Helicase and application thereof

Abstract

The invention belongs to the technical field of nucleic acid sequencing, and relates to helicase and application thereof. Specifically, the present invention provides a helicase in which two or more amino acid residues on the surface of the helicase surrounding a polynucleotide binding domain of the helicase are linked by an ectopic bond, and the helicase retains its ability to control movement of a target analyte, the ectopic bond not including an ectopic bond in which cysteine participates in formation. The invention also provides a polypeptide, a construct, a polynucleotide, a vector, a host cell, a method of preparing helicase, polypeptide or construct, a method of controlling movement of a target analyte, a method of characterizing a target analyte, a method of forming a sensor for characterizing a target analyte, a sensor for characterizing a target analyte, and a method of forming a sensor for characterizing a target analyte. Use of helicases or constructs for controlling the movement of a target analyte through a well, kits or devices for characterizing a target analyte, and a set of two or more helicases linked to a target analyte.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid sequencing, and particularly relates to a modified helicase and an application thereof in characterizing a target analyte. Background Art

[0002] Nanopore sequencing technology, also known as the fourth-generation sequencing technology, uses a nanopore that can provide an ion current channel to allow analytes such as single-stranded nucleic acid molecules to pass through the nanopore under the drive of electrophoresis. When analytes such as nucleic acids pass through the nanopore, the current of the nanopore will be reduced, and the gene sequencing technology can read the sequence information of the different signals generated in real time.

[0003] Helicases are a useful tool for controlling the movement of nucleic acid molecules during nanopore sequencing, but current helicases have some problems that need to be solved. For example, the helicase may fall off the nucleic acid molecule during sequencing, causing the nucleic acid molecule to be pulled through the pore at an uncontrolled speed and in an uncontrolled manner, so that the current signal of the analyte, such as a single nucleotide, is too short to be distinguished.

[0004] To address this problem, the prior art CN105899678A discloses a modified helicase. Specifically, at least one cysteine / non-natural amino acid is introduced into the tower / pin / 1A domain of the helicase, thereby improving the continuous rate control ability of the helicase in nanopore sequencing. Summary of the invention

[0005] The present application provides a new helicase modification method, which can also improve the continuous rate control ability of the helicase in nanopore sequencing, and has better effects in terms of sequencing stability and accuracy.

[0006] In a first aspect, the present application provides a helicase,

[0007] (a) comprising a polynucleotide binding domain and two RecA-like domains, wherein two or more amino acid residues on the surface of the helicase surrounding the polynucleotide binding domain are connected by an ectopic bond, so that the polynucleotide bound to the polynucleotide binding domain is surrounded by the structure formed after the connection; or

[0008] (b) comprising a polynucleotide binding domain and two RecA-like domains, wherein two or more amino acid residues on the surface of the helicase surrounding the polynucleotide binding domain can be connected by an ectopic bond, so that the polynucleotide bound in the polynucleotide binding domain is surrounded by the connected structure, and at least one of the two or more amino acid residues is a mutant amino acid residue; or

[0009] (c) comprising a polynucleotide binding domain, wherein the polynucleotide binding domain comprises an opening in at least one conformational state, through which a polynucleotide can be debound by the helicase, wherein the helicase forms an ectopic bond between two or more amino acids at the opening (the ectopic bond can prevent the polynucleotide from being debound by the helicase through the opening), and wherein the helicase retains its ability to control the movement of the target polynucleotide; or

[0010] (d) comprising a polynucleotide binding domain, wherein the polynucleotide binding domain comprises an opening in at least one conformational state (a polynucleotide can be debound from the helicase through the opening), wherein the helicase is modified so that it can form an ectopic bond between two or more amino acids at the opening (the ectopic bond can prevent the polynucleotide from being debound from the helicase through the opening), and wherein the helicase retains its ability to control the movement of the target polynucleotide.

[0011] In one embodiment, the ectopic bond does not include an ectopic bond formed with the participation of cysteine, and the ectopic bond includes an ectopic bond formed with the participation of any natural amino acid except cysteine.

[0012] The arbitrary natural amino acid except cysteine ​​is selected from the group consisting of the following amino acids: Ile, Val, Leu, Phe, Met, Ala, Gly, Thr, Ser, Trp, Tyr, Pro, His, Glu, Gln, Asp, Asn, Lys, Arg,

[0013] Preferably, the ectopic bond comprises Lys-His, Lys-Ser, Lys-Thr, Lys-Tyr, Lys-Lys, Lys-Glu, Lys-Asp, Lys-Gln, Lys-Arg, Arg-Glu, Lys-Met, Arg-Asp, Arg-Arg, Tyr-Tyr, Tyr-Trp, Met-Met ectopic bond or a combination thereof;

[0014] and / or, the helicase consists of one or more monomers,

[0015] And / or, the two amino acids forming the isopeptide bond are located in the same domain or in different domains.

