Modulation of gene expression for gene therapy
Chimeric nucleic acids with enhancers like hTERT and SV40 enhance HSV-TK expression, addressing the challenge of low gene expression in gene therapy and improving cancer treatment efficacy.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-11-12
- Publication Date
- 2026-05-21
AI Technical Summary
Current gene therapy methods face challenges in achieving high expression of Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK), which is crucial for selective cytotoxicity in cancer treatment, and this issue is not limited to cancer therapies but is widespread in gene therapies.
The use of chimeric nucleic acids comprising enhancers such as human telomerase reverse transcriptase (hTERT), SV40, RSV, CMV, CAG, and HIF1 enhancers or their fragments to increase gene expression, including vectors encoding these enhancers and promoters linked to expressible genes, enhancing HSV-TK expression.
The chimeric nucleic acids significantly increase HSV-TK expression, improving the efficacy of gene therapy by increasing the cytotoxic effect on target cells, particularly in cancer treatment.
Smart Images

Figure US2025055060_21052026_PF_FP_ABST
Abstract
Description
[0001] Docket No. 10063-111WO1
[0002] MODULATION OF GENE EXPRESSION FOR GENE THERAPY CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U. S. Provisional Application No.
[0003] 63 / 719,435, filed November 12, 2024, which is incorporated by reference herein in its entirety.
[0004] REFERENCE TO SEQUENCE LISTING
[0005] The sequence listing submitted on November 12, 2025, as an. XML file entitled “10063-11 lW01_ST26.xml” created on November 11, 2025, and having a file size of 30,009 bytes is hereby incorporated by reference pursuant to 37 C. F. R. § 1.52(e)(5).
[0006] BACKGROUND
[0007] Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) is currently the most widely used suicide agent for gene therapy for cancer. HSV-TK can be used as a window of opportunity treatment before other therapies (e.g., radiotherapy, chemotherapy, immunotherapy, immune checkpoint blockade therapy, etc.). Briefly, expression of HSV-TK can catalyze the phosphorylation of certain antiviral agents (e.g., acyclovir) to a toxic form capable of inhibiting DNA synthesis, resulting in selective cytotoxicity towards cells expressing HSV-TK. However, it is difficult to achieve high expression of HSV-TK. Tills is an issue which is faced not only in this gene therapy, nor merely in gene therapies for cancer, but in numerous applications of gene therapy.
[0008] Thus, there exists a need for improved gene expression in gene therapy. Tills need and others are at least partially satisfied by the present disclosure.
[0009] SUMMARY
[0010] In an aspect, provided is a chimeric nucleic acid including any two or more enhancers selected from: a human telomerase reverse transcriptase (hTERT) enhancer or a fragment thereof, an SV40 enhancer or a fragment thereof, an RSV enhancer or a fragment thereof, a CMV enhancer or a fragment thereof, a CAG (chicken beta actin) enhancer or a fragment thereof, and a HIF1 enhancer or a fragment thereof.
[0011] In another aspect, provided is a chimeric nucleic acid including: a human telomerase reverse transcriptase (hTERT) enhancer or a fragment thereof; and an SV40 enhancer or a fragment thereof. Docket No. 10063-111WO1
[0012] In yet another aspect, provided is a vector encoding any of the disclosed chimeric nucleic acids.
[0013] In yet still another aspect, provided is a cell including any of the disclosed vectors. In yet still another aspect, provided is a method of increasing gene expression in a cell, the method including providing to the cell a vector encoding any two or more enhancers selected from: a human telomerase reverse transcriptase (hTERT) enhancer or a fragment thereof, an SV40 enhancer or a fragment thereof, an RSV enhancer or a fragment thereof, a CMV enhancer or a fragment thereof, a CAG (chicken beta actin) enhancer or a fragment thereof, and a H1F1 enhancer or a fragment thereof; and at least one promoter operably linked to at least one expressible gene; wherein the chimeric nucleic acid can increase expression of the at least one expressible gene.
[0014] In yet still another aspect, provided is a method of increasing gene expression in a cell, the method including providing to the cell a vector encoding: a chimeric nucleic acid including an hTERT enhancer or a fragment thereof and an SV40 enhancer or a fragment thereof; and at least one promoter operably linked to at least one expressible gene; wherein the chimeric nucleic acid can increase expression of the at least one expressible gene.
[0015] In yet still another aspect, provided is a method of treating and / or preventing a cancer in a subject, the method including: a) providing to the subject a vector encoding: a chimeric nucleic acid including an hTERT enhancer or a fragment thereof and an SV40 enhancer or a fragment thereof; and at least one promoter operably linked to Herpes Simplex Virus type 1 -thymidine kinase (HSV-TK) or a fragment thereof; wherein the chimeric nucleic acid can increase expression of HSV-TK or a fragment thereof; and b) providing to the subject an antiviral agent.
[0016] Other systems, methods, features and / or advantages will be or may become apparent to one with skill in the art upon examination of the following drawings and detailed description. It is intended that all such additional systems, methods, features and / or advantages be included within this description and be protected by the accompanying claims.
[0017] BRIEF DESCRIPTION OF DRAWINGS FIGURES 1A-1B depict the plasmid construct for screening a super enhancer and the enhancer activities. FIG. 1A shows a graph of the plasmid construct used to assess the enhancer activity with the pRSV promoter. FIG. IB shows that the 293T cells were transfected with different enhancer constructs including its full RSV enhancer as a benchmark. After one, three, Docket No. 10063-111WO1
[0018] and five days of transfection, the fluorescence intensity of GFP was measured and presented as mean fluorescence intensity (MFI). UBC-mCherry was used as an internal control.
[0019] FIGURE 2A shows quantifications and comparisons of levels of GFP fluorescence intensity measured in mCherry positive cells as indicated at various time points after transfection with hTERT, CAG, SV40, and original RSV enhancer elements in HEK293 cells.
[0020] FIGURE 2B shows mean fluorescence intensity (GFP) of the mutated tandem repeat (SV40 / hTERT) library after the transfection and selection of the stable expression clones of MCF-7 human breast cancer cells. FIGURE 2C shows mean fluorescence intensity of GFP in mCherry positive cells at indicated time points after transfection with RSV, tandem, and mutated enhancer in HEK293 cells.
[0021] FIGURES 3A-3C depict mean fluorescence intensity of GFP in mCherry positive cells at indicated time points after transfection. The tandem repeat point mutated enhancer clones and RSV enhancer were transfected into various tumor lines: MCF-7 (FIG. 3A), MDMB321 (FIG.3B), and HCT116 (FIG.3C). The GFP expressions (as MFI) standardized to endogenous control ubiquitous mCherry were compared.
[0022] FIGURE 4 depicts mean fluorescence intensity (GFP) of mutated tandem repeat (SV40 / hTERT) library after the transfection and selection of the stable expression clones of MCF-7 human breast cancer cells. The high expression clones were sorted from transfected cells and put in the single cells 96 well plate. The cloned cells were rerun, and the enhancer sequence region of each high expression clone underwent PCR and was sequenced.
[0023] FIGURES 5A-5C depict that HMR100 (ADV / 15-RSV-HSV-tk) with modified enhancer clone 15 improves tumor killing in vitro and in vivo. FIGS. 5A-5B show that E0771 mouse mammary tumor (FIG. 5A) and MDA-MB-231 human breast cancer (FIG. 5B) cell lines were transduced with adenovirus and treated with or without ganciclovir at 10 pg / ml for 48 hours. A repeat assay is also shown. FIG. 5C shows that adenovirus (IxlO9PFU / mouse) was injected intratumorally into E0771 orthotopic tumor engrafted in female C57BL / 6 mice on Day 10 latter after tumor developed. Ganciclovir (GCV) was administrated following virus injection for 10 days, and the tumor size was measured over the time after the viral injection.
[0024] FIGURES 6A-6F depict the similarity between different segments of several enhancers and many transcriptional factors. FIG.6A shows the selection of base pairs 130-170 of the hTERT enhancer. FIG. 6B shows the selection of base pairs 1-20, 60-80, 120-130, 160- 200, and 210-220 of the SV40 enhancer. FIG.6C shows the selection of base pairs 60-70, 160- 190, 210-220, 300-330, and 400-410 of the RSV short enhancer. FIG. 6D shows the selection of base pairs 304 bp of the CMV enhancer. FIG. 6E shows the selection of base pairs 20-40, Docket No. 10063-111WO1
[0025] 50-80, 90-120, 190-2.00, and 250-260 of the CAG enhancer. FIG. 6F shows the selection of base pairs 1-20, 50-80, and 160-180 of the HIF enhancer.
[0026] FIGURE 7 depicts adenoviral constructs A, B, and C for HSV-TK with RSV (construct A) vs. clone 15-RSV (construct B) and super enhancer (clone 15-SV40-hTERT, construct C).
[0027] FIGURES 8A-8C depict HSV-TK gene expression using the disclosed constructs. FIG. 8A shows HSV-TK gene expression from the Ad / RSV-HSV-TK vs. ADV / 15-RSV-TK vs. super-enhancer (15-SV40-hTERT) transduced SUM159 human breast cancer cell lines at MOI 500. The HSV-TK gene expression is confirmed by the RT-PCR. FIG. 8B shows a repeated experiment of HSV-TK gene expression from the Ad / RSV-HSV-TK vs. superenhancer (clone 15-SV40-hTERT) transduced SUM 159 human breast cancer cells line at various MOI. The HSV-TK gene expression is confirmed by RT-PCR. FIG. 8C shows tumor cell viability from Ad / RSV-TK vs. Ad / 15-SV40-hTERT / HSV-Tk transduced SUMI 59 breast Tumor cells at multiple MOI with / without GCV treatment in vitro.
[0028] FIGURES 9A-9B depict in vivo data using the disclosed constructs. FIG. 9A shows various adenovirus at dose 5x109PFU / mouse were injected intratumorally into E0771 orthotopic mammary tumor engrafted in female C57BL / 6 mice on Day 9 after tumor developed. Ganciclovir (GCV) or control PBS was administrated following virus injection for 10 days, and the tumor size was measured over the time after the viral injection. FIG. 9B shows LLC lung tumor bearing mice were injected with various enhancer adenovirus at dose 3x109VP / mouse, with / without GCV treatment. The tumor sizes were measured.
[0029] FIGURE 10 depicts adenoviral constructs with RSV enhancer (construct D) vs. super¬ enhancer (clone 15-SV40-hTERT, construct E) drive the HSV-TK and bifunctional antibody (anti-LILRB2-CD40L) expression.
[0030] FIGURES 11A-11B depict adenoviral constructs with either RSV enhancer or super¬ enhancer (clone 15-SV40-hTERT) drive the HSV-TK and bifunctional antibody (anti- LILRB2-CD40L) expression. The vector was transfected into 2793 cells the HSV-TK (FIG.
[0031] 11 A) vs. bifunctional antibody (FIG. 11B) gene expressions were detected and quantified by RT-PCR.
[0032] DETAILED DESCRIPTION
[0033] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate aspects, can also be provided in combination with a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, can also be provided separately or in any suitable subcombination. Unless Docket No. 10063-111WO1
[0034] defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure.
[0035] DEFINITIONS
[0036] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:
[0037] As used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by,” “comprising,” “comprises,” “comprised of,” “including,” “includes,” “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, nonlimiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of’ and “consisting of.” Similarly, the term “consisting essentially of’ is intended to include examples encompassed by the term “consisting of.
[0038] As used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound,” “a composition,” or “cancer” includes, but is not limited to, two or more such compounds, compositions, or cancers, and the like.
[0039] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It can be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it can be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.
[0040] When a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g., the phrase “x to y” includes the range from ‘x’ to ‘y’ as well as the range Docket No. 10063-111WO1
[0041] greater than ‘x’ and less than ‘y’. The range can also be expressed as an upper limit, e.g., ‘about x, y, z, or less’ and should be interpreted to include the specific ranges of ‘about x,’ ‘about y’, and ‘about z’ as well as the ranges of ‘less than x,’ less than y’, and ‘less than z’. Likewise, the phrase ‘about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘about x,’ ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x,’ greater than y’, and ‘greater than z.’ In addition, the phrase “about ‘x’ to ‘y’,” where ‘x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’.”
[0042] It is to be understood that such a range format is used for convenience and brevity and, thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “about 0.1% to 5%” should be interpreted to include not only the explicitly recited values of about 0.1 % to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the sub¬ ranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.
[0043] As used herein, the terms “about,” “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter, or other quantity or characteristic is “about,” “approximate,” or “at or about,” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.
[0044] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired modification of a physical property of the composition or material. For example, an “effective amount” of a monomer refers to an amount that is sufficient to achieve Docket No. 10063-111WO1
[0045] the desired improvement in the property modulated by the formulation component, e.g., desired antioxidant release rate or viscoelasticity. 'The specific level in terms of wt% in a composition required as an effective amount will depend upon a variety of factors, including the amount and type of monomer, amount and type of polymer, e.g., acrylamide, amount of antioxidant, and desired release kinetics.
[0046] As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors, including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors within the knowledge and expertise of the health practitioner and which may be well known in the medical arts. In the case of treating a particular disease or condition, in some instances, the desired response can be inhibiting the progression of the disease or condition. This may involve only slowing the progression of the disease temporarily. However, in other instances, it may be desirable to halt the progression of the disease permanently. Tills can be monitored by routine diagnostic methods known to one of ordinary skill in the art for any particular disease. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.
[0047] For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single-dose compositions can contain such amounts or submultiples thereof to make up the daily dose. 'The dosage can be adjusted by the individual physician in the event of any contraindications. It is generally preferred that a maximum dose of the pharmacological agents of the invention (alone or in combination with other therapeutic agents) be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons, or for virtually any other reasons.
[0048] A response to a therapeutically effective dose of a disclosed drug delivery composition can be measured by determining the physiological effects of the treatment or medication, such Docket No. 10063-111WO1
[0049] as the decrease or lack of disease symptoms following administration of the treatment or pharmacological agent. Other assays will be known to one of ordinary skill in the art and can be employed for measuring the level of the response. The amount of a treatment may be varied, for example, by increasing or decreasing the amount of a disclosed compound and / or pharmaceutical composition, by changing the disclosed compound and / or pharmaceutical composition administered, by changing the route of administration, by changing the dosage timing, and so on. Dosage can vary and can be administered in one or more dose administrations daily for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
[0050] As used herein, the term “prophylactically effective amount” refers to an amount effective for preventing onset or initiation of a disease or condition.
[0051] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit, or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.
[0052] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0053] As used interchangeably herein, “subject,” “individual,” or “patient” can refer to a vertebrate organism, such as a mammal (e,g., human). " Subject" can also refer to a cell, a population of cells, a tissue, an organ, or an organism, preferably to human and constituents thereof.
