350 mMKCl, 12 mM MgCl2, 50 mM DTT) 4 μL, Thermo Scientific RiboLock RNase Inhibitor (#EO0381) 0.5 μL (20 U), dNTP Mix (10 mM each (#R0191)), 1 μL Random Hexamer (#SO142) and 200 U purified reverse transcriptase (No. 10), and the total volume was made up to 20 μL with Nuclease-free Water, and the reaction was carried out at 65°C for 20 minutes at different reaction temperatures. min; after the reaction, incubate at 85℃ for 15s to terminate the reaction; use 2μL of reverse transcription product as PCR template, reverse transcriptase variant No. 10 and primers targeting β-Actin gene for PCR, and judge the situation of reverse transcription synthesis of cDNA according to the electrophoresis band; use commercial reverse transcriptase Maxima as control.

[0094] The results showed that the detection limits of the 10th reverse transcriptase variant and Maxima were 10 -7 The dilution gradient was 10 -6 The dilution gradient shows that compared with Maxima, the reverse transcriptase provided by the patent of the present invention has a better effect on sample detection.

[0095] The above-described embodiments only express several implementation methods of the present invention, which are convenient for understanding the technical solution of the present invention in detail, but cannot be understood as limiting the scope of protection of the present invention. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the scope of protection of the present invention.

Claims

1. A mutant of M-MLV reverse transcriptase, characterized in that Compared with the amino acid sequence of the wild-type M-MLV reverse transcriptase, the amino acid sequence of the reverse transcriptase mutant has one or more of the following mutations: Y133K, T306H, T330G, L435R.

2. The M-MLV reverse transcriptase mutant according to claim 1, characterized in that: Compared with the amino acid sequence of the wild-type M-MLV reverse transcriptase, the amino acid sequence of the reverse transcriptase mutant has one of the following mutation combinations: Mutation combination 2: Y133K, T330G; Mutation combination 3: T306H, T330G; Mutation combination 6: Y133K, T306H, L435R; Mutation combination 8: Y133K, T330G, L435R; Mutation combination 10: Y133K, T306H, T330G, L435R; Mutation combination 18: Y133K, T306H, T330G.

3. The M-MLV reverse transcriptase mutant according to claim 1 or 2, characterized in that: The amino acid sequence of the wild-type M-MLV reverse transcriptase is shown in SEQ ID NO.

02.

4. The M-MLV reverse transcriptase mutant according to claim 3, characterized in that: The amino acid sequence of the M-MLV reverse transcriptase mutant is shown in SEQ ID NO.

01.

5. A coding gene, characterized in that The coding gene has a nucleotide sequence encoding the M-MLV reverse transcriptase mutant according to any one of claims 1-4.

6. Biomaterial, characterized in that The biological material is a recombinant plasmid or a recombinant bacterium, and the biological material has the coding gene according to claim 5.

7. The method for preparing the M-MLV reverse transcriptase mutant according to any one of claims 1 to 4, characterized in that: The method comprises the following steps: using the biological material according to claim 6 to express the M-MLV reverse transcriptase mutant.

8. Use of the M-MLV reverse transcriptase mutant according to any one of claims 1 to 4 in the preparation of a thermostable reagent; the thermostable reagent has biological activity at 65°C.

9. Use of the M-MLV reverse transcriptase mutant according to any one of claims 1 to 4 in a reverse transcription reaction.

10. The use according to claim 9, characterized in that: A reverse transcription inhibitor exists in the reverse transcription reaction, and the reverse transcription inhibitor is selected from at least one of guanidine salt, heparin or salt.

Images