[0016] In one embodiment, the helicase is derived from a member of the natural or modified helicase family of the following group: Dda helicase, Pifl-like helicase, Upfl-like helicase, UvrD / Rep helicase, Ski-like helicase, Rad3 / XPD helicase, NS3 / NPH-II helicase, DEAD helicase, DEAHi RHA helicase, RecG-like helicase, REcQ-like helicase, T1R-like helicase, Swi / Snf-like helicase, and Rig-I-like helicase, preferably Dda helicase, more preferably T4-Dda helicase;

[0017] And / or, the helicase is derived from a natural or modified member of the helicase family of the following group: RecD helicase, Upfl helicase, PcrA helicase, Rep helicase, UvrD helicase, Hel308 helicase, Mtr4 helicase, XPD helicase, NS3 helicase, Mssl 16 helicase, Prp43 helicase, RecG helicase, RecQ helicase, T1R helicase, RapA helicase and Hef helicase.

[0018] In one embodiment, the natural or modified Dda helicase is from the Dda helicases in Table 1 and Table 2 disclosed in CN105899678A.

[0019] In one embodiment, the natural or modified Pif1-like helicase is from the Pif1-like helicases in Table 1 and Table 2 disclosed in CN113930406A.

[0020] In one embodiment, an ectopic bond is introduced between the natural amino acid residues in the 1A domain and the 2A domain of the helicase. In one embodiment, the ectopic bond comprises Lys-His, Lys-Ser, Lys-Thr, Lys-Tyr, Lys-Lys, Lys-Glu, Lys-Asp, Lys-Gln, Lys-Arg, Arg-Glu, Lys-Met, Arg-Asp, Arg-Arg, Tyr-Tyr, Tyr-Trp, Met-Met ectopic bond or a combination thereof. In one embodiment, the amino acid side chains are directly connected to form a covalent bond or are connected to form an ectopic bond by a connecting molecule. In one embodiment, the helicase is derived from a Dda helicase, preferably a T4-Dda helicase.

[0021] In one embodiment, the helicase is derived from T4-Dda helicase, and the helicase comprises:

[0022] (1) Tyr-Tyr heterotopic bond formed by x1 and x2;

[0023] (2) Lys-Gln heterotopic bond formed by x3 and x4;

[0024] (3) Tyr-Lys heterotopic bond formed by x1 and x3;

[0025] (4) Tyr-Gln heterotopic bond formed by x1 and x4;

[0026] (5) Tyr-Lys heterotopic bond formed by x2 and x3;

[0027] (6) a Tyr-Gln ectopic bond formed between x2 and x4; or

[0028] (7)Any combination of the above.

[0029] In one embodiment, the helicase comprises any mutant of the 1A domain and / or any mutant of the 2A domain, as long as the helicase retains its ability to control the movement of the target analyte, preferably the target polynucleotide. In one embodiment, the target analyte is modified by methylation, oxidation, damage with one or more proteins or one or more markers, tags or spacers. In one embodiment, the target analyte is a target polynucleotide.

[0030] In a second aspect, the present application provides a polypeptide comprising the 1A domain and the 2A domain that form an ectopic bond from the aforementioned helicase, and a polynucleotide binding domain, and excluding other domains of the helicase.

[0031] In a third aspect, the present application provides a helicase, comprising the polypeptide, wherein the helicase has the ability to control the movement of a target analyte, preferably a target polynucleotide.

[0032] In a fourth aspect, the present application provides a construct comprising a helicase or a polypeptide, and a target polynucleotide bound to its polynucleotide binding domain, wherein two or more amino acid residues on the surface of the helicase surrounding the polynucleotide binding domain are connected by an isopeptide bond, and the bound target polynucleotide is surrounded by the structure after the isopeptide bond connection.

[0033] In one embodiment, the construct comprises an adapter, the target polynucleotide is connected to the adapter, and the construct has the ability to control the movement of the target polynucleotide.

[0034] In one embodiment, the construct comprises two or more helicases. In one embodiment, the helicase may be any of the helicases described above, or a combination thereof.

[0035] In a fifth aspect, the present application provides a polynucleotide comprising a sequence encoding the helicase, the polypeptide, the construct, or consisting of a sequence thereof.

[0036] In a sixth aspect, the present application provides a vector comprising the polynucleotide operably linked to a promoter.

[0037] In a seventh aspect, the present application provides a host cell, comprising the vector.

[0038] In an eighth aspect, the present application provides a method for preparing the helicase, the polypeptide, or the construct, comprising expressing the polynucleotide, transfecting cells with the vector, or culturing the host cells.

[0039] In the ninth aspect, the present application provides a method for controlling the movement of a target analyte, preferably a target polynucleotide, comprising contacting the target polynucleotide with the helicase or polypeptide, or the construct, and thereby controlling the movement of the target analyte, preferably the target polynucleotide.

[0040] In one embodiment, the method is used to control the movement of a target analyte, preferably a target polynucleotide, through a pore.