[0054] As used herein, the terms "treating" and "treatment" can refer generally to obtaining a desired pharmacological and / or physiological effect. The effect can be, but does not necessarily have to be, prophylactic in terms of preventing or partially preventing a disease, symptom, or condition thereof. The effect can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom, or adverse effect attributed to the disease, disorder, or condition. The term "treatment" as used herein can include any treatment of a disease or disorder in a subject, particularly a human, and can include any one or more of the following: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., mitigating or ameliorating the disease and / or its symptoms or conditions. The term "treatment," as used herein, can refer to both therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of Docket No. 10063-111WO1
[0055] treatment (subjects in need thereof) can include those already with the disorder and / or those in which the disorder is to be prevented. As used herein, the term "treating" can include inhibiting the disease, disorder, or condition, e.g., impeding its progress, and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder, and / or condition. Treating the disease, disorder, or condition can include ameliorating at least one symptom of the particular disease, disorder, or condition, even if the underlying pathophysiology is not affected, e.g., such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.
[0056] As used herein, “dose,” “unit dose,” or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of a disclosed compound and / or a pharmaceutical composition thereof calculated to produce the desired response or responses in association with its administration.
[0057] As used herein, “therapeutic” can refer to treating, healing, and / or ameliorating a disease, disorder, condition, or side effect or to decreasing the rate of advancement of a disease, disorder, condition, or side effect.
[0058] As used herein, the term “nucleic acid” or “nucleic acid sequence” refers to the order or sequence of nucleotides along a strand of nucleic acids. In some cases, the order of these nucleotides may determine the order of the amino acids along a corresponding polypeptide chain. The nucleic acid sequence thus codes for the amino acid sequence. The nucleic acid sequence may be single-stranded or double-stranded, as specified, or contain portions of both double-stranded and single-stranded sequences. The nucleic acid sequence may be composed of DNA, both genomic and cDNA, RNA, or a hybrid, where the sequence comprises any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil (U), adenine (A), thymine (T), cytosine (C), guanine (G), inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc. It may include modified bases, including locked nucleic acids, peptide nucleic acids, and others known to those skilled in the art.
[0059] As used herein, the term “cell” includes progeny. It is also understood that all progenies may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that have the same function or biological property, as screened for in the originally transformed cell, are included. The “cells” referred to in the present invention generally are prokaryotic or eukaryotic hosts.
[0060] As used herein, the term “gene” refers to a segment of DNA arranged in a linear manner along a chromosome, which codes for a specific protein or segment of protein. A gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally Docket No. 10063-111WO1
[0061] introns, and a 3' untranslated region. The gene may further comprise a terminator, enhancers and / or silencers. In some aspects, the gene may be “mutated,” which refers to the replacement, absence, or presence of additional nucleic acids as compared to a control gene. In some aspects, the gene may be “abnormal,” which refers to an atypical presentation of a gene as compared to a control gene. In some aspects, the mutation or abnormality may have a negative effect on the expression of the gene.
[0062] As used herein, the term “functional fragment” refers to any partial segment of a protein or nucleic acid sequence which at least partially retains the capability to perform a function or a part of a function of the full protein or full nucleic acid sequence. The functional fragment can be capable of performing multiple functions of the full protein or full nucleic acid sequence, a single function of the full protein or full nucleic acid sequence, or a part of one or more functions of the full protein or full nucleic acid sequence.
[0063] Antibodies
[0064] The term “antibodies” is used herein in a broad sense and includes both polyclonal and monoclonal antibodies. In addition to intact immunoglobulin molecules, also included in the term “antibodies” are fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules or fragments thereof. The antibodies can be tested for their desired activity using the in vitro assays described herein, or by analogous methods, after which their in vivo therapeutic and / or prophylactic activities are tested according to known clinical testing methods. There are five major classes of human immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgG-1, IgG-2, IgG-3, and IgG-4; IgA-1 and IgA-2. One skilled in the art would recognize the comparable classes for mouse. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively.
[0065] The term “monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules. The monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular' species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another Docket No. 10063-111WO1
[0066] species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity.
[0067] The disclosed monoclonal antibodies can be made using any procedure which produces mono clonal antibodies. For example, disclosed monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 2.56:495 (1975). In a hybridoma method, a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro.
[0068] The monoclonal antibodies may also be made by recombinant DNA methods. DNA encoding the disclosed monoclonal antibodies can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Libraries of antibodies or active antibody fragments can also be generated and screened using phage display¬ techniques, e.g., as described in U. S. Patent No. 5,804,440 to Burton et al. and U. S. Patent No.
[0069] 6,096,441 to Barbas et al.
[0070] In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described in WO 94 / 29348 published Dec. 22, 1994 and U. S. Pat. No. 4,342,566. Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen.
[0071] As used herein, the term “antibody or fragments thereof’ encompasses chimeric antibodies and hybrid antibodies, with dual or multiple antigen or epitope specificities, and fragments, such as F(ab’)2, Fab’, Fab, Fv, sFv, scFv, VHH (i.e., nanobodies) diabodies,, and the like, including hybrid fragments. Thus, fragments of the antibodies that retain the ability to bind their specific antigens are provided. For example, fragments of antibodies which maintain binding activity are included within the meaning of the term “antibody or fragment thereof.” Such antibodies and fragments can be made by techniques known in the ait and can be screened for specificity and activity according to the methods set forth in the Examples and in general methods for producing antibodies and screening antibodies for specificity and activity (See Docket No. 10063-111WO1
[0072] Harlow and Lane. Antibodies, A Laboratory Manual. Cold Spring Harbor Publications, New York, (1988)).
[0073] Also included within the meaning of “antibody or fragments thereof” are conjugates of antibody fragments and antigen binding proteins (single chain antibodies).
[0074] The fragments, whether attached to other sequences or not, can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the antibody or antibody fragment is not significantly- altered or impaired compared to the non-modified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove / add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the antibody or antibody fragment must possess a bioactive property, such as specific binding to its cognate antigen. Functional or active regions of the antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed byexpression and testing of the expressed polypeptide. Such methods are readily apparent to a skilled practitioner in the art and can include site-specific mutagenesis of the nucleic acid encoding the antibody or antibody fragment. (Zoller, M.. T. Curr. Opin. Biotechnol. 3:348-354, 1992).
[0075] As used herein, the term “antibody” or “antibodies” can also refer to a human antibody and / or a humanized antibody. Many non-human antibodies (e.g., those derived from mice, rats, or rabbits) are naturally antigenic in humans, and thus can give rise to undesirable immune responses when administered to humans. Therefore, the use of human or humanized antibodies in the methods serves to lessen the chance that an antibody administered to a human will evoke an undesirable immune response.
[0076] CHIMERIC NUCLEIC ACIDS
[0077] In an aspect, provided is a chimeric nucleic acid including any two or more enhancers selected from: a human telomerase reverse transcriptase (hTERT) enhancer or a fragment thereof, an SV40 enhancer or a fragment thereof, an RSV enhancer or a fragment thereof, a CMV enhancer or a fragment thereof, a CAG (chicken beta actin) enhancer or a fragment thereof, and a HIF1 enhancer or a fragment thereof. In another aspect, provided is a chimeric nucleic acid including: a human telomerase reverse transcriptase (hTERT) enhancer or a fragment thereof; and an SV40 enhancer or a fragment thereof.
[0078] In some aspects, the chimeric nucleic acid can include DNA. In other aspects, the chimeric nucleic acid can include RNA. In yet other aspects, the chimeric nucleic acid can include DNA, RNA, and / or modified nucleotides, or any combination of these. The chimeric Docket No. 10063-111WO1
[0079] nucleic acid can be double-stranded, single-stranded, or a combination of double- and single¬ stranded. The chimeric nucleic acid can optionally further include one or more linkers (for example, for separating the enhancers).
[0080] The terms “nucleic acid” and “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of genomic or synthetic origin (which may be single-stranded or double-stranded and may represent the sense or the antisense strand).
[0081] Variants comprising deletions relative to a reference nucleotide sequence are contemplated herein. A “deletion” refers to a change in the nucleotide sequence that results in the absence of one or more nucleotides relative to a reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 nucleotides. A deletion may include an internal deletion or a terminal deletion (e.g., a 5 '-terminal or 3 '-terminal truncation or both of a reference polynucleotide).
[0082] Variants comprising a fragment of a reference nucleotide sequence are contemplated herein. A “fragment” is a portion of a nucleotide sequence which is identical in sequence to but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides of a reference polynucleotide. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides of a reference polynucleotide. Fragments may be preferentially selected from certain regions of a molecule, for example the 5'-terminal region and / or the 3' terminal region of a polynucleotide. The term “at least a fragment” encompasses the full length polynucleotide.
[0083] Variants comprising insertions or additions relative to a reference sequence are contemplated herein. The words “insertion” and “addition” refer to changes in nucleotide sequence resulting in the addition of one or more nucleotides. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 nucleotides.
[0084] Fusion polynucleotides also are contemplated herein. A fusion polynucleotide refers to the fusion of the nucleotide sequence of a first polynucleotide to the nucleotide sequence of a second heterologous polynucleotide (e.g., the 3' end of a first polynucleotide to a 5' end of the second polynucleotide). Where the first and second polynucleotides encode proteins, the fusion may be such that the encoded proteins are in-frame and results in a fusion protein. The first and second polynucleotide may be fused such that the first and second polynucleotide are operably- linked (e.g., as a promoter and a gene expressed by the promoter). Docket No. 10063-111WO1
[0085] The term “chimeric construct” or “chimeric gene” or “chimeric polynucleotide” or “chimeric nucleic acid” (or similar terms) as used herein refers to a construct or molecule comprising two or more polynucleotides of different origin assembled into a single nucleic acid molecule. The term “chimeric construct”, “chimeric gene”, “chimeric polynucleotide” or “chimeric nucleic acid” refers to any construct or molecule that contains, without limitation, (1) polynucleotides (e.g., DNA), including regulatory and coding polynucleotides that are not found together in nature ( i. e., at least one of the polynucleotides in the construct is heterologous with respect to at least one of its other polynucleotides), or (2) polynucleotides encoding parts of proteins not naturally adjoined, or (3) parts of promoters that are not naturally adjoined. Further, a chimeric construct, chimeric gene, chimeric polynucleotide or chimeric nucleic acid may comprise regulatory polynucleotides and coding polynucleotides that are derived from different sources, or comprise regulatory polynucleotides and coding polynucleotides derived from the same source, but arranged in a manner different from that found in nature.
[0086] “Homology” refers to sequence similarity or, interchangeably, sequence identity, between two or more polynucleotide sequences. Homology, sequence similarity, and percentage sequence identity may be determined using methods in the art and described herein.
[0087] The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U. S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403 410), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI website. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed above). Docket No. 10063-111WO1
[0088] Percent identity may be measured over the length of an entire defined polynucleotide sequence or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length may be used to describe a length over which percentage identity may be measured.
[0089] A “full length” polynucleotide sequence is one containing at least a translation initiation codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length” polynucleotide sequence encodes a “full length” polypeptide sequence.
[0090] A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences -a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide.
[0091] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences due to the degeneracy of the genetic code. It is understood that changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that all encode substantially the same protein.
[0092] “Operably linked” refers to the situation in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be in close proximity or contiguous and, where necessary to join two protein coding regions, in the same reading frame.
[0093] A “recombinant nucleic acid” is a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two or more otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1 3, Cold Spring Harbor Press, Plainview N. Y. Docket No. 10063-111WO1
[0094] The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid. Frequently, a recombinant nucleic acid may include a nucleic acid sequence operably linked to a promoter sequence. Such a recombinant nucleic acid may be part of a vector that is used, for example, to transform a cell.
[0095] “Transformation” describes a process by which exogenous DNA is introduced into a recipient cell. Transformation may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method for transformation is selected based on the type of host cell being transformed and may include, but is not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, and particle bombardment. The term “transformed cells” includes stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome, as well as transiently transformed cells which express the inserted DNA or RNA for limited periods of time.
[0096] “Substantially isolated or purified” nucleic acid sequences are contemplated herein. The term “substantially isolated or purified” refers to nucleic acid sequences that are removed from their natural environment, and are at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which they are naturally associated.
[0097] The term “downstream” refers to a nucleotide sequence that is located 3’ to reference nucleotide sequence. The term “upstream” refers to a nucleotide sequence that is located 5’ to reference nucleotide sequence.
[0098] In some aspects, the chimeric nucleic acid can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88%’ similarity or more, 89%’ similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 1. In some aspects, the chimeric nucleic acid can include SEQ ID NO: 1. In some aspects, the chimeric nucleic acid can consist of SEQ ID NO: 1.
[0099] In some aspects, the chimeric nucleic acid can include 50% similarity or more (e.g., 5 % similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or Docket No. 10063-111WO1
[0100] more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 2. In some aspects, the chimeric nucleic acid can include SEQ ID NO: 2. In some aspects, the chimeric nucleic acid can consist of SEQ ID NO: 2.
[0101] In some aspects, the chimeric nucleic acid can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 3. In some aspects, the chimeric nucleic acid can include SEQ ID NO: 3. In some aspects, the chimeric nucleic acid can consist of SEQ ID NO: 3.
[0102] In some aspects, the chimeric nucleic acid can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 4. In some aspects, the chimeric nucleic acid can include SEQ ID NO: 4. In some aspects, the chimeric nucleic acid can consist of SEQ ID NO: 4.
[0103] In some aspects, the chimeric nucleic acid can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81%’ similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or Docket No. 10063-111WO1
[0104] more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 5. In some aspects, the chimeric nucleic acid can include SEQ ID NO: 5. In some aspects, the chimeric nucleic acid can consist of SEQ ID NO: 5.
[0105] In some aspects, the chimeric nucleic acid can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82%’ similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 6. In some aspects, the chimeric nucleic acid can include SEQ ID NO: 6. In some aspects, the chimeric nucleic acid can consist of SEQ ID NO: 6.
[0106] In some aspects, the chimeric nucleic acid can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81 ’ similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 7. In some aspects, the chimeric nucleic acid can include SEQ ID NO: 7. In some aspects, the chimeric nucleic acid can consist of SEQ ID NO: 7.
[0107] Enhancers
[0108] As used herein, the term “enhancer” refers to a region of a nucleic acid sequence, for example a DNA sequence, which activates or increases the expression or a target gene encoded by said nucleic acid sequence. Enhancers can be bound by transcription factors, which serve to facilitate the acti vation or increased expression of the target gene. An enhancer may have any orientation, distance, or location relative to the target gene. Further discussion of the mechanism, structure, and features of enhancers is provided in Panigrahi, A. et al., Mechanisms of enhancer action: the known and the unknown. Genome Biol 22, 108 (2021), which is hereby incorporated by reference in its entirety. Docket No. 10063-111WO1
[0109] In some aspects, the hTERT enhancer or the fragment thereof can include at least a portion of SEQ ID NO: 8, SEQ ID NO: 18, SEQ ID NO: 19 or a variant thereof. In some aspects, the SV40 enhancer can include at least a portion of SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or a variant thereof.