[0041] In a tenth aspect, the present application provides a method for characterizing a target analyte, preferably a target polynucleotide, comprising:

[0042] (a) contacting a target analyte, preferably a target polynucleotide, with a pore and said helicase or polypeptide, or said construct, such that said helicase controls movement of said target analyte, preferably a target polynucleotide, through said pore; and

[0043] (b) obtaining one or more measurements as the target analyte, preferably target polynucleotide, moves relative to the pore, wherein the measurements represent one or more characteristics of the target polynucleotide and thereby characterize the target analyte, preferably target polynucleotide.

[0044] In one embodiment, the target analyte is selected from one or more of polynucleotides, polypeptides, polysaccharides and lipids, preferably polynucleotides or polypeptides, polysaccharides and lipids linked to polynucleotides, more preferably single-stranded polynucleotides, double-stranded polynucleotides or partially double-stranded polynucleotides; or

[0045] The target analyte is a target polynucleotide, and the one or more characteristics are selected from (i) the length of the target polynucleotide, (ii) the identity of the target polynucleotide, (iii) the sequence of the target polynucleotide, (iv) the secondary structure of the target polynucleotide; and (v) whether the target polynucleotide is modified.

[0046] In one embodiment, the target polynucleotide is modified by methylation, oxidation, damage with one or more proteins or one or more markers, tags or spacers. In one embodiment, one or more characteristics of the target analyte, preferably the target polynucleotide, are measured by electrical measurement and / or optical measurement. In one embodiment, the electrical measurement is current measurement, impedance measurement, tunnel measurement or field effect transistor measurement.

[0047] In one embodiment, the method comprises:

[0048] (a) contacting the target analyte, preferably a target polynucleotide, with a pore and the helicase or the construct, such that the helicase or the construct controls the movement of the target analyte, preferably a target polynucleotide, through the pore; and

[0049] (b) acquiring a current across the pore as the target analyte, preferably target polynucleotide, moves relative to the pore, wherein the current represents one or more characteristics of the target analyte, preferably target polynucleotide, and thereby characterizes the target analyte, preferably target polynucleotide.

[0050] In one embodiment, the method further comprises the step of applying a voltage across the hole to form a complex between the hole and the helicase or construct. In one embodiment, the target analyte is a target polynucleotide, and at least part of the target polynucleotide is double-stranded. In one embodiment, the hole is a nanopore or a transmembrane hole, or the hole is selected from a biological hole, a solid-state hole, or a hole hybridized with a biological solid state. In one embodiment, the biological hole is derived from hemolysin, leukocidin, CsGG, Mycobacterium smegmatis porin A (MspA), porin B, porin C, porin D, outer membrane porin F, outer membrane porin G, outer membrane phospholipase A, Neisseria autotransporter, and WZA; the solid-state hole is derived from a graphene nanopore, a MoS2 nanopore, a BN nanopore, or a PA63 nanopore.

[0051] In the eleventh aspect, the present application provides a method for forming a sensor for characterizing a target analyte, preferably a target polynucleotide, comprising forming a complex between (a) a hole and (b) the helicase or polypeptide, or the construct, and thereby forming a sensor for characterizing the target analyte, preferably a target polynucleotide.

[0052] In one embodiment, the complex is formed by (a) contacting the pore and the helicase or construct in the presence of the target analyte, preferably the target polynucleotide, and (b) applying an electric potential across the pore. In one embodiment, the electric potential is a voltage potential or a chemical potential. In one embodiment, the complex is formed by covalently linking the pore to the helicase or construct.

[0053] In a twelfth aspect, the present application provides a sensor for characterizing a target analyte, preferably a target polynucleotide, comprising (a) a pore and (b) the helicase or polypeptide, or a complex between the constructs.

[0054] In a thirteenth aspect, the present application provides the use of the helicase or polypeptide, or the construct in controlling the movement of a target analyte, preferably a target polynucleotide, through a pore.

[0055] In a fourteenth aspect, the present application provides a kit for characterizing a target analyte, preferably a target polynucleotide, comprising (a) a pore and (b) the helicase or polypeptide, or the construct.

[0056] In one embodiment, the kit further comprises a chip comprising an amphiphilic membrane.

[0057] In a fifteenth aspect, the present application provides a device for characterizing a target analyte, preferably a target polynucleotide, comprising (a) a plurality of holes and (b) a plurality of the helicases or polypeptides, or the constructs.

[0058] In one embodiment, the device comprises: a sensor device capable of supporting a plurality of pores and operable to use the pores and helicase or construct to characterize a target analyte, preferably a target polynucleotide; and at least one port for delivering a material for characterization. In one embodiment, the device comprises: a sensor device capable of supporting a plurality of pores and operable to use the pores and helicase or construct to characterize a target analyte, preferably a target polynucleotide; and at least one memory for storing materials for characterization; a fluidics system configured to controllably provide materials to the sensor device from the at least one memory; and one or more containers for receiving corresponding samples, the fluidics system being configured to selectively provide samples to the sensor device from one or more containers.