[0110] In some aspects, the chimeric nucleic acid can include one or more mutations to the hTERT enhancer or the fragment thereof and / or the SV40 enhancer or the fragment thereof.
[0111] In some aspects, the hTERT enhancer or the fragment thereof can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 8, SEQ ID NO: 18, or SEQ ID NO: 19.
[0112] In some aspects, the SV40 enhancer or the fragment thereof can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
[0113] In some aspects, the hTERT enhancer or the fragment thereof can be upstream of the SV40 enhancer or the fragment thereof. In other aspects, the SV40 enhancer or the fragment thereof can be upstream of the hTERT enhancer or the fragment thereof.
[0114] In some aspects, the hTERT enhancer or the fragment thereof can be immediately adjacent to the SV40 enhancer or the fragment thereof. In other aspects, the hTERT enhancer or the fragment thereof and the SV40 enhancer or the fragment thereof can be separated by a linker.
[0115] In some aspects, the linker can include at least 1 nucleotide (e.g., at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 Docket No. 10063-111WO1
[0116] nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides). In some aspects, the linker can include up to 20 nucleotides (e.g., up to 19 nucleotides, up to 18 nucleotides, up to 17 nucleotides, up to 16 nucleotides, up to 15 nucleotides, up to 14 nucleotides, up to 13 nucleotides, up to 12 nucleotides, up to 11 nucleotides, up to 10 nucleotides, up to 9 nucleotides, up to 8 nucleotides, up to 7 nucleotides, up to 6 nucleotides, up to 5 nucleotides, up to 4 nucleotides, up to 3 nucleotides, up to 2 nucleotides, up to 1 nucleotide).
[0117] It is considered that the linker can include a number of nucleotides ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the linker can include from 1 nucleotide to 20 nucleotides (e.g., from 2 nucleotides to 19 nucleotides, from 3 nucleotides to 18 nucleotides, from 4 nucleotides to 17 nucleotides, from 5 nucleotides to 16 nucleotides, from 6 nucleotides to 15 nucleotides, from 7 nucleotides to 14 nucleotides, from 8 nucleotides to 13 nucleotides, from 9 nucleotides to 12 nucleotides, from 10 nucleotides to 11 nucleotides, from 1 nucleotide to 11 nucleotides, from 2 nucleotides to 10 nucleotides, from 3 nucleotides to 9 nucleotides, from 4 nucleotides to 8 nucleotides, from 5 nucleotides to 7 nucleotides, from 10 nucleotides to 20 nucleotides, from 11 nucleotides to 19 nucleotides, from 12 nucleotides to 18 nucleotides, from 13 nucleotides to 17 nucleotides, from 14 nucleotides to 16 nucleotides).
[0118] In some aspects, the chimeric nucleic acid can further include multiple copies of the hTERT enhancer or fragments thereof, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the hTERT enhancer or fragments thereof. In some such aspects, each copy of the hTERT enhancer or fragment thereof can be the same. In other such aspects, each copy of the hTERT enhancer or fragment thereof can be different. Additionally or alternatively, in other aspects, the chimeric nucleic acid can further include multiple copies of the SV40 enhancer or fragments thereof, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the SV40 enhancer or fragments thereof. In some such aspects, each copy of the SV40 enhancer or fragment thereof can be the same. In other such aspects, each copy of the SV40 enhancer or fragment thereof can be different.
[0119] In some aspects, the chimeric nucleic acid can include multiple copies of the hTERT enhancer or fragments thereof and multiple copies of SV40 enhancer or fragments thereof, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the hTERT enhancer or fragments thereof, and 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the SV40 enhancer or fragments thereof.
[0120] In some aspects, the chimeric nucleic acid can include a first SV40 enhancer fragment, a first hTERT enhancer fragment, a second SV40 enhancer or fragment thereof, and a second Docket No. 10063-111WO1
[0121] hTERT enhancer or fragment thereof. In some aspects, the first SV40 enhancer fragment, the first hTERT enhancer fragment, the second SV40 enhancer or fragment thereof, and the second hTERT enhancer or fragment thereof can be present in any multiplicity and in any arrangement in order, optionally including linkers between any two enhancers or fragments thereof (for example, any of the linkers described herein).
[0122] In some aspects, the first SV40 enhancer fragment can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 16.
[0123] In some aspects, the first hTERT enhancer fragment can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 18.
[0124] In some aspects, the second SV40 enhancer or fragment thereof can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80%’ similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89'2 similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 15.
[0125] In some aspects, the second hTERT enhancer or fragment thereof can include 50% similarity or more (e.g., 55% similarity or more, 60% similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% Docket No. 10063-111WO1
[0126] similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 8.
[0127] In some aspects, the first SV40 enhancer fragment and the hTERT enhancer fragment can include 0%’ similarity or more (e.g., 55% similarity or more, 60%’ similarity or more, 65% similarity or more, 70% similarity or more, 75% similarity or more, 80% similarity or more, 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87%’ similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to any one of SEQ ID NOs: 1-7.
[0128] In some aspects, the chimeric nucleic acid can further include an RSV enhancer or a fragment thereof, a CMV enhancer or a fragment thereof, a CAG (chicken beta actin) enhancer or a fragment thereof, a HIF1 enhancer or a fragment thereof, or any combination thereof. In some aspects, the RSV enhancer or the fragment thereof can include at least a portion of the sequence SEQ ID NO: 10 or a variant thereof. In some aspects, the CMV enhancer can include at least a portion of the sequence SEQ ID NO: 11 or a variant thereof. In some aspects, the CAG enhancer or the fragment thereof can include at least a portion of the sequence SEQ ID NO: 12 or a variant thereof. In some aspects, the HIF1 enhancer can include at least a portion of the sequence SEQ ID NO: 13 or a variant thereof.
[0129] In some aspects, the chimeric nucleic acid can include one or more mutations to the RSV enhancer or the fragment thereof, the CMV enhancer or the fragment thereof, the CAG enhancer or the fragment thereof, and / or the HIF1 enhancer or the fragment thereof.
[0130] In some aspects, the enhancers present (e.g., the hTERT enhancer or the fragment thereof, the SV40 enhancer or the fragment thereof, the RSV enhancer or the fragment thereof, the CMV enhancer or the fragment thereof, the CAG enhancer or the fragment thereof, and / or the HIF1 enhancer or the fragment thereof) can be present in any multiplicity and in any arrangement and order.
[0131] In some aspects, the chimeric nucleic acid can further include multiple copies of each enhancer, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of each enhancer. In some such aspects, Docket No. 10063-111WO1
[0132] each copy of each enhancer can be the same. In other such aspects, each copy of each enhancer can be different.
[0133] In some aspects, any two enhancers may be immediately adjacent. Additionally or alternatively, in other aspects, any two enhancers may be separated by a linker. In some aspects, the linker can include at least 1 nucleotide (e.g., at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides). In some aspects, the linker can include up to 20 nucleotides (e.g., up to 19 nucleotides, up to 18 nucleotides, up to 17 nucleotides, up to 16 nucleotides, up to 15 nucleotides, up to 14 nucleotides, up to 13 nucleotides, up to 12 nucleotides, up to 11 nucleotides, up to 10 nucleotides, up to 9 nucleotides, up to 8 nucleotides, up to 7 nucleotides, up to 6 nucleotides, up to 5 nucleotides, up to 4 nucleotides, up to 3 nucleotides, up to 2 nucleotides, up to 1 nucleotide).
[0134] It is considered that the linker can include a number of nucleotides ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the linker can include from 1 nucleotide to 20 nucleotides (e.g., from 2 nucleotides to 19 nucleotides, from 3 nucleotides to 18 nucleotides, from 4 nucleotides to 17 nucleotides, from 5 nucleotides to 16 nucleotides, from 6 nucleotides to 15 nucleotides, from 7 nucleotides to 14 nucleotides, from 8 nucleotides to 13 nucleotides, from 9 nucleotides to 12 nucleotides, from 10 nucleotides to 11 nucleotides, from 1 nucleotide to 11 nucleotides, from 2 nucleotides to 10 nucleotides, from 3 nucleotides to 9 nucleotides, from 4 nucleotides to 8 nucleotides, from 5 nucleotides to 7 nucleotides, from 10 nucleotides to 20 nucleotides, from 11 nucleotides to 19 nucleotides, from 12 nucleotides to 18 nucleotides, from 13 nucleotides to 17 nucleotides, from 14 nucleotides to 16 nucleotides).
[0135] In some aspects, one or more of the enhancers (e.g., the hTERT enhancer or the fragment thereof, the SV40 enhancer or the fragment thereof, the RSV enhancer or the fragment thereof, the CMV enhancer or the fragment thereof, the CAG enhancer or the fragment thereof, and / or the HIF1 enhancer or the fragment thereof) can be bound to transcription factors which are highly expressed in diseased or abnormal cells. For example, in some aspects, one or more of the enhancers can be bound to transcription factors which are highly expressed in cancerous and / or tumor cells. Docket No. 10063-111WO1
[0136] Vectors
[0137] In another aspect, provided is a vector encoding any of the disclosed chimeric nucleic acids. As used herein, the term “vector” refers to any moiety which can deliver a nucleic acid sequence into a cell or virus so that the nucleic acid sequence can be replicated and / or expressed by the cell or virus. In some aspects, the vector can be any suitable in vivo gene expression vector. In some aspects, the vector can be a viral vector. For example, in some aspects, the vector can be an adenovirus vector. As used herein, the term “adenovirus,” abbreviated “Ad,” refers to viruses of the adenoviridae family. Adenovirus is a medium-sized (90-100 nm), nonenveloped icosahedral virus containing double-stranded DNA. The term “adenoviridae” refers collectively to adenoviruses of the genera Atadenovirus, Aviadenovirus, Ichtadenovirus, Mastadenovirus, and Siadenovirus. “Adenovirus” includes, but is not limited to human, bovine, ovine, equine, canine, porcine, murine and simian adenovirus species. Human adenoviruses, i.e., adenoviruses that can infect humans, can be classified into subgenera, or species, A-G. Similarly, the term “adenovirus vector” or “adenoviral vector” refers to an adenovirus containing, in the genome thereof, a sequence other than the intrinsic base sequence of the adenovirus, for example any of the disclosed nucleic acids.
[0138] In other such aspects, the vector can be a retroviral vector. The term “retroviral vector” refers to a vector containing structural and functional genetic elements that are primarily derived from a retrovirus.
[0139] In yet other such aspects, the vector can be a lentiviral vector. The term “lentiviral vector” refers to a vector including one or more nucleic acid sequences derived from at least a portion of a lentivirus genome.
[0140] In some aspects, the vector can be a plasmid. The term “plasmid” refers to an extra chromosomal element often carrying a gene that is not part of the central metabolism of the cell, for example any of the disclosed nucleic acids, and usually in the form of circular doublestranded DNA molecules.
[0141] In some aspects, the vector can be a cosmid. In some aspects, the vector can be an artificial chromosome. In another aspect, provided is a vehicle (e.g., lipid nanoparticle) including any of the disclosed vectors.
[0142] In some aspects, the vector may further encode at least one promoter operably linked to at least one expressible gene. In some aspects, the at least one promoter can include an hTERT promoter or a fragment thereof, an SV40 promoter or a fragment thereof, an RSV promoter or a fragment thereof, a CMV promoter or a fragment thereof, a CAG (chicken beta Docket No. 10063-111WO1
[0143] actin) promoter or a fragment thereof, a HIF1 promoter or a fragment thereof, an EFl alpha promoter or a fragment thereof, an NFAT promoter or a fragment thereof, or any combination thereof. Additionally or alternatively, in some aspects, the at least one promoter can include any DNA sequence which has a high binding affinity for RNA polymerase and / or transcriptional factors, leading to more frequent initiation of transcription which results in a high rate of gene transcription and, therefore, a high level of gene expression.
[0144] In some aspects, the at least one expressible gene can encode a fluorescent protein. In some aspects, the at least one expressible gene can be a therapeutic gene or encode a therapeutic protein. In some aspects, the at least one expressible gene can encode an enzyme for gene-directed enzyme prodrug therapy or a fragment thereof. Gene-directed enzyme prodrug therapy, as well as examples of enzymes which may be encoded by the at least one expressible gene, is described in further detail in Denny WA. Prodrugs for Gene-Directed Enzyme-Prodrug Therapy (Suicide Gene Therapy). J Biomed Biotechnol. 2003;2003(1):48-70. doi: 10.1155 / S1110724303209098. PMID: 12686722; PMCID: PMC179761, which is incorporated by reference herein in its entirety. For example, in some specific aspects, the at least one expressible gene can encode cytosine deaminase (CD) to activate nontoxic prodrugs with 5-fluorocytosine (5-FC). In other specific aspects, the at least one expressible gene can encode purine nucleoside phosphorylase (PNP) or a fragment thereof for activating 6-methylpurine deoxyriboside. In yet other specific aspects, the at least one expressible gene can encode cyto-chrome P450 (CYP) or a fragment thereof for activating cyclophosphamide (CPA).
[0145] In yet still other specific aspects, the at least one expressible gene can encode Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) or a fragment thereof. In some such aspects, the at least one expressible gene can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92%’ similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 14. In some aspects, the at least one expressible gene can include SEQ ID NO: 14. In some aspects, the at least one expressible gene can consist of SEQ ID NO: 14.
[0146] In some aspects, the at least one expressible gene can encode an immune checkpoint inhibitor. In some such aspects, the immune checkpoint can include an antibody or a fragment thereof that blocks PD-1 (such as, for example, Nivolumab (BMS-936558 or MDX1106), Docket No. 10063-111WO1
[0147] pembrolizumab, cemiplimab, CT-011, MK-3475), PD-L1 (such as, for example, atezolizumab, avelumab, durvalumab, MDX-1105 (BMS-936559), MPDL3280A, or MSB0010718C), PD-L2 (such as, for example, rHIgM12B7), CTLA-4 (such as, for example, Ipilimumab (MDX-010), Tremelimumab (CP-675,206)), IDO, B7-H3 (such as, for example, MGA271, MGD009, omburtamab), B7-H4, B7-H3, T cell immunoreceptor with Ig and ITIM domains (TIGIT) (such as, for example BMS-986207, OMP-313M32, MK-7684, AB-154, ASP-8374, MTIG7192A, or PVSRIPO), CD96, B- and T-lymphocyte attenuator (BTLA), V-domain Ig suppressor of T cell activation (VISTA)(such as, for example, JNJ-61610588, CA-170), TIM1, 3 (such as, for example, TSR-022, MBG453, Sym023, INCAGN2390, LY3321367, BMS-986258, SHR-1702, RO7121661), LAG-3 (such as, for example, BMS-986016, LAG525, MK-4280, REGN3767, TSR-033, BI754111, Sym022, FS118, MGD013, and Immutep), LILRB1, 2, 3, 4, 5, CD47, SIRP-aipha ( signal regulatory protein alpha), TREM-1, TREM-2, Vimentin, EpCAM, or any fragments or combinations thereof.
[0148] In some aspects, the at least one expressible gene can include a costimulatory molecule. In some such aspects, the costimulatory molecule can include an antibody or a fragment thereof that binds to CD28, B7, ICOS, CD226, CRT AM, 41-BB, 0X40, CD27, GITR, HVEM, CD40, BAFFR, BAFF, LAG3, TREM-2, TIM-3, or any fragments or combinations thereof.
[0149] In some aspects, the at least one expressible gene can include a bifunctional antibody. In some such aspects, the bifunctional antibody can include a first portion including an immune checkpoint inhibitor and a second portion that binds to a costimulatory molecule. For example, in some specific aspects, the at least one expressible gene can include a bifunctional antibody that binds to LILRB2 and CD40.
[0150] In some aspects, the at least one expressible gene can include one or more components for gene knockdown, gene knockout, or gene editing, for example, siRNA, guide RNA, endonucleases (e.g., Cas9), or any fragments or combinations thereof.
[0151] In some aspects, the at least one expressible gene can include one or more chemokines, cytokines, or a combination thereof.
[0152] In another aspect, provided is a cell including any of the disclosed vectors. In some aspects, the cell can have been transfected with any of the disclosed vectors. In some aspects, the cell can deliver any of the disclosed vectors to another cell or virus. In some aspects, the cell can be a bacterium, a yeast, an archaeon, or another prokaryotic or single-celled organism. In some aspects, the cell can be a mesenchymal stem cell, an induced pluripotent stem cell, or an embryonic stem cell. In some aspects, the cell can be naturally occurring within a subject. Docket No. 10063-111WO1
[0153] In some aspects, provided is a cell component (e.g., exosome) including any of the disclosed vectors.
[0154] In some aspects, the cell can be human. In some aspects, the cell can be healthy. In other aspects, the cell can be diseased or abnormal. In some aspects, the cell can be cancerous. In some aspects, the cell can be, but is not limited to, a hematologic cancer cell, a lymphoma cell, a colorectal cancer cell, a colon cancer cell, a lung cancer cell, a head and neck cancer cell, an ovarian cancer cell, a prostate cancer cell, a testicular cancer cell, a renal cancer cell, a skin cancer cell, a cervical cancer cell, a brain cancer cell, a pancreatic cancer cell, or a breast cancer cell. In some aspects, the cell can be derived from a solid tumor. In other aspects, the cell can be derived from acute myeloid leukemia, myelodysplastic syndrome, chronic myeloid leukemia, acute lymphoblastic leukemia, myelofibrosis, or multiple myeloma. In yet other aspects, the cell can be derived from a leukemia, a lymphoma, a sarcoma, or a carcinoma, any of which may originate in the marrow, brain, lung, breast, pancreas, liver, head and neck, skin, reproductive tract, prostate, colon, liver, kidney, intraperitoneum, bone, joint, or eye.
[0155] In some aspects, the cell can be infected. In some aspects, the cell can be derived from a subject having an autoimmune disease or disorder, a neurological disease or disorder, or a metabolic disease or disorder.
[0156] METHODS
[0157] In an aspect, provided is a method of increasing gene expression in a cell, the method including providing to the cell a vector encoding any two or more enhancers selected from: a human telomerase reverse transcriptase (hTERT) enhancer or a fragment thereof, an SV40 enhancer or a fragment thereof, an RSV enhancer or a fragment thereof, a CMV enhancer or a fragment thereof, a CAG (chicken beta actin) enhancer or a fragment thereof, and a HIF1 enhancer or a fragment thereof; and at least one promoter operably linked to at least one expressible gene; wherein the chimeric nucleic acid can increase expression of the at least one expressible gene.
[0158] In another aspect, provided is a method of increasing gene expression in a cell, the method including providing to the cell a vector encoding: a chimeric nucleic acid including an hTERT enhancer or a fragment thereof and an SV40 enhancer or a fragment thereof; and at least one promoter operably linked to at least one expressible gene; wherein the chimeric nucleic acid can increase expression of the at least one expressible gene.
[0159] In some aspects, the chimeric nucleic acid can be any of the disclosed chimeric nucleic acids as described above.
[0160] 9 Docket No. 10063-111WO1
[0161] In some aspects, the vector can be an adenovirus vector. In some aspects, the vector can be a plasmid. In some aspects, the vector can be a viral vector. In some aspects, the vector can be a cosmid. In some aspects, the vector can be an artificial chromosome. In some aspects, the vector can be any other suitable in vivo gene expression vector. In some aspects, the vector can be any of the disclosed vectors. In some aspects, the vector can be provided to the cell via a vehicle (e.g., lipid nanoparticle).
[0162] In some aspects, the vector may further encode at least one promoter operably linked to at least one expressible gene. In some aspects, the at least one promoter can include an RSV promoter or a fragment thereof.
[0163] In some aspects, the at least one expressible gene can encode a fluorescent protein. In some aspects, the at least one expressible gene can be a therapeutic gene or encode a therapeutic protein. In some aspects, the at least one expressible gene can encode an enzyme for gene-directed enzyme prodrug therapy or a fragment thereof. Gene-directed enzyme prodrug therapy, as well as examples of enzymes which may be encoded by the at least one expressible gene, is described in further detail in Denny WA. Prodrugs for Gene-Directed Enzyme-Prodrug Therapy (Suicide Gene Therapy). J Biomed Biotechnol. 2003;2003(1):48-70. doi: 10.1155 / S1110724303209098. PMID: 12686722; PMCID: PMC179761, which is incorporated by reference herein in its entirety. For example, in some specific aspects, the at least one expressible gene can encode cytosine deaminase (CD) to activate nontoxic prodrugs with 5-fluorocytosine (5-FC). In other specific aspects, the at least one expressible gene can encode purine nucleoside phosphorylase (PNP) for activating 6-methylpurine deoxyriboside. In yet other specific aspects, the at least one expressible gene can encode cyto-chrome P450 (CYP) for activating cyclophosphamide (CPA).
[0164] In yet still other specific aspects, the at least one expressible gene can encode Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) or a fragment thereof. In some such aspects, the at least one expressible gene can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more) to SEQ ID NO: 14. In some aspects, the at least one expressible gene can include SEQ ID NO: 14. In some aspects, the at least one expressible gene can consist of SEQ ID NO: 14. Docket No. 10063-111WO1
[0165] In some aspects, the at least one expressible gene can encode an immune checkpoint inhibitor. In some such aspects, the immune checkpoint can include an antibody or a fragment thereof that blocks PD-1 (such as, for example, Nivolumab (BMS-936558 or MDX1106), pembrolizumab, cemiplimab, CT-011, MK-3475), PD-L1 (such as, for example, atezolizumab, avelumab, durvalumab, MDX-1105 (BMS-936559), MPDL3280A, or MSB0010718C), PD-L2 (such as, for example, rHIgM12B7), CTLA-4 (such as, for example, Ipilimumab (MDX-010), Tremelimumab (CP-675,206)), IDO, B7-H3 (such as, for example, MGA271, MGD009, omburtamab), B7-H4, B7-H3, T cell immunoreceptor with 1g and H IM domains (1’IGIT) (such as, for example BMS-986207, OMP-313M32, MK-7684, AB-154, ASP-8374, MTIG7192A, or PVSRIPO), CD96, B- and T-lymphocyte attenuator (BTLA), V-domain Ig suppressor of T cell activation (VISTA)(such as, for example, JNJ-61610588, CA-170), TIM3 (such as, for example, TSR-022, MBG453, Sym023, INCAGN2390, LY3321367, B MS-986258, SHR-1702, RO7121661), LAG-3 (such as, for example, BMS-986016, LAG525, MK-4280, REGN3767, TSR-033, BI754111, Sym022, FS118, MGD013, and Immutep), LILRB2, or any fragments or combinations thereof.
[0166] In some aspects, the at least one expressible gene can include a costimulatory molecule. In some such aspects, the costimulatory molecule can include an antibody or a fragment thereof that binds to CD28, B7, ICOS, CD226, CRT AM, 41-BB, 0X40, CD27, GITR, HVEM, CD40, LAG3, TREM-2, TIM-3, BAFFR, B AFF, or any fragments or combinations thereof.
[0167] In some aspects, the at least one expressible gene can include a bifunctional antibody. In some such aspects, the bifunctional antibody can include a first portion including an immune checkpoint inhibitor and a second portion that binds to a costimulatory molecule. For example, in some specific aspects, the at least one expressible gene can include a bifunctional antibody that binds to LILRB2 and CD40.
[0168] In some aspects, the cell can be a bacterium, a yeast, an archaeon, or another prokaryotic or single-celled organism. In some aspects, the cell can be a mesenchymal stem cell, an induced pluripotent stem cell, or an embryonic stem cell. In some aspects, the cell can be naturally occurring within a subject. In some aspects, provided is a cell component (e.g., exosome) including any of the disclosed vectors.
[0169] In some aspects, the cell can be human. In some aspects, the cell can be healthy. In other aspects, the cell can be diseased or abnormal. In some aspects, the cell can be cancerous. In some aspects, the cell can be, but is not limited to, a hematologic cancer cell, a lymphoma cell, a colorectal cancer cell, a colon cancer cell, a lung cancer cell, a head and neck cancer cell, an ovarian cancer cell, a prostate cancer cell, a testicular cancer cell, a renal cancer cell, a Docket No. 10063-111WO1
[0170] skin cancer cell, a cervical cancer cell, a brain cancer cell, a pancreatic cancer cell, or a breast cancer cell. In some aspects, the cell can be derived from a solid tumor. In other aspects, the cell can be derived from acute myeloid leukemia, myelodysplastic syndrome, chronic myeloid leukemia, acute lymphoblastic leukemia, myelofibrosis, or multiple myeloma. In yet other aspects, the cell can be derived from a leukemia, a lymphoma, a sarcoma, or a carcinoma, any of which may originate in the marrow, brain, lung, breast, pancreas, liver, head and neck, skin, reproductive tract, prostate, colon, liver, kidney, intraperitoneum, bone, joint, or eye.
[0171] In some aspects, the cell can be infected. In some aspects, the cell can be derived from a subject having an autoimmune disease or disorder, a neurological disease or disorder, or a metabolic disease or disorder.
[0172] In some aspects, the method can be carried out in vitro, in vivo, or ex vivo.
[0173] In another aspect, provided is a method of treating and / or preventing a cancer in a subject, the method including: a) providing to the subject a vector encoding: a chimeric nucleic acid including an hTERT enhancer or a fragment thereof and an SV40 enhancer or a fragment thereof; and at least one promoter operably linked to Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) or a fragment thereof; wherein the chimeric nucleic acid can increase expression of HSV-TK or a fragment thereof; and b) providing to the subject an antiviral agent.
[0174] Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) is currently the most widely used suicide agent for gene therapy for cancer. HSV-TK can be used as a window of opportunity treatment before other therapies (e.g., radiotherapy, chemotherapy, immunotherapy, immune checkpoint blockade therapy, etc.). Briefly, expression of HSV-TK can catalyze the phosphorylation of certain antiviral agents (e.g., acyclovir) to a toxic form capable of inhibiting DNA synthesis, resulting in selective cytotoxicity towards cells expressing HSV-TK. Further discussion of this treatment is provided in Sun, K. et al., A Phase 2 Trial of Enhancing Immune Checkpoint Blockade by Stereotactic Radiation and In situ Virus Gene 'Therapy in Metastatic 'Triple-Negative Breast Cancer. Clin Cancer Res 28, 20 (2022), which is hereby incorporated by reference in its entirety.
[0175] In some aspects, the antiviral agent can be acyclovir, ganciclovir, valacyclovir, penciclovir, famciclovir, any other suitable drugs or prodrugs which can be activated by HSV-TK or a fragment thereof, or any combination thereof.
[0176] In some aspects, the chimeric nucleic acid can be any of the disclosed chimeric nucleic acids as described above.
[0177] In some aspects, the vector can be an adenovirus vector. In some aspects, the vector can be a plasmid. In some aspects, the vector can be a viral vector. In some aspects, the vector can Docket No. 10063-111WO1
[0178] be a cosmid. In some aspects, the vector can be an artificial chromosome. In some aspects, the vector can be any other suitable in vivo gene expression vector. In some aspects, the vector can be any of the disclosed vectors. In some aspects, the vector can be provided to the cell via a vehicle (e.g., lipid nanoparticle).
[0179] In some aspects, the at least one promoter can include an RSV promoter or a fragment thereof.
[0180] In some aspects, the subject can have hematologic cancer, lymphoma, colorectal cancer, colon cancer, lung cancer, head and neck cancer, an ovarian cancer, prostate cancer, testicular cancer, renal cancer, skin cancer, cervical cancer, brain cancer, pancreatic cancer, or breast cancer. In some aspects, the subject can have a solid tumor. In other aspects, the subject can have acute myeloid leukemia, myelodysplastic syndrome, chronic myeloid leukemia, acute lymphoblastic leukemia, myelofibrosis, or multiple myeloma. In yet other aspects, the subject can have leukemia, lymphoma, sarcoma, or carcinoma, any of which may originate in the marrow, brain, lung, breast, pancreas, liver, head and neck, skin, reproductive tract, prostate, colon, liver, kidney, intraperitoneum, bone, joint, or eye.
[0181] In some aspects, the method can further include: c) providing to the subject an anticancer agent. In some aspects, the anti-cancer agent can include radiotherapy, chemotherapy, immunotherapy, immune checkpoint blockade therapy, or any combination thereof.