[0059] In a sixteenth aspect, the present application provides a method for preparing the helicase, comprising:

[0060] (a) providing a helicase, preferably a Dda helicase, more preferably a T4-Dda helicase; and

[0061] (b) forming an ectopic bond within the helicase protein to prepare the helicase;

[0062] Preferably, in step (b), the step of contacting the helicase with the polynucleotide is also included.

[0063] Preferably, the ectopic bond is formed by catalysis using H2O2, Hemin and H2O2, HRP enzyme and H2O2, transglutaminase, EDC, or Ru, more preferably, HRP enzyme and H2O2.

[0064] In one embodiment, the method further comprises (c) determining whether the obtained helicase is capable of controlling the movement of a target analyte, preferably a target polynucleotide.

[0065] In the seventeenth aspect, the present application provides a method for preparing the construct, comprising connecting the helicase or polypeptide to a linker and thereby preparing the construct.

[0066] In one embodiment, the method further comprises determining whether the obtained construct can control the movement of the target analyte, preferably the target polynucleotide.

[0067] In a seventeenth aspect, the present application provides a group of two or more helicases attached to a target analyte, preferably a target polynucleotide, wherein at least one of the two or more helicases is the aforementioned helicase. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] The drawings described are only schematic and are non-limiting.

[0069] Figures 1 to 4 The effect of enzyme cross-linking under different catalyst additions is shown.

[0070] Figure 5 The locked enzyme cross-linking effect of different enzymes under HRP / H2O2 catalysis according to one embodiment is shown.

[0071] Figure 6 The figure shows the column purification elution process of the locked enzyme mutant based on Tyr-Tyr cross-linking according to one embodiment.

[0072] Figure 7 A PAGE gel image of column purification elution of a nucleic acid-protein complex based on Tyr-Tyr cross-linking according to one embodiment is shown.

[0073] Figure 8 A graph showing an on-machine test signal of a nucleic acid-protein complex based on Tyr-Tyr cross-linking according to one embodiment is shown. DETAILED DESCRIPTION

[0074] It should be understood that different applications of the disclosed products and methods can be adapted according to the specific needs of the field. It should also be understood that the terminology used herein is only for the purpose of describing specific embodiments of the present application and is not intended to be limiting.

[0075] Additionally, as used in the specification and claims, the singular forms "a", "an" and "the" include pluralities unless the context clearly dictates otherwise. For example, reference to "a nucleotide" includes two or more nucleotides, and reference to "a helicase" includes two or more helicases.

[0076] As used herein, the term "comprising" means that any listed elements must be included, and other elements may also be optionally included. "Composed of" means that all unlisted elements are not included. Embodiments defined by each of these terms are within the scope of the present application embodiments.

[0077] As used herein, "nucleotide sequence", "DNA sequence" or "nucleic acid molecule" refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. The term refers only to the primary structure of the molecule. Thus, the term includes double-stranded and single-stranded DNA and RNA.

[0078] The term "nucleic acid" as used herein refers to a single-stranded or double-stranded covalently linked nucleotide sequence, wherein the 3' and 5' ends on each nucleotide are linked by a phosphodiester bond. Nucleotides can be composed of deoxyribonucleotide bases or ribonucleotide bases. Nucleic acids can include DNA and RNA, and can be synthesized and prepared in vitro or isolated from natural resources. Nucleic acids can further include modified DNA or RNA, such as methylated DNA or RNA, or RNA modified after translation, such as 5'-capping with 7-methylguanosine, 3'-end processing, such as cleavage and polyadenylation, and splicing. Nucleic acids can also include synthetic nucleic acids (XNA), such as hexitol nucleic acids (HNA), cyclohexene nucleic acids (CeNA), threose nucleic acids (TNA), glycerol nucleic acids (GNA), locked nucleic acids (LNA) and peptide nucleic acids (PNA). The size of nucleic acids (or polynucleotides) is usually expressed in terms of the number of base pairs (bp) for double-stranded polynucleotides, or in terms of the number of nucleotides (nt) in the case of single-stranded polynucleotides. One thousand bp or nt is equal to one kilobase pair (kb). Polynucleotides of less than about 40 nucleotides in length are often referred to as "oligonucleotides," and may comprise primers used in DNA manipulations, such as by the polymerase chain reaction (PCR).

[0079] A polynucleotide, such as a nucleic acid, is a macromolecule comprising two or more nucleotides. The polynucleotide or nucleic acid may comprise any combination of any nucleotides. The nucleotides may be naturally occurring or artificially synthesized. One or more nucleotides in the polynucleotide may be oxidized or methylated. One or more nucleotides in the polynucleotide may be damaged. For example, the polynucleotide may comprise a pyrimidine dimer. Such dimers are generally associated with damage caused by ultraviolet light and are a major cause of melanoma of the skin. One or more nucleotides in the polynucleotide may be modified, for example with a conventional marker or label. The polynucleotide may comprise one or more nucleotides that are abasic (i.e., lack a nucleobase), or lack a nucleobase and a sugar (i.e., C3).

[0080] The nucleotides in the polynucleotide can be linked to each other in any manner. The nucleotides are usually linked by their sugar and phosphate groups, as in nucleic acids. The nucleotides can be linked by their nucleobases, as in pyrimidine dimers.

[0081] The polynucleotide may be single-stranded or double-stranded. At least a portion of the polynucleotide is preferably double-stranded. The polynucleotide may be a nucleic acid, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The polynucleotide may comprise an RNA chain hybridized to a DNA chain. The polynucleotide may be any synthetic nucleic acid known in the prior art, such as a peptide nucleic acid (PNA), a glycerol nucleic acid (GNA), a threose nucleic acid (TNA), a locked nucleic acid (LNA) or other synthetic polymers having nucleotide side chains. The PNA backbone is composed of repeated N-(2-aminoethyl)-glycine units linked by peptide bonds. The GNA backbone is composed of repeated ethylene glycol units linked by phosphodiester bonds. The TNA backbone is composed of repeated threose groups linked together by phosphodiester bonds. LNA is formed by the above-mentioned ribonucleic acid, with an additional bridging structure connecting the 2' oxygen and 4' carbon in the ribose moiety. Bridged nucleic acids (BNA) are modified RNA nucleotides. They can also be referred to as restricted or inaccessible RNA. BNA monomers can contain 5-, 6- or even 7-membered bridges with a "fixed" C3'-endo sugar puckering. The bridges are synthetically introduced into the 2', 4'-positions of the ribose to produce 2', 4'-BNA monomers.

[0082] The polynucleotide is most preferably ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). The polynucleotide can be of any length. For example, the length of the polynucleotide can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotides or nucleotide pairs. The length of the polynucleotide can be 1000 or more nucleotides or nucleotide pairs, 5000 or more nucleotides or nucleotide pairs or 100000 or more nucleotides or nucleotide pairs.

[0083] Any number of polynucleotides can be studied. For example, the method of the embodiment can involve characterizing 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, 100 or more polynucleotides. If two or more polynucleotides are characterized, they can be different polynucleotides or the same polynucleotide.

[0084] The polynucleotide may be naturally occurring or artificially synthesized. For example, the method may be used to verify the sequence of the prepared oligonucleotide. The method is typically performed in vitro.

[0085] The terms "protein", "polypeptide" and "peptide" are further used interchangeably herein to refer to polymers of amino acid residues as well as variants and synthetic analogs of amino acid residues. Thus, these terms apply to amino acid polymers in which one or more amino acid residues is a synthetic non-naturally occurring amino acid, such as a chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Polypeptides may also undergo maturation or post-translational modification processes, which may include, but are not limited to, glycosylation, proteolytic cleavage, lipidation, signal peptide cleavage, propeptide cleavage, phosphorylation, and the like.

[0086] Conservative substitution replaces amino acid with other amino acid with similar chemical structure, similar chemical property or similar side chain volume. The amino acid introduced can have polarity, hydrophilicity, hydrophobicity, alkalinity, acidity, neutrality or charge similar to the amino acid they replace. Alternatively, conservative substitution can introduce another aromatic or aliphatic amino acid to replace pre-existing aromatic or aliphatic amino acid. Conservative amino acid changes are well known in the art and can be selected according to the properties of the 20 kinds of main amino acids defined in the following table 1. In the case where amino acid has similar polarity, this can also be determined with reference to the hydrophilicity scale of the amino acid side chain in Table 2.

[0087] Table 1 - Chemical properties of amino acids

[0088]

[0089] Table 2 - Hydrophilicity Scale

[0090] Sidechain Hydrophilicity Ile,I 4.5 Val,V 4.2 Leu,L 3.8 Phe,F 2.8 Cys,C 2.5 Met,M 1.9 Ala,A 1.8 Gly,G -0.4 Thr,T -0.7 Ser,S -0.8 Trp,W -0.9 Tyr,Y -1.3 Pro,P -1.6 His,H -3.2 Glu,E -3.5 Gln,Q -3.5 Asp,D -3.5 Asn,N -3.5 Lys,K -3.9 Arg, R -4.5

[0091] It is well known that conservative substitutions between amino acids with similar properties usually do not affect the activity of the peptide sequence. Conservative substitutions are shown in Table 3.