[0182] As an example, the anti-cancer agent can include Abemaciclib, Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Afatinib Dimaleate, Afinitor (Everolimus), Akynzeo (Netupitant and Palonosetron Hydrochloride), Aldara (Imiquimod), Aldesleukin, Alecensa (Alectinib), Alectinib, Alemtuzumab, Alimta (Pemetrexed Disodium), Aliqopa (Copanlisib Hydrochloride), Alkeran for Injection (Melphalan Hydrochloride), Alkeran Tablets (Melphalan), Aloxi (Palonosetron Hydrochloride), Alunbrig (Brigatinib), Ambochlorin (Chlorambucil), Amboclorin Chlorambucil), Amifostine, Aminolevulinic Acid, Anastrozole, Aprepitant, Aredia (Pamidronate Disodium), Arimidex (Anastrozole), Aromasin (Exemestane), Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Atezolizumab, Avastin (Bevacizumab), Avelumab, Axitinib, Azacitidine, Bavencio (Avelumab), BEACOPP, Becenum (Carmustine), Beleodaq (Belinostat), Belinostat, Bendamustine Hydrochloride, BEP, Besponsa (Inotuzumab Ozogamicin), Bevacizumab, Bexarotene, Bexxar (Tositumomab and Iodine I 131 Tositumomab), Bicalutamide, BiCNU Docket No. 10063-111WO1
[0183] (Carmustine), Bleomycin, Blinatumomab, Blincyto (Blinatumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab Vedotin, Brigatinib, BuMel, Busulfan, Busulfex (Busulfan), Cabazitaxel, Cabometyx (Cabozantinib-S-Malate), Cabozantinib-S-Malate, CAP, Campath (Alemtuzumab), Camptosar, (Irinotecan Hydrochloride), Capecitabine, CAPOX, Carac (Fluorouracil-Topical), Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, Cannubris (Carmustine), Carmustine, Camiustine Implant, Casodex (Bicalutamide), CEM, Ceritinib, Cerubidine (Daunorubicin Hydrochloride), Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, CEV, Chlorambucil, CHLORAMBUCIL -PREDNISONE, CHOP, Cisplatin, Cladribine, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clofarabine), Clolar (Clofarabine), CMF, Cobimetinib, Cometriq (Cabozantinib-S-Malate), Copanlisib Hydrochloride, COPDAC, COPP, COPP-ABV, Cosmegen (Dactinomycin), Cotellic (Cobimetinib), Crizotinib, CVP, Cyclophosphamide, Cyfos (Ifosfamide), Cyramza (Ramucirumab), Cytarabine, Cytarabine Liposome, Cytosar-U (Cytarabine), Cytoxan (Cyclophosphamide), Dabrafenib, Dacarbazine, Dacogen (Decitabine), Dactinomycin, Daratumumab, Darzalex (Daratumumab), Dasatinib, Daunorubicin Hydrochloride, Daunorubicin Hydrochloride and Cytarabine Liposome, Decitabine, Defibrotide Sodium, Defitelio (Defibrotide Sodium), Degarelix, Denileukin Diftitox, Denosumab, DepoCyt (Cytarabine Liposome), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), DTIC-Dome (Dacarbazine), Durvalumab, Efudex (Fluorouracil-Topical), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Elotuzumab, Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Empliciti (Elotuzumab), Enasidenib Mesylate, Enzalutamide, Epirubicin Hydrochloride, EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib Hydrochloride, Erwinaze (Asparaginase Erwinia chrysanthemi), Ethyol (Amifostine), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista, (Raloxifene Hydrochloride), Evomela (Melphalan Hydrochloride), Exemestane, 5-FU (Fluorouracil Injection), 5-FU (Fluorouracil-Topical), Fareston (Toremifene), Farydak (Panobinostat), Faslodex (Fulvestrant), FEC, Femara (Letrozole), Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil-Topical), Fluorouracil Injection, Fluorouracil-Topical, Flutamide, Folex (Methotrexate), Folex PFS (Methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRI-CETUXIMAB, FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (Recombinant HPV Quadrivalent Vaccine), Docket No. 10063-111WO1
[0184] Gardasil 9 (Recombinant HPV Nonavalent Vaccine), Gazyva (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, GEMCITABINEOXALIPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine Hydrochloride), Gilotrif (Afatinib Dimaleate), Gleevec (Imatinib Mesylate), Gliadel (Carmustine Implant), Gliadel wafer (Carmustine Implant), Glucarpidase, Goserelin Acetate, Halaven (Eribulin Mesylate), Hemangeol (Propranolol Hydrochloride), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine, Recombinant, Hycamtin (Topotecan Hydrochloride), Hydrea (Hydroxyurea), Hydroxyurea, Hyper-CVAD, Ibrance (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, Iclusig (Ponatinib Hydrochloride), Idamycin (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Idhifa (Enasidenib Mesylate), Ifex (Ifosfamide), Ifosfamide, Ifosfamiduni (Ifosfamide), IL-2 (Aldesleukin), Imatinib Mesylate, Imbruvica (Ibrutinib), Imfinzi (Durvalumab), Imiquimod, Imlygic (Talimogene Laherparepvec), Inlyta (Axitinib), Inotuzumab Ozogamicin, Interferon Alfa-2b, Recombinant, Interleukin-2 (Aldesleukin), Intron A (Recombinant Interferon Alfa-2b), Iodine I 131 Tositumomab and Tositumomab, Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Irinotecan Hydrochloride Liposome, Istodax (Romidepsin), Ixabepilone, Ixazomib Citrate, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), JEB, Jevtana (Cabazitaxel), Kadcyla (Ado-Trastuzumab Emtansine), Keoxifene (Raloxifene Hydrochloride), Kepivance (Palifermin), Keytruda (Pembrolizumab), Kisqali (Ribociclib), Kymriah (Tisagenlecleucel), Kyprolis (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Lartruvo (Olaratumab), Lenalidomide, Lenvatinib Mesylate, Lenvima (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Leustatin (Cladribine), Levulan (Aminolevulinic Acid), Linfolizin (Chlorambucil), LipoDox (Doxorubicin Hydrochloride Liposome), Lomustine, Lonsurf (Trifluridine and Tipiracil Hydrochloride), Lupron (Leuprolide Acetate), Lupron Depot (Leuprolide Acetate), Lupron Depot-Ped (Leuprolide Acetate), Lynparza (Olaparib), Marqibo (Vincristine Sulfate Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megestrol Acetate, Mekinist (Trametinib), Melphalan, Melphalan Hydrochloride, Mercaptopurine, Mesna, Mesnex (Mesna), Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF (Methotrexate), Methylnaltrexone Bromide, Mexate (Methotrexate), Mexate-AQ (Methotrexate), Midostaurin, Mitomycin C, Mitoxantrone Hydrochloride, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mustargen (Mechlorethamine Hydrochloride), Mutamycin (Mitomycin C), Myleran (Busulfan), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Docket No. 10063-111WO1
[0185] Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Necitumumab, Nelarabine, Neosar (Cyclophosphamide), Neratinib Maleate, Nerlynx (Neratinib Maleate), Netupitant and Palonosetron Hydrochloride, Neulasta (Pegfilgrastim), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilandron (Nilutamide), Nilotinib, Nilutamide, Ninlaro (Ixazomib Citrate), Niraparib Tosylate Monohydrate, Nivolumab, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Obinutuzumab, Odomzo (Sonidegib), OEPA, Ofatumumab, OFF, Olaparib, Olaratumab, Omacetaxine Mepesuccinate, Oncaspar (Pegaspargase), Ondansetron Hydrochloride, Onivyde (Irinotecan Hydrochloride Liposome), Ontak (Denileukin Diftitox), Opdivo (Nivolumab), OPPA, Osimertinib, Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, PAD, Palbociclib, Palifermin, Palonosetron Hydrochloride, Palonosetron Hydrochloride and Netupitant, Pamidronate Disodium, Panitumumab, Panobinostat, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pazopanib Hydrochloride, PCV, PEB, Pegaspargase, Pegfilgrastim, Peginterferon Alfa-2b, PEG-Intron (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Platinol (Cisplatin), Platinol-AQ (Cisplatin), Plerixafor, Pomalidomide, Pomalyst (Pomalidomide), Ponatinib Hydrochloride, Portrazza (Necitumumab), Pralatrexate, Prednisone, Procarbazine Hydrochloride, Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Propranolol Hydrochloride, Provenge (Sipuleucel-T), Purinethol (Mercaptopurine), Purixan (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, R-CHOP, R-CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, Relistor (Methylnaltrexone Bromide), R-EPOCH, Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Ribociclib, R-ICE, Rituxan (Rituximab), Rituxan Hycela (Rituximab and Hyaluronidase Human), Rituximab, Rituximab and, Hyaluronidase Human,, Rolapitant Hydrochloride, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Rubraca (Rucaparib Camsylate), Rucaparib Camsylate, Ruxolitinib Phosphate, Rydapt (Midostaurin), Sclerosol Intrapleural Aerosol (Talc), Siltuximab, Sipuleucel-T, Somatuline Depot (Lanreotide Acetate), Sonidegib, Sorafenib Tosylate, Sprycel (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sutent (Sunitinib Malate), Sylatron (Peginterferon Alfa-2b), Sylvant (Siltuximab), Synribo (Omacetaxine Mepesuccinate), Tabloid (Thioguanine), TAG, Tafinlar (Dabrafenib), Tagrisso (Osimertinib), Talc, Talimogene Laherparepvec, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Docket No. 10063-111WO1
[0186] Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Taxol (Paclitaxel), Taxotere (Docetaxel), Tecentriq (Atezolizumab), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid (Thalidomide), Thioguanine, Thiotepa, Tisagenlecleucel, Tolak (Fluorouracil-Topical), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Tositumomab and Iodine I 131 Tositumomab, Totect (Dexrazoxane Hydrochloride), TPF, Trabectedin, Trametinib, Trastuzumab, Treanda (Bendamustine Hydrochloride), Trifluridine and Tipiracil Hydrochloride, Trisenox ( Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Unituxin (Dinutuximab), Uridine Triacetate, VAC, Vandetanib, VAMP, Varubi (Rolapitant Hydrochloride), Vectibix (Panitumumab), VelP, Velban (Vinblastine Sulfate), Velcade (Bortezomib), Velsar (Vinblastine Sulfate), Vemurafenib, Venclexta (Venetoclax), Venetoclax, Verzenio (Abemaciclib), Viadur (Leuprolide Acetate), Vidaza (Azacitidine), Vinblastine Sulfate, Vincasar PFS (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, VIP, Vismodegib, Vistogard (Uridine Triacetate), Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Vyxeos (Daunorubicin Hydrochloride and Cytarabine Liposome), Wellcovorin (Leucovorin Calcium), Xalkori (Crizotinib), Xeloda (Capecitabine), XELIRI, XELOX, Xgeva (Denosumab), Xofigo (Radium 223 Dichloride), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Yondelis (Trabectedin), Zaltrap (Ziv-Aflibercept), Zarxio (Filgrastim), Zejula (Niraparib Tosylate Monohydrate), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv-Aflibercept, Zofran (Ondansetron Hydrochloride), Zoladex (Goserelin Acetate), Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), Zydelig (Idelalisib), Zykadia (Ceritinib), and / or Zytiga (Abiraterone Acetate).
[0187] As yet another example, in yet other aspects, the anti-cancer agent can be a PD1 / PDL1 blockade inhibitors (such as, for example, lambrolizumab, nivolumab, pembrolizumab, pidilizumab, BMS-936559, Atezolizumab, Durvalumab, or Avelumab).
[0188] In some aspects, the vector can increase the efficacy of the anti-cancer agent.
[0189] EXAMPLES
[0190] Example 1
[0191] Disclosed herein is a “super enhancer,” a combination of enhancers with much stronger and longer activity than commonly used enhancers, including RSV, CMV, GAG, and hTERT. Enhancers are DNA-regulatory elements that activate transcription of a gene or genes to higher levels than would be the case in their absence. This enhancer could be used in any viral vector or plasmid for higher and more persistent gene expression. In gene therapy, it would allow for Docket No. 10063-111WO1
[0192] a lower dose of vector. The super enhancer differs from commonly used enhancers by several point mutations.
[0193] There is an ongoing clinical trial with the Herpes Simplex Virus type 1 (HSV)-thymidine kinase (TK) adenovirus, which includes the RSV enhancer and promoter without the super enhancer. HSV-TK is currently the most widely used suicide agent for gene therapy for cancer. HSV-TK can be used in stereotactic body radiation therapy (SBRT) and in situ oncolytic virus therapy as a window of opportunity treatment before pembrolizumab in patients with metastatic triple negative breast cancer (TNBC) and metastatic non-small cell lung cancer (NSCLC). In situ oncolytic virus therapy includes adenovirus-mediated expression of herpes simplex virus thymidine kinase ( ADV / HSV-TK) plus valacyclovir therapy.
[0194] The super enhancer may be more tumor specific since the transcriptional factors for binding to the new enhancer have a higher level in tumor cells.
[0195] The enhancer can be used for an HSV-TK adenovirus therapy (either adding it to the RSV enhancer or substituting it for the RSV enhancer) for the treatment of metastatic triple negative breast cancer and metastatic non-small cell lung cancer in combination with other treatments. The enhancer can also be used for gene therapy products. In the gene therapy pipeline, oncology and rare diseases remain the top areas of development, with other therapeutic areas including anti-infectives, autoimmune disease, neurological, metabolic. Finally, the enhancer can be used in plasmids for basic research applications.
[0196] In the current ADV / HSV-TK vector, the HSV-TK gene is driven by the RSV promoter. However, this promoter cannot achieve the optimal expression level, and the gene expression does not persist for a long period of time. It was hypothesized that the replacement, insertion or modification of enhancer of the original RSV enhancer can augment the gene expression and thus can have higher efficacy of tumor killing with a reduced viral dose.
[0197] The super enhancer was discovered by 1) truncating known enhancers (RSV short enhancer, CMV, CAG, SV40, H1F1 and hTERT), followed by 2) mutagenesis and tandem repeat of the best truncated enhancers with expression tested in a breast cancer cell line (MCF-7). The testing used an RSV promoter driving eGFP expression and standardized with endogenous ubiquitin promoter driving mCherry gene expression. Three enhancers that are a combination of SV40 / hTERT enhancers were selected for additional analysis because gene expression was augmented, increasing GFP gene expression from MFI 40,000 with the RSV enhancer to 55,000 when standardized with the endogenous mCherry gene expression. The sequences of these enhancers and the point mutations compared to the original enhancers are included in TABLE 1. Docket No. 10063-111WO1
[0198] TABLE 1. Enhancer sequences. Point mutations are indicated in bold underline.