[0092] Table 3 Conservative amino acid substitutions

[0093]

[0094] Polynucleotide sequences can be derived and replicated using standard methods in the art. Suitable methods for site-directed mutagenesis are known in the art and include, for example, combinatorial chain reactions. Polynucleotides encoding the constructs of the embodiments can be prepared using techniques known in the art, such as those described in Sambrook, J. and Russell, D. (2001). Molecular Cloning A Laboratory Manual, 3rd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

[0095] The resulting polynucleotide sequence can then be incorporated into a recombinant replicable vector, such as a cloning vector. The vector can be used to replicate the polynucleotide in a compatible host cell. Thus, the polynucleotide sequence can be prepared by introducing the polynucleotide into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions that cause the vector to replicate. The vector can be recovered from the host cell.

[0096] Since the molecular structures and volumes of the four bases adenine (A), guanine (G), cytosine (C) and thymine (T) that make up DNA are different, when single-stranded DNA (ssDNA) passes through a nanoscale pore driven by a rate-controlling enzyme (such as the helicase in the embodiment of the present application) and an electric field, the differences in the chemical properties of different bases result in different amplitudes of changes in the current caused when passing through the nanopore, protein pore or transmembrane pore, thereby obtaining the sequence information of the measured nucleic acid, such as DNA.

[0097] In an embodiment of a nanopore / protein pore / transmembrane pore sequencing experiment, the nanopore is the only channel for ions to pass through on both sides of the phospholipid membrane. Speed-controlling proteins such as polynucleotide binding proteins (such as the helicase of the present application embodiment) act as motor proteins for nucleic acid molecules such as DNA, pulling the DNA chain so that it passes through the nanopore / protein pore / transmembrane pore in sequence with a step length of a single nucleotide. Whenever a nucleotide passes through the nanopore / protein pore / transmembrane pore, the corresponding pore blocking signal will be recorded. By analyzing these sequence-related current signals through corresponding algorithms, the sequence information of nucleic acid molecules such as DNA can be inferred.

[0098] Helicase

[0099] The present application embodiment provides the helicase of modification, the helicase (Dda helicase) of the DNA dependent ATPase of modification is preferred, more preferably T4-Dda helicase.The modification allows the modified helicase to keep the combination with the analyte preferably polynucleotide for a longer time.The modified helicase retains its ability to control the movement of the analyte preferably polynucleotide.In other words, the modified helicase can still control the movement of the analyte preferably polynucleotide.The degree of movement of the helicase control analyte preferably polynucleotide is usually changed by the modification, as described in detail below.

[0100] In one embodiment, the helicase, preferably the Dda helicase, more preferably the T4-Dda helicase is modified. The modified helicase is usually modified compared to the corresponding wild-type helicase or natural helicase. The helicase of the present application embodiment is artificial or non-natural.

[0101] The ability of a helicase to bind or not bind to a polynucleotide can be determined using any method known in the art. Suitable binding / not binding assays include, but are not limited to, native polyacrylamide gel electrophoresis (PAGE), fluorescence anisotropy, calorimetry, and surface plasmon resonance (SPR, such as Biacore). TM ). Of course, the ability of a helicase to unwind a polynucleotide can be determined by measuring the time it takes for the helicase to control the movement of the polynucleotide. This can also be determined using any method known in the art. The ability of a helicase to control the movement of a polynucleotide is typically analyzed in a nanopore system.

[0102] The modified helicase is a useful tool for controlling the movement of polynucleotides during strand sequencing. In one embodiment, the Dda helicase can operate in at least two active modes (when all the necessary components to promote movement, such as ATP and Mg, are provided to the helicase). 2+The Dda helicase controls the movement of DNA in two modes: when the DNA is captured 5' downwards, and in an inactive mode of operation (when the helicase is not provided with the necessary components to facilitate movement). When all the necessary components to facilitate movement are provided, the Dda helicase moves along the DNA in a 5'-3' direction, but the orientation of the DNA in the nanopore (depending on which end of the DNA is captured) means that the enzyme can be used to move the DNA out of the nanopore against the direction of the applied field, or to move the DNA into the nanopore in the direction of the applied field. When the 3' end of the DNA is captured, the helicase works against the direction of the field applied by the potential, pulling the helical DNA out of the nanopore and into the cis compartment. However, when the DNA is captured into the nanopore 5' downwards, the helicase works in the direction of the field applied by the potential, pushing the helical DNA into the nanopore and into the trans compartment. When the Dda helicase is not provided with the necessary components to facilitate movement, the Dda helicase can bind to the DNA and act as a brake to slow the movement of the DNA as it is pulled into the hole by the applied field. In the inactive mode, it does not matter whether the DNA is captured with the 3' or 5' end down, it is the applied field that pulls the DNA into the nanopore toward the trans side, and the enzyme acts as a brake. When in the inactive mode, the helicase's control of the movement of the DNA can be described in a variety of ways, including ratcheting, sliding, and braking.

[0103] The problem in the sequencing process of polynucleotides, especially 500 nucleotides or more nucleotides, is that the molecular motor controlling the movement of the polynucleotides may be released from the polynucleotides. This allows the polynucleotides to be rapidly pulled through the hole in an uncontrolled manner in the direction of the applied field. The modified helicase of the present application embodiment does not unwind or release from the polynucleotides being sequenced. When the modified helicase controls the polynucleotides to move through the nanopore, the modified helicase can provide the increased polynucleotide read length. The ability of the modified helicase of the present application embodiment to move the entire polynucleotide through the nanopore allows the polynucleotides to be evaluated to be characterized with the accuracy and speed improved than the known methods, such as its sequence. When the chain length increases and it is necessary to have a molecular motor with improved progress, this becomes more important. The modified helicase of the present application embodiment is particularly effective for controlling the movement of 500 nucleotides or more nucleotides, for example 1000 nucleotides, 5000, 10000, 20000, 50000, 100000 or more nucleotides.

[0104] In addition, the use of the modified helicase according to the embodiments of the present application means that lower helicase concentrations can be used.

[0105] The helicase of the modification of the present application embodiment is also a useful tool for isothermal polymerase chain reaction (PCR). In this method, the chain of double-stranded DNA is first separated by helicase and covered by single-stranded DNA (ssDNA)-binding protein. In the second step, two sequence-specific primers are usually hybridized to each edge of the DNA template. Then the primer annealed to the template can be extended using DNA polymerase to prepare double-stranded DNA, and then two newly synthesized DNA products can be used as substrates by the helicase of the present application embodiment, enter the next round of reaction. Therefore, synchronous chain reaction occurs, causing the exponential amplification of the target sequence selected.

[0106] The modified helicase has the ability to control the movement of a polynucleotide. The ability of the helicase to control the movement of a polynucleotide can be analyzed by any method known in the art. For example, the helicase can be contacted with a polynucleotide, and the position of the polynucleotide can be determined using standard methods. The ability of the modified helicase to control the movement of a polynucleotide is analyzed in a nanopore system.

[0107] The modified helicase of the present application embodiment can be separated, separated substantially, purified or purified substantially. If the helicase does not contain any other components such as lipid, polynucleotide, hole monomer or other protein completely, the helicase is separated or purified. If the helicase is mixed with a carrier or diluent that does not interfere with its intended use, the helicase is separated substantially. For example, if the helicase exists in the form of containing less than 10%, less than 5%, less than 2% or less than 1% other components such as lipid, polynucleotide, hole monomer or other protein, the helicase is separated substantially or purified substantially.

[0108] Any helicase, preferably Dda helicase, more preferably T4-Dda helicase can be modified according to the embodiments of the present application. In one embodiment, the Dda helicase is T4-Dda helicase.

[0109] Dda helicases generally contain the following five domains: 1A (RecA-type motor) domain, 2A (RecA-type motor) domain, tower domain, pin domain and hook domain (Xiaoping He et al., 2012, Structure; 20: 1189-1200). These domains can be identified using the following methods: protein modeling, X-ray diffraction measurements of proteins in crystal state (Rupp B (2009). Biomolecular Crystallograph: Principles, Practice and Application to Structural Biology. New York: Gar 1and Science.), nuclear magnetic resonance (NMR) spectroscopy of protein solutions (Mark Rance; Cavanagh, John; Wayne J. Fairbrother; Arthur W. Hunt III; Skelton, N Nicholas J. (2007). Protein NMR spectroscopy: principles and practice (2 nd ed.).Boston:Academic Press.) or cryo-electron microscopy of cold-hydrated proteins (van Heel M, Gowen B, Matadeen R, Orlova EV, Finn R, Pape T, Cohen D, Stark H, Schmidt R, Schatz M, Patwardhan A (2000). "Single-particle electron cryo-microscopy: toward atomic resolution." Q Rev Biophys. 33: 307-69). The structural information of proteins determined by the above methods is publicly available in the Protein Data Bank (PDB).

[0110] In one embodiment, the modified helicase is further modified to reduce its surface negative charge. Surface residues can be identified in the same manner as the Dda domain described above. Surface negative charge is typically surface negatively charged amino acids, such as aspartic acid (D) and glutamic acid (E).

[0111] The helicase is preferably modified to neutralize one or more surface negative charges by: by replacing one or more negatively charged amino acids with one or more positively charged amino acids, uncharged amino acids, non-polar amino acids and / or aromatic amino acids, or by introducing one or more positively charged amino acids, preferably adjacent to one or more negatively charged amino acids. Suitable positively charged amino acids include, but are not limited to, histidine (H), lysine (K) and arginine (R). Uncharged amino acids have no net charge. Suitable uncharged amino acids include, but are not limited to, cysteine ​​(C), serine (S), threonine (T), methionine (M), asparagine (N) and glutamine (Q). Non-polar amino acids have non-polar side chains. Suitable non-polar amino acids include, but are not limited to, glycine (G), alanine (A), proline (P), isoleucine (I), leucine (L) and valine (V). Aromatic amino acids have aromatic side chains. Suitable aromatic amino acids include, but are not limited to, histidine (H), phenylalanine (F), tryptophan (W) and tyrosine (Y).