[0199] TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCA
[0200] Tandem ACCAGGTGTGGAAAGTCCCCACATGCATCTCAA
[0201] SEQ ID
[0202] sequence TTAGTCAGCACTCCGCCCATCCCGCCCCTAACT
[0203] NO:
[0204] (hTERT / SV4 CCGCCCAGTTCCGCCCATTCTCCGCCCCATGGC
[0205] 1 0) TGACT AATTTTTTTTCC GGGCC CTCCC AGCCCCT CCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCA ACCAGGTGTGGAAAGTCCCCACATGCATCTCAA SEQ ID TTAGCCAGCACTCCGCCCATCCCGCCCCTAACT
[0206] Clone 12 NO:
[0207] CX2GCX2CAGCTCCGCCCATTCTCCGCCCCATGGC
[0208] ? T11ACTAATT1GTTTTCCGGGCCCTCCCAGCCCCT CCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCA ACCAGGTGTGGAAAGTCCCCACATGCATCTCAA SEQ ID ITAGCCAGCACTCCGCCCAACCCGCCCCTAACT
[0209] Clone 13 NO:
[0210] CCGCCCAGTTCCGCCCTTTCTCCGCCCCATGGC
[0211] 3 TGACrAATlTTTTTTCCGGGCCCTCCCAGCCCCT CCCCTrCCITTCCGCGGCCCCGCCCTCTCCT TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCA ACCAGGTGTGGAAAGTCCCCACATGCATCTCAA SEQ ID TTAGTCAGCACTCCGCCCATCCCGCCCCTGACT
[0212] Clone 15 NO:
[0213] CCGCCCAGTTCCGCCCACTCTCCGCCCCATGGC
[0214] 4 TGACTAATmTTITCCGGGCCCACCCAGCCCCT CCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCA ACCAGGTGTGGAAAGTCCCCACATGCATCTCAA SEQ ID
[0215] TrAGTCAGCACTCCGCCCATCCCGCCCCTAACT Clone 16 NO:
[0216] CCGCCCAGCTCCGCCCATTCTCCGCCCCATGGC
[0217] 5 TGACTAATTTTTTTTCCGGGCCCTCCCAGCCCCT CCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT
[0218]
[0219] Docket No. 10063-111WO1
[0220] GTGGAAGTCCCCAGGCTCCCCAGCATTAGTCAGCA ACCAGGTGTGGAAAGTCCCCACATGCATCTCAA SEQ ID
[0221] TrAGTCAGCACTCCGCCCATCCCGCCCCrAACT
[0222] Clone 21 NO:
[0223] CCGCCCAGTTCCGCCCATTCTCCGCCCCATGGC
[0224] 6 TGACTAATTTTTTTTCCGGGCCCTCCCAGCCCCT CCCClTCCnTCCGCGGCCCCGCCCTCTCCT TGGAAAGTCCCCAGGCTCCCCAGCACTAGCCAGCA ACCAGGTGTGGAAAGTCCCCACATGCATCTCAA SEQ ID TTAGTCAGCACTCCGCCCATCCCGCCCCTAACT
[0225] Clone 36 NO:
[0226] CCGCCCAGTTCCGCCCATTCTCCGCCCCATGGC
[0227] 7 AGACTAATrrrrrATCCGGGCCCTCCCAGCCCC TCCCCITCC'TTTCCGCGGCCCCGCCCTCTCCT rGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCA ACCAGGTGTGGAAAGTCCCCACATGCATCTCAA SEQ ID
[0228] Clone 44 (same TTAGTCAGCACTCCGCCCATCCCGCCCCTGACT
[0229] NO: as clone 15) CCGCCCAGTTCCGCCCACTCTCCGCCCCATGGC
[0230] 4 TGACTAATTTTTTTTCCGGGCCCACCCAGCCCCT CCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT
[0231]
[0232] The study first compared truncated enhancers (e.g., RSV short enhancer, GMV, GAG (chicken beta actin), SV40, HIF1 and hTERT (human telomerase)) with an RSV promoter driving eGFP expression and standardized with endogenous ubiquitin promoter driving mCherry gene expression (FIG. 1A). The kinetic gene expression was followed. The best enhancer was further modified with mutagenesis and tandem repeat to increase the enhancer activity. Preliminary data showed that a single copy of SV40, hTERT, and GAG short enhancer significantly augmented the RSV promoter GFP gene expression from MFI 40,000 (RSV enhancer) to 55,000 when standardized with endogenous mCherry gene expression. Furthermore, the gene expression level persisted longer (FIG. IB).
[0233] Among seven enhancers, two enhancers (SV40 and hTERT) with the highest expression of the GFP reporter assay and better than the RSV enhancer (the benchmark) were identified (FIG. 2A). The SV40 and hTERT enhancers were selected, and a tandem repeat random mutation library was made and transfected into the MCF-7 (breast cancer cell line). The highest expression clones were then selected (FIG. 2B). Their sequences were retrieved Docket No. 10063-111WO1
[0234] and reinserted in the reporter GFP vector with internal control mCherry gene expression. The enhancer mutated clones 13, 16, and 15 exhibited a significantly higher enhancer activity than the original tandem repeat enhancer (SV40 / hTERT) (FIG. 2C) and the RSV enhancer.
[0235] The activity of the 3 best super enhancer clones was tested in two additional tumor cell lines: MCF-7 (FIG. 3A), MB-MD-231 (FIG. 3B), and drug-resistant colon tumor line HCT- 116 (FIG. 3C). The results further confirmed that mutated tandem repeat enhancers had a significantly stronger activity than the original tandem enhancer and RSV enhancer in multiple tumor cell lines. Clone 15 has two point mutations when compared with the original hTERT / SV40 sequence. The sequence of this point mutation is given in TABLE 1. Finally, the HSV-TK adenovirus vector (with and without the original RSV enhancer) was modified to include the super enhancer, clone 15.
[0236] This enhancer can be used in any viral vector or plasmid for optimal gene expression. This enhancer can be used to replace or add into any existing adenoviral vector with RSV enhancer. The addition of the enhancer can result in higher and more persistent therapeutic gene expression; thus a lower dose of adenoviral vector can be sufficient for gene delivery and optimal gene expression. This enhancer can be used for any viral vectors or plasmid gene expression with any therapeutic genes.
[0237] The disclosed combination of enhancers has a much stronger enhancer activity than existing enhancers alone (e.g., RSV, CMV, CAG, etc.). This enhancer has been incorporated into viral constructs for gene expression, and recombinant adenoviruses with this enhancer have been generated to optimize the expression of various genes (e.g., HSV-TK, immune checkpoint costimulatory molecules, etc.). This synthetic enhancer can be used for any viral vector gene delivery to achieve maximal and persistent gene expression. This enhancer can be used in the circulating plasmid gene expression as well, since it can significantly enhance the promoter function for maximal gene expression.
[0238] This enhancer can enhance the gene expression better than an adenoviral vector with an RSV enhancer. Furthermore, this enhancer can improve the efficacy of an adenoviral vector. For example, this enhancer can be incorporated into an adenoviral vector encoding HSV-TK to result in a better and more persist gene expression, which may lead to a better tumor killing. This super enhancer can also improve CAR-T expression and / or any other viral vector gene expression for therapeutic purpose.
[0239] This enhancer has higher gene expression and leads to higher protein expression, which can induce a strong tumor killing activity and higher bystander effect with therapeutic genes (e.g., HSV-TK) or any other genes mediated by this enhancer. Subsequently, the higher Docket No. 10063-111WO1
[0240] expression can allow the use of a lower dose of the therapeutic gene, which can serve to lower the cost effectively and to reduce the nonspecific toxicity with higher local gene expression. The enhancer can work with multiple types of tumors. The enhancer is also more tumor specific since the transcriptional factors for binding to the new enhancer have a higher level in tumor cells.
[0241] Example 2
[0242] The library design uses “NNK” (N = A / T / G / C; K = T / G) as a codon for certain hot spot to generate a saturation library. One spot includes all 20 amino acids residues and contains 20 constructs in the mix. Two spots are 400. There are no limits for how many spots can be included for synthesis in the defined region. Due to the transformation efficiency limits, usually the majority of variants are lost if the spots number are over 7 (1.28*109variants for 7 spots). Transformation efficiency could reach 109, but survival of cells will barely reach 107. It is a very efficient way to generate a library to screen the best mutation construct.
[0243] Based on the kit information, the highest mutation rate is 9 to 16 mutations per Kb. The enhancer is 199 bp, so 2 to 3 mutations were expected per clone. A few clones were sequenced under each condition to check how many mutations there were, then the best conditions to scale up were chose. The amount of DNA equivalent was delivered as a Maxiprep. Ten clones were ultimately sequenced to quality control the final DNA mutation rate.
[0244] TABLE 2. Library parameters.
[0245] Length Mut Mut_factor Combi_factor Library_size Sci. Count 199 1 3 199 597 5.97E+02 199 2 15 19701 295,515 2.96E+05 199 3 63 1293699 81,503,037 8.15E+07 199 4 255 63391251 16,164,769,005 1.62E+10 199 5 1023 2472258789 2,529,120,741,147 2.53E+ 12 199 6 4095 79936367511 327,339,424,957,545 3.27E+14 199 7 16383 2.20396E+12 36,107,474,174,859,100 3.61E+16 199 8 65535 5.2895E+13 3,466,476,205,895,460,000 3.47E+18 199 9 262143 1.12255E+15 294,268,681,128,883,000,000 2.94E+20 199 10 1048575 2.13285E+16 22, 364,483,751, 157,400,000,000 2.24E+22
[0246]
[0247] Docket No. 10063-111WO1
[0248] Stable ceil clones were established from the enhancer library by cell sorting using GFP reporter transduced cells. The results are depicted in FIG. 4. The enhancer region from those stable selected 67 cloned cells were then sequenced. Several high expression enhancer clones were selected for PCR. The highest expression clone (clone 15 / clone 44) was chosen to make the recombinant adenovirus and is referred to as HMR100.
[0249] As the original viral HSV-TK expression is only at the basal level of RSV promoter, the composite super-enhancer was used to improve the HSV-TK gene expression, make gene expression more tumor-specific and make a master seed recombinant adenovirus for both preclinical testing and clinical trial. Mouse (E0771) and human (MDA-MB231) breast cancer cells were transduced with adenovirus and treated with Ganciclovir (GCV) at a concentration of 10 pg / mL. Cells were incubated for 48 hours, and cell viability was determined by flow cytometry (DAPI staining). The results indicate that HMR 100 exhibited superior tumor killing than the original benchmark ADV / HSV-TK at different viral doses (MOI, multiplicity of infection) (FIGS. 5A-5B). The in vivo tumor killing effect was further tested. 5 x 104E0771 cells were injected orthotopically into the 4th inguinal mammary fat pad of female C57B1 / 6 mice. 10 days later, tumors size grew to an average of 100 mm3prior to IT injection of benchmark ADV / HSV-TK or HMR100 (day 0). Ganciclovir was administered via intraperitoneal (I. P.) injection 125 mg / kg twice daily on days 1-3, then once daily at 125 mg / kg body weight for the remainder of treatment up to day 10. Tumor volume was measured. The results indicate that HMR100 has a longer and more lasting antitumor effect than ADV / HSV-TK (FIG. 5C).
[0250] Example 3
[0251] Identifying the transcriptional factor binding sites of enhancers can be used to identify the regions of enhancers which can bind best to either specific transcriptional factors or to the broadest group of transcriptional factors. FIGS. 6A-6F depict the similarity between different segments of several enhancers and many transcriptional factors. This methodology can be used as a starting point to construct additional enhancers by combining the selected regions of each enhancer with the most desirable binding properties.
[0252] Example 4
[0253] In FIG. 7, construct B is a combination of clone 15 and RSV enhancers. The RSV enhancer was replaced with clone 15-SV40-11TERT, which was named the super enhancer. Gene expression was further evaluated by replacing the RSV enhancer (construct A) with the mutant clone 15-SV40-HTERT enhancer (construct C). Docket No. 10063-111WO1
[0254] Viral gene expression and tumor killing in vitro of various enhancer constructs: Disclosed herein is a recombinant adenovirus with a super -enhancer adenovirus HSV-TK (Ad / 1 -SV40-hTERT-HSV-TK), which was compared to the clone 15-RSV enhancer (Ad / 15-RSV-HS V-TK), and a benchmark (Ad / RSV-HSV-TK) on the expression of the HSV-TK gene from adenovirus transduced SUM159 breast cancer cell line using RT-PCR at MOI 500 (FIG.
[0255] 8A). This comparison was repeated with super-enhancer HSV-TK virus with RSV enhancer virus at various MOI of infection in breast cancer cells by RT-PCR as shown in FIG. 8B. Additionally, a study conducted in vitro tumor killing experiments with super-enhancer vs. RSV enhancer adenovirus infection at multiple MOI with and without ganciclovir (GCV) treatment as shown in FIG. 8C. The results indicate that the super enhancer (clone 15-SV40-h'l'ERT) is expressed approximately 4-5 times more than the RSV enhancer for the HSV-TK gene. Furthermore, the super-enhancer adenovirus is more efficacious in tumor cell killing in the presence of GCV.
[0256] Anti-tumor response with various enhancer adenovirus: The study compared the tumor-killing effect in vivo on two different tumor cell lines: E0771 (triple-negative breast cancer, TNBC) and LLC (lung cancer tumor). The study injected 5 x 104E0771 (TNBC) cells orthotopically into the 4th inguinal mammary fat pad of female C57B1 / 6 mice. The tumor size grew to an average of 100 mm3on day 9 before the intratumoral (11') injection of the benchmark ADV / HSV-tk or Ad / 15-SV40-hTERT-HSV-TK. GCV or control PBS was administered via intraperitoneal (I. P.) injection at 100 mg / kg twice daily on days 1-3, then once daily at 125 mg / kg body weight for the remainder of the treatment, for up to 10 days. Tumor volume was measured. The preliminary results indicate that Ad / 1 -SV40-hTERT-HSV-TK exhibited a longer and more sustained antitumor effect compared to ADV / RSV-HSV-TK (FIG. 9A). The study also tested another type of tumor, LLC (lung cancer), with a higher viral dose of injection. Similar results showed that Ad / 15-SV40-hTERT-HSV-TK was superior to ADV / RSV-HSV- TK in terms of antitumor response (FIG. 9B).
[0257] Overall, the new' super-enhancer demonstrated higher HSV-TK expression and antitumor response compared to the original benchmark virus after replacing the selected tandem tumor-specific (clone 1 S V40-hTERT) enhancers.
[0258] Super-enhancer significantly increased co-stimulatory molecular expression in adenovirus vectors: The study further constructed adenoviruses with tlie expression on other proteins, e.g., costimulatory molecules, using various enhancers, such as the RSV enhancer, construct D, and the super-enhancer, construct E. These adenoviruses co-expressed costimulatory molecules, including a bifunctional antibody, an anti-LILRB2 and a CD40L Docket No. 10063-111WO1
[0259] fusion protein. The study then compared the expression of the TK and costimulatory molecule genes using the diagram shown in FIG. 10. The study transfected the plasmid constructs into 293 cells and used RT-PCR to quantify the gene expression. The results indicated that the super enhancer (clone 15-SV40-hTERT) exhibited superior expression levels for both HSV-TK (FIG. 11A) and bifunctional costimulatory molecules (FIG. 11B) compared to the RSV enhancer.
[0260] These data support that super-enhancer is superior to the original RSV enhancer, which can express the HSV-TK gene and other proteins as well.
[0261] EXAMPLE ASPECTS
[0262] Example 1: A chimeric nucleic acid comprising: a human telomerase reverse transcriptase (hTERT) enhancer or a fragment thereof; and an SV40 enhancer or a fragment thereof.
[0263] Example 2: The chimeric nucleic acid of any examples herein, particularly Example 1, wherein the chimeric nucleic acid comprises one or more mutations to the hTERT enhancer or the fragment thereof and / or the S V40 enhancer or the fragment thereof.
[0264] Example 3: The chimeric nucleic acid of any examples herein, particularly Examples 1-2, wherein the hTERT enhancer or the fragment thereof is upstream of the SV40 enhancer or the fragment thereof.
[0265] Example 4: The chimeric nucleic acid of any examples herein, particularly Examples 1 -2, wherein the SV40 enhancer or the fragment thereof is upstream of the hTERT enhancer or the fragment thereof.