[0112] Preferred substitutions include, but are not limited to, R for E, K for E, N for E, K for D, and R for D.

[0113] Modification of 1A and 2A domains

[0114] The embodiment provides a modified helicase, forming an ectopic bond between the 1A domain and the 2A domain of the helicase. The operation of introducing non-natural amino acids is relatively cumbersome and costly, while the introduction of disulfide bonds is less stable and easily opened by reducing agents. On the contrary, the introduction of natural side chains into the 1A domain and the 2A domain can form ectopic bonds. The amino acid residues, thereby mediating the formation of stable covalent ectopic bonds, improve the sustainable rate control ability of the enzyme during the sequencing process.

[0115] Eccentric bond

[0116] Heteropeptide bonds are a type of covalent bond formed by the reaction of amino acid R chains in addition to backbone peptide bonds in proteins. Heteropeptide bonds can be formed within protein molecules or between protein molecules in the natural environment. Generally, isopeptide bonds formed within molecules help proteins respond to environmental stress and improve protein stability (DOI:10.1016 / j.tibs.2010.09.007), while isopeptide bonds formed between protein molecules can be used in the food industry (doi:10.1007 / s12223-013-0287-x) or in protein-protein interaction research. The formation of heteropeptide bonds can be divided into three ways: self-catalytic formation within proteins, enzymatic catalysis, and chemical catalysis. Below I will list specific examples of these three types of formation methods.

[0117] Spontaneous formation of covalent bonds within proteins: For example, studies have found that Lys-Asp ectopic bonds (also known as isopeptide bonds) can be spontaneously formed within proteins in a hydrophobic environment and with carboxyl groups as catalysts (DOI: 10.1002 / anie.201004340), and common examples include CnaA / CnaB proteins. Therefore, by forming a hydrophobic environment and introducing specific reactive and catalytic amino acids, ectopic bonds can be spontaneously formed within proteins. This type of ectopic bond can also be transformed into a polypeptide ligase / bisubstrate form, that is, the protein that can spontaneously form an isopeptide bond is divided into a catalytic protein and two polypeptides with side chains that can react to form an ectopic bond. The polypeptides with side chains that can react to form an ectopic bond can be integrated into the site where a covalent bond needs to be formed in the form of a recombinant protein. Examples include the SpyTag / KTag ectopic bond connection catalyzed by SpyLiagse based on CnaB modification (doi / 10.1073 / pnas.ss11113) and the SnoopTagJr / DogTag connection catalyzed by SnoopLigase based on RrgA C-terminal domain modification.

[0118] Enzymatic catalysis: This type of method involves many reactions, such as the dityrosine or trityrosine covalent bond formed by peroxidase (HRP, myeloperoxidase tyrosinas, laccase, etc.) (DOI: 10.1021 / acsbiomaterials.6b00454). This cross-linking reaction can also be catalyzed by G4-hemin nuclease (DOI: 10.1002 / chem.201101941); Lys-Gln heterotopic bond (also known as isopeptide bond https: / / doi.org / 10.1016 / j.ijbiomac.2017.10.115) formed by transglutaminase; Lys-Lys cross-linking catalyzed by lysyl oxidases (doi: 10.1021 / Bm1010195).

[0119] Chemical cross-linking method: Chemical cross-linking produces many ectopic bonds, such as the isopeptide bonds formed between the side chains of D / E acidic amino acids and K / R basic amino acids catalyzed by EDC / NHS / S-NHS, Tyr-Tyr covalent cross-linking catalyzed by H2O2 / Hemin, ruthenium, and cross-linking between D / E and D / E mediated by diazo-containing cross-linkers (doi.org / 10.1021 / acs.analchem.7b03789).

[0120] The types of ectopic bonds in which non-Cys participate include, but are not limited to, Lys-His, Lys-Ser, Lys-Thr, Lys-Tyr, Lys-Lys, Lys-Glu, Lys-Asp, Lys-Gln, Lys-Arg, Arg-Glu, Lys-Met, Arg-Asp, Arg-Arg, Tyr-Tyr, Tyr-Trp, Met-Met, and these amino acid side chains can directly form covalent bonds or can be connected through other linker molecules. In one embodiment, the ectopic bond can be Tyr-Tyr, Lys-Lys, Gln-Lys, Glu-Lys, etc.

[0121] In one embodiment, an ectopic bond is formed between the 1A domain and the 2A domain of a helicase, preferably a Dda helicase, more preferably a T4-Dda helicase. In another embodiment, an ectopic bond is introduced between the natural amino acid residues of the 1A domain and the 2A domain of the helicase.

[0122] In one embodiment, the ectopic bond comprises a Tyr-Tyr ectopic bond, a Lys-Lys ectopic bond, a Gln-Lys