[0266] Example 5: The chimeric nucleic acid of any examples herein, particularly Examples 1-4, wherein the hTERT enhancer or the fragment thereof comprises 70% similarity or more to SEQ ID NO: 8, SEQ ID NO: 18, or SEQ ID NO: 19.
[0267] Example 6: The chimeric nucleic acid of any examples herein, particularly Examples 1-5, wherein the SV40 enhancer or the fragment thereof compri ses 70% similarity or more to SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
[0268] Example 7: The chimeric nucleic acid of any examples herein, particularly Examples 1-6, wherein the hTERT enhancer or the fragment thereof is immediately adjacent to the SV40 enhancer or the fragment thereof.
[0269] Example 8: The chimeric nucleic acid of any examples herein, particularly Examples 1-6, wherein the hTERT enhancer or the fragment thereof and the SV40 enhancer or the fragment thereof are separated by a linker. Docket No. 10063-111WO1
[0270] Example 9: The chimeric nucleic acid of any examples herein, particularly Example 8, wherein the linker comprises from 1 nucleotide to 20 nucleotides.
[0271] Example 10: The chimeric nucleic acid of any examples herein, particularly Examples 1-9, further comprising multiple copies of the hTERT enhancer or fragments thereof and / or multiple copies of the SV40 enhancer or fragments thereof.
[0272] Example 11: The chimeric nucleic acid of any examples herein, particularly Example 10, wherein each copy of the hTERT enhancer or fragment thereof and / or the SV40 enhancer or fragment thereof is the same.
[0273] Example 12: 'The chimeric nucleic acid of any examples herein, particularly Example 10, wherein each copy of the hTERT enhancer or fragment thereof and / or the SV40 enhancer or fragment thereof is different.
[0274] Example 13: The chimeric nucleic acid of any examples herein, particularly Example 12, further comprising, from 5’ to 3’: a first SV40 enhancer fragment comprising 80% similarity or more to SEQ ID NO: 16; a first hTERT enhancer fragment comprising 80% similarity or more to SEQ ID NO: 18; a second SV40 enhancer comprising 80% similarity or more to SEQ ID NO: 15; and a second hTERT enhancer comprising 80% similarity or more to SEQ ID NO: 8.
[0275] Example 14: The chimeric nucleic acid of any examples herein, particularly Examples 1-13, further comprising an RSV enhancer or a fragment thereof, a CMV enhancer or a fragment thereof, a CAG (chicken beta actin) enhancer or a fragment thereof, a HIF1 enhancer or a fragment thereof, or any combination thereof.
[0276] Example 15: The chimeric nucleic acid of any examples herein, particularly Examples 1-14, wherein the chimeric nucleic acid comprises 70% similarity or more to any one of SEQ ID NOs: 1-7.
[0277] Example 16: The chimeric nucleic acid of any examples herein, particularly Examples 1-15, wherein the chimeric nucleic acid comprises 90% similarity or more to any one of SEQ ID NOs: 1-7.
[0278] Example 17: The chimeric nucleic acid of any examples herein, particularly Examples 1-16, wherein the chimeric nucleic acid comprises any one of SEQ ID NOs: 1-7.
[0279] Example 18: The chimeric nucleic acid of any examples herein, particularly Examples 1-17, wherein the chimeric nucleic acid comprises DNA.
[0280] Example 19: The chimeric nucleic acid of any examples herein, particularly Examples 1-18, wherein the chimeric nucleic acid comprises RNA. Docket No. 10063-111WO1
[0281] Example 20: A vector encoding the chimeric nucleic acid of any examples herein, particularly Examples 1-19.
[0282] Example 21: The vector of any examples herein, particularly Example 20, wherein the vector is a viral vector.
[0283] Example 22: The vector of any examples herein, particularly Example 21, wherein the vector is an adenovirus vector, a retroviral vector, a lend viral vector, or any other suitable in vivo gene expression vector.
[0284] Example 23: The vector of any one of clams 20-22, wherein the vector further encodes at least one promoter operably linked to at least one expressible gene.
[0285] Example 24: The vector of any examples herein, particularly Example 23, wherein the at least one promoter comprises an RSV promoter or a fragment thereof.
[0286] Example 25: The vector of any examples herein, particularly Examples 23-24, wherein the at least one expressible gene encodes an enzyme for gene-directed enzyme prodrug therapy or a fragment thereof.
[0287] Example 26: The vector of any examples herein, particularly Example 25, wherein the at least one expressible gene encodes Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) or a fragment thereof.
[0288] Example 27: The vector of any examples herein, particularly Examples 23-26, wherein the at least one expressible gene encodes an immune checkpoint inhibitor.
[0289] Example 28: The vector of any examples herein, particularly Example 27, wherein the at least one expressible gene encodes LILRB2 or a fragment thereof.
[0290] Example 29: The vector of any examples herein, particularly Examples 23-28, wherein the at least one expressible gene encodes an antibody or a fragment thereof that binds to a costimulatory molecule.
[0291] Example 30: The vector of any examples herein, particularly Example 29, wherein the at least one expressible gene encodes an antibody or a fragment thereof that binds to CD40L.
[0292] Example 31: The vector of any examples herein, particularly Examples 23-30, wherein the at least one expressible gene encodes a bifunctional antibody.
[0293] Example 32: The vector of any examples herein, particularly Example 31, wherein the bifunctional antibody comprises a first portion comprising an immune checkpoint inhibitor and a second portion that binds to a costimulatory molecule.
[0294] Example 33: The vector of any examples herein, particularly Example 32, wherein the bifunctional antibody binds to LILRB2 and CD40. Docket No. 10063-111WO1
[0295] Example 34: A cell comprising the vector of any examples herein, particularly Examples 20-33.
[0296] Example 35: A method of increasing gene expression in a cell, the method comprising providing to the cell a vector encoding: a chimeric nucleic acid comprising an hTERT enhancer or a fragment thereof and an SV40 enhancer or a fragment thereof; and at least one promoter operably linked to at least one expressible gene; wherein the chimeric nucleic acid increases expression of the at least one expressible gene.
[0297] Example 36: The method of any examples herein, particularly Example 35, wherein the chimeric nucleic acid comprises 70% similarity or more to any one of SEQ ID NOs: 1-7.
[0298] Example 37: The method of any examples herein, particularly Examples 35-36, wherein the chimeric nucleic acid comprises 90% similarity or more to any one of SEQ ID NOs: 1-7.
[0299] Example 38: The method of any examples herein, particularly Examples 35-37, wherein the chimeric nucleic acid comprises any one of SEQ ID NOs: 1-7.
[0300] Example 39: The method of any examples herein, particularly Examples 35-38, wherein the chimeric nucleic acid is the chimeric nucleic acid of any examples herein, particularly Examples 1-19.
[0301] Example 40: The method of any examples herein, particularly Examples 35-39, wherein the vector is a viral vector.
[0302] Example 41: The method of any examples herein, particularly Example 40, wherein the vector is an adenovirus vector, a retroviral vector, a lenti viral vector, or any other suitable in vivo gene expression vector.
[0303] Example 42: The method of any examples herein, particularly Examples 35-41, wherein the at least one promoter comprises an RSV promoter or a fragment thereof.
[0304] Example 43: The method of any examples herein, particularly Examples 35-42, wherein the at least one expressible gene encodes an enzyme for gene-directed enzyme prodrug therapy or a fragment thereof.
[0305] Example 44: The method of any examples herein, particularly Example 43, wherein the at least one expressible gene encodes Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) or a fragment thereof.
[0306] Example 45: The method of any examples herein, particularly Examples 35-44, wherein the at least one expressible gene encodes an immune checkpoint inhibitor.
[0307] Example 46: The method of any examples herein, particularly Example 45, wherein the at least one expressible gene encodes LILRB2 or a fragment thereof. Docket No. 10063-111WO1
[0308] Example 47: The method of any examples herein, particularly Examples 35-46, wherein the at least one expressible gene encodes an antibody or a fragment thereof that binds to a costimulatory molecule.
[0309] Example 48: The method of any examples herein, particularly Example 47, wherein the at least one expressible gene encodes an antibody or a fragment thereof that binds to CD40L.
[0310] Example 49: The method of any examples herein, particularly Examples 35-48, wherein the at least one expressible gene encodes a bifunctional antibody.
[0311] Example 50: The method of any examples herein, particularly Example 49, wherein the bifunctional antibody comprises a first portion comprising an immune checkpoint inhibitor and a second portion that binds to a costimulatory molecule.
[0312] Example 51: The method of any examples herein, particularly Example 50, wherein the bifunctional antibody binds to LIERB2 and CD40.
[0313] Example 52: The method of any examples herein, particularly Examples 35-51, wherein the cell is human.
[0314] Example 53: The method of any examples herein, particularly Examples 35-52, wherein the ceil is healthy.
[0315] Example 54: The method of any examples herein, particularly Examples 35-52, wherein the cell is cancerous.
[0316] Example 55: The method of any examples herein, particularly Example 54, wherein the cell is a breast cancer cell or a coion cancer cell.
[0317] Example 56: A method of treating and / or preventing a cancer in a subject, the method comprising: a) providing to the subject a vector encoding: a chimeric nucleic acid comprising an hTERT enhancer or a fragment thereof and an SV40 enhancer or a fragment thereof; and at least one promoter operably linked to Herpes Simplex Virus type 1 - thymidine kinase (HSV- TK) or a fragment thereof; wherein the chimeric nucleic acid increases expression of HSV-TK or a fragment thereof; and b) providing to the subject an antiviral agent.
[0318] Example 57: The method of any examples herein, particularly Example 56, wherein the antiviral agent is ganciclovir.
[0319] Example 58: The method of any examples herein, particularly Examples 56-57, wherein the chimeric nucleic acid comprises 70% similarity or more to any one of SEQ ID NOs: 1-7. Docket No. 10063-111WO1
[0320] Example 59: The method of any examples herein, particularly Examples 56-58, wherein the chimeric nucleic acid comprises 90% similarity or more to any one of SEQ ID NOs: 1-7.
[0321] Example 60: The method of any examples herein, particularly Examples 56-59, wherein the chimeric nucleic acid comprises any one of SEQ ID NOs: 1-7.
[0322] Example 61: The method of any examples herein, particularly Examples 56-60, wherein the chimeric nucleic acid is the chimeric nucleic acid of any examples herein, particularly Examples 1-19.
[0323] Example 62: The method of any examples herein, particularly Examples 56-61, wherein the vector is a viral vector.
[0324] Example 63: The method of any examples herein, particularly Example 62, wherein the vector is an adenovirus vector, a retroviral vector, a lentiviral vector, or any other suitable in vivo gene expression vector.
[0325] Example 64: The method of any examples herein, particularly Examples 56-63, wherein the at least one promoter comprises an RSV promoter or a fragment thereof.
[0326] Example 65: The method of any examples herein, particularly Examples 56-64, wherein the subject has breast cancer or colon cancer.
[0327] Example 66: The method of any examples herein, particularly Examples 56-65, further comprising: c) providing to the subject an anti-cancer agent.
[0328] Example 67: The method of any examples herein, particularly Example 66, wherein the anti-cancer agent comprises radiotherapy, chemotherapy, immunotherapy, immune checkpoint blockade therapy, or any combination thereof.
[0329] Any patents, applications and publications as listed throughout this document are hereby incorporated by reference in their entirety herein. Docket No. 10063-111WO1
[0330] SEQUENCES
[0331] SEQ ID NO: 1 (hTERT / SV40 tandem sequence) TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCAACCAGGTGTGGAAAGTCCC CACATGCATCTCAATTAGTCAGCACTCCGCCCATCCCGCCCCTAACTCCGCCCAG TTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTCCGGGCCCTCCCAGCC CCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT
[0332] SEQ ID NO: 2 (clone 12) TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCAACCAGGTGTGGAAAGTCCC CACATGCATCTCAATTAGCCAGCACTCCGCCCATCCCGCCCCTAACTCCGCCCAG CTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTCCGGGCCCTCCCAGCC CCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT
[0333] SEQ ID NO: 3 (clone 13) TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCAACCAGGTGTGGAAAGTCCC CACATGCATCTCAATTAGCCAGCACTCCGCCCAACCCGCCCCTAACTCCGCCCAG TTCCGCCCTTTCTCCGCCCCATGGCTGACTAATTTTTTTTCCGGGCCCTCCCAGCC CCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT
[0334] SEQ ID NO: 4 (clone 15, clone 44) TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCAACCAGGTGTGGAAAGTCCC CACATGCATCTCAATTAGTCAGCACTCCGCCCATCCCGCCCCTGACTCCGCCCAG TTCCGCCCACTCTCCGCCCCATGGCTGACTAATTTTTTTTCCGGGCCCACCCAGCC CCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT
[0335] SEQ ID NO: 5 (clone 16) TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCAACCAGGTGTGGAAAGTCCC CACATGCATCTCAATTAGTCAGCACTCCGCCCATCCCGCCCCTAACTCCGCCCAG CTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTCCGGGCCCTCCCAGCC CCTCCCCTTC CTTTCCGCGGCCCCGCCCTCTCCT Docket No. 10063-111WO1
[0336] SEQ ID NO: 6 (clone 21) GTGGAAGTCCCCAGGCTCCCCAGCATTAGTCAGCAACCAGGTGTGGAAAGTCCC CACATGCATCTCAATTAGTCAGCACTCCGCCCATCCCGCCCCTAACTCCGCCCAG
[0337] I’TCC GCCC ATTCTCCGCCCC ATGGCTGACTA AT IT IT TTTCCGGGCCCTCCC AGCC CCTCCCCTrCCn CCGCGGCCCCGCCCTCTCCT
[0338] SEQ ID NO: 7 (clone 36) TGGAAAGTCCCCAGGCTCCCCAGCACTAGCCAGCAACCAGGTGTGGAAAGTCCC CACATGCATCTCAATTAGTCAGCACTCCGCCCATCCCGCCCCTAACTCCGCCCAG TTCCGCCCATTCTCCGCCCCATGGCAGACTAATTTTTTATCCGGGCCCTCCCAGCC CCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT
[0339] SEQ ID NO: 8 (hTERT enhancer) CTTCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCT TCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCC CCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCC GCCCTCTCCTCGCGGCGCGAGTT
[0340] SEQ ID NO: 9 (SV40 enhancer) TGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAA TTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTAT GCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCC ATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAA TTTTTTTTATTTATGCAGAGGCCGAGGCCGTCTGCCTCTGAGCTATTCCAGAAG TAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCT
[0341] SEQ ID NO: 10 (RSV enhancer)
[0342] GTGTGGCGGAAGTGTGATGTTGCAAGTGTGGCGGAACACATGTAAGCGCCGGAT
[0343] GTGGTAAAGTGACGTTTTTGGTGTGCGCCGGTGTATACGGGAAGTGACAATTTТ CGCGCGGTTTTAGGCGGATGTTGTAGTAAATTTGGGCGTAACCAAGTAATATTTG GCCATTTTCGCGGGAAAACTGAATAAGAGGAAGTGAAATCTGAATAATTCTGTG ITACTCATAGCGCGrAATATTTG'rCTAGGGCCGCGGGGAC rTGACCGri’TACGT GGAGACTCGCCCAGGTGTTTTTCTCAGGTGTTTTCCGCGTTCCGGGTCAAAGTTG GCGTTTTATTATTATAGTCAGCTCTAGCTGCTTCGCGATGTACGGGCCAGATATA Docket No. 10063-111WO1
[0344] CGCGTA TCTGAGGGGACTAGGGTG TGTTTAGGCGAAAAGCGGGGCTTCGGTTGT ACGCGGl TAGGAGTCCCC TCAGGATATAGTAGTTTCGC ITITGC ATAGGGAGGGG GAA
[0345] SEQ ID NO: 11 (CMV enhancer) CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGC CCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCC ATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCA AGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCC GCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACA TCTACGTATrAGTCATCGCTAITACCATG
[0346] SEQ ID NO: 12 (CAG enhancer) GCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCG CCCATTGACGTCAATAATGACGTATGTrCCCA'rAGTAACGCCAATAGGGACTTTC CATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATC AAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCC CGCCTGGCATTATGCCCAGTACATGACCTrATGGGACTrTCCTACITGGCAGTAC ATCT AC GT ATI A GTC ATCGCT ATT AC C ATG
[0347] SEQ ID NO: 13 (HIF enhancer)
[0348] TGGCTATTTTTC ACCCTTTGCTTTC AT A A AA ACC AGAT ATATCT AGCTGGTTTGA ACTGGATTTTGAAATTGTTAGTCATTTACGATAAAGAGATATAGTGTCCTTGCTG CTGAAAAATGATGTATGAGATGCGAAATCATTGTAGTCACTCCATAGATAGTAA GGACAAAGGAAAGAAAAACCCTAATCTTCTAACTGGTT
[0349] SEQ ID NO: 14 (HSV-TK) ATGGCTTCGTACCCCGGCCATCAGCACGCGTCTGCGTTCGACCAGGCTGCGCGTT CTCGCGGCCATAGCAACCGACGTACGGCGTTGCGCCCTCGCCGGCAGCAAGAAG CCACGGAAGTCCGCCCGGAGCAGAAAATGCCCACGCTACTGCGGGTTTATATAG ACGGTCCCCACGGGATGGGGAAAACCACCACCACGCAACTGCTGGTGGCCCTGG GTTCGCGCGACGATATCGTCTACGTACCCGAGCCGATGACTTACTGGCGGGTGCT GGGGGCTTCCGAGACAATCGCGAACATCTACACCACACAACACCGCCTTGACCA GGGTGAGATATCGGCCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAAC Docket No. 10063-111WO1
[0350] AATGGGCATGCCTTA'rGCCGTGACCGACGCCGTrCTGGC'rCCrCATArCGGGGGG GAGGCTGGGAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATC1TCGACCGCC ATCCCATCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCAT GACCCCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGC ACAAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTCGC CGCGTTTACGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGGGTCGT GGCGGGAGGAT TGGGGAC AGC IT TCGGGGACGGCCGTGCCGCCCC AGGGTGCCG AGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGTrATI ACCC TGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTACAACGTGTTTGC CTGGGCCTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCACGTCTTTATCCTG GATrACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGCTGCAACTTACCTCCG GGATGATCCAGACCCACGTCACCACCCCAGGCTCCATACCGACGATCTGCGACCT GGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCTAACTGA
[0351] SEQ ID NO: 15 (mutated SV40 enhancer) TGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAA
[0352] 1TAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTAT GCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCC ATCCCGCCCCTGACTCCGCCCAGTTCCGCCCACTCTCCGCCCCATGGCTGACTAA TITITITrATITATGCAGAGGCCGAGGCCGCCTCrGCCTCTGAGCTATTCCAGAAG TAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTC
[0353] SEQ ID NO: 16 (SV40 enhancer fragment) TGGAAAGTCCCCAGGCTCCCCAGCATTAGTCAGCAACCAGGTGTGGAAAGTCCC CACATGCATCTCAATTAGTCAGCACTCCGCCCATCCCGCCCCTGACTCCGCCCAG TTCC’GCCCACTCTOCGCCCCATGGCTGACTAATTTTTTTT
[0354] SEQ ID NO: 17 (SV40 enhancer fragment) GGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAAT TAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTGACTCCGC CCAGnCCGCCCACTCTCCGCCCCATGGCTGACTAATTn’n’n’ Docket No. 10063-111WO1
[0355] SEQ ID NO: 18 (hTERT enhancer fragment) CCGGGCCCACCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCT
[0356] SEQ ID NO: 19 (mutated hTERT enhancer) CTTCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCC'CITCACCT TCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCC CCGGCCCAGCCCCCTCCGGGCCCACCCAGCCCCTCCCCTTCCTTTCCGCGGCCCC GCCCTCTCCTCGCGGCGCGAGTT
Claims
Docket No. 10063-111WO1CLAIMSWhat is claimed is:
1. A chimeric nucleic acid comprising:a human telomerase reverse transcriptase (hTERT) enhancer or a fragment thereof; and an SV40 enhancer or a fragment thereof.
2. The chimeric nucleic acid of claim 1, wherein the chimeric nucleic acid comprises one or more mutations to the hTERT enhancer or the fragment thereof and / or the SV40 enhancer or the fragment thereof.
3. The chimeric nucleic acid of any one of claims 1-2, wherein the hTERT enhancer or the fragment thereof is upstream of the SV40 enhancer or the fragment thereof.
4. The chimeric nucleic acid of any one of claims 1-2, wherein the SV40 enhancer or the fragment thereof is upstream of the hTERT enhancer or the fragment thereof.
5. The chimeric nucleic acid of any one of claims 1-4, wherein the hTERT enhancer or the fragment thereof comprises 70% similarity or more to SEQ ID NO: 8, SEQ ID NO: 18, or SEQ ID NO: 19.
6. The chimeric nucleic acid of any one of claims 1-5, wherein the SV40 enhancer or the fragment thereof comprises 70% similarity or more to SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
7. The chimeric nucleic acid of any one of claims 1-6, wherein the hTERT enhancer or the fragment thereof is immediately adjacent to the SV40 enhancer or the fragment thereof.
8. The chimeric nucleic acid of any one of claims 1-6, wherein the hTERT enhancer or the fragment thereof and the SV40 enhancer or the fragment thereof are separated by a linker.
9. The chimeric nucleic acid of claim 8, wherein the linker comprises from 1 nucleotide to 20 nucleotides.Docket No. 10063-111WO110. The chimeric nucleic acid of any one of claims 1-9, further comprising multiple copies of the hTERT enhancer or fragments thereof and / or multiple copies of the SV40 enhancer or fragments thereof.
11. The chimeric nucleic acid of claim 10, wherein each copy of the hTERT enhancer or fragment thereof and / or the SV40 enhancer or fragment thereof is the same.
12. The chimeric nucleic acid of claim 10, wherein each copy of the hTERT enhancer or fragment thereof and / or the SV40 enhancer or fragment thereof is different.
13. The chimeric nucleic acid of claim 12, further comprising, from 5’ to 3’:a first SV40 enhancer fragment comprising 80% similarity or more to SEQ ID NO: 16; a first hTERT enhancer fragment comprising 80% similarity or more to SEQ ID NO: 18;a second SV40 enhancer comprising 80% similarity or more to SEQ ID NO: 15; and a second hTERT enhancer comprising 80% similarity or more to SEQ ID NO: 8.
14. The chimeric nucleic acid of any one of claims 1-13, further comprising an RSV enhancer or a fragment thereof, a CMV enhancer or a fragment thereof, a CAG (chicken beta actin) enhancer or a fragment thereof, a HIF1 enhancer or a fragment thereof, or any combination thereof.
15. The chimeric nucleic acid of any one of claims 1-14, wherein the chimeric nucleic acid comprises 70% similarity or more to any one of SEQ ID NOs: 1-7.
16. The chimeric nucleic acid of any one of claims 1-15, wherein the chimeric nucleic acid comprises 90% similarity or more to any one of SEQ ID NOs: 1-7.
17. The chimeric nucleic acid of any one of claims 1-16, wherein the chimeric nucleic acid comprises any one of SEQ ID NOs: 1-7.
18. The chimeric nucleic acid of any one of claims 1-17, wherein the chimeric nucleic acid comprises DNA.Docket No. 10063-111WO119. The chimeric nucleic acid of any one of claims 1-18, wherein the chimeric nucleic acid comprises RNA.
20. A vector encoding the chimeric nucleic acid of any one of claims 1-19.
21. The vector of claim 20, wherein the vector is a viral vector.
22. The vector of claim 21, wherein the vector is an adenovirus vector, a retroviral vector, a lend viral vector, or any other suitable in vivo gene expression vector.
23. The vector of any one of clams 20-22, wherein the vector further encodes at least one promoter operably linked to at least one expressible gene.
24. The vector of claim 23, wherein the at least one promoter comprises an RSV promoter or a fragment thereof.
25. The vector of any one of claims 23-24, wherein the at least one expressible gene encodes an enzyme for gene-directed enzyme prodrug therapy or a fragment thereof.
26. The vector of claim 25, wherein the at least one expressible gene encodes Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) or a fragment thereof.
27. The vector of any one of claims 23-26, wherein the at least one expressible gene encodes an immune checkpoint inhibitor.
28. The vector of claim 27, wherein the at least one expressible gene encodes LILRB2 or a fragment thereof.
29. The vector of any one of claims 23-28, wherein the at least one expressible gene encodes an antibody or a fragment thereof that binds to a costimulatory molecule.
30. The vector of claim 29, wherein the at least one expressible gene encodes an antibody or a fragment thereof that binds to CD40L.Docket No. 10063-111WO131. The vector of any one of claims 2.3-30, wherein the at least one expressible gene encodes a bifunctional antibody.
32. The vector of claim 31, wherein the bifunctional antibody comprises a first portion comprising an immune checkpoint inhibitor and a second portion that binds to a costimulatory molecule.
33. The vector of claim 32, wherein the bifunctional antibody binds to LILRB2 and CD40.
34. A cell comprising the vector of any one of claims 20-33.
35. A method of increasing gene expression in a cell, the method comprising providing to the cell a vector encoding:a chimeric nucleic acid comprising an hTERT enhancer or a fragment thereof and an SV40 enhancer or a fragment thereof; andat least one promoter operably linked to at least one expressible gene;wherein the chimeric nucleic acid increases expression of the at least one expressible gene.
36. The method of claim 35, wherein the chimeric nucleic acid comprises 70% similarity or more to any one of SEQ ID NOs: 1-7.
37. The method of any one of claims 35-36, wherein the chimeric nucleic acid comprises 90% similarity or more to any one of SEQ ID NOs: 1-7.
38. The method of any one of claims 35-37, wherein the chimeric nucleic acid comprises any one of SEQ ID NOs: 1-7.
39. The method of any one of claims 35-38, wherein the chimeric nucleic acid is the chimeric nucleic acid of any one of claims 1-19.
40. The method of any one of claims 35-39, wherein the vector is a viral vector.Docket No. 10063-111WO141. The method of claim 40, wherein the vector is an adenovirus vector, a retroviral vector, a lend viral vector, or any other suitable in vivo gene expression vector.
42. The method of any one of claims 35-41, wherein the at least one promoter comprises an RSV promoter or a fragment thereof.
43. The method of any one of claims 35-42, wherein the at least one expressible gene encodes an enzyme for gene-directed enzyme prodrug therapy or a fragment thereof.
44. The method of claim 43, wherein the at least one expressible gene encodes Herpes Simplex Virus type 1 - thymidine kinase (HS V-TK) or a fragment thereof.
45. The method of any one of claims 35-44, wherein the at least one expressible gene encodes an immune checkpoint inhibitor.
46. The method of claim 45, wherein the at least one expressible gene encodes LILRB2 or a fragment thereof.
47. The method of any one of claims 35-46, wherein the at least one expressible gene encodes an antibody or a fragment thereof that binds to a costimulatory molecule.
48. The method of claim 47, wherein the at least one expressible gene encodes an antibody or a fragment thereof that binds to CD40L.
49. The method of any one of claims 35-48, wherein the at least one expressible gene encodes a bifunctional antibody.
50. The method of claim 49, wherein the bifunctional antibody comprises a first portion comprising an immune checkpoint inhibitor and a second portion that binds to a costimulatory molecule.
51. The method of claim 50, wherein the bifunctional antibody binds to LILRB2 and CD40.
52. The method of any one of claims 35-51, wherein the cell is human.Docket No. 10063-111WO153. The method of any one of claims 35-52, wherein the cell is healthy.
54. The method of any one of claims 35-52, wherein the cell is cancerous.
55. The method of claim 54, wherein the cell is a breast cancer cell or a colon cancer cell.
56. A method of treating and / or preventing a cancer in a subject, the method comprising:a) providing to the subject a vector encoding:a chimeric nucleic acid comprising an hTERT enhancer or a fragment thereof and an SV40 enhancer or a fragment thereof; andat least one promoter operably linked to Herpes Simplex Virus type 1 - thymidine kinase (HSV-TK) or a fragment thereof;wherein the chimeric nucleic acid increases expression of HSV-TK or a fragment thereof; andb) providing to the subject an antiviral agent.
57. The method of claim 56, wherein the antiviral agent is ganciclovir.
58. The method of any one of claims 56-57, wherein the chimeric nucleic acid comprises 70% similarity or more to any one of SEQ ID NOs: 1-7.
59. The method of any one of claims 56-58, wherein the chimeric nucleic acid comprises 90% similarity or more to any one of SEQ ID NOs: 1-7.
60. The method of any one of claims 56-59, wherein the chimeric nucleic acid comprises any one of SEQ ID NOs: 1-7.
61. The method of any one of claims 56-60, wherein the chimeric nucleic acid is the chimeric nucleic acid of any one of claims 1-19.
62. The method of any one of claims 56-61, wherein the vector is a viral vector.Docket No. 10063-111WO163. The method of claim 62, wherein the vector is an adenovirus vector, a retroviral vector, a lend viral vector, or any other suitable in vivo gene expression vector.
64. The method of any one of claims 56-63, wherein the at least one promoter comprises an RSV promoter or a fragment thereof.
65. The method of any one of claims 56-64, wherein the subject has breast cancer or colon cancer.
66. The method of any one of claims 56-65, further comprising:c) providing to the subject an anti-cancer agent.
67. The method of claim 66, wherein the anti-cancer agent comprises radiotherapy, chemotherapy, immunotherapy, immune checkpoint blockade therapy, or any combination thereof.
Citation Information
Patent Citations
System for increasing gene expression and vector comprising the system
US20120309050A1
Method for inducing glial cells transdifferentiation into functional neurons, and application thereof
US20230201304A1
Synthetic htert promoters and uses thereof
WO2024130007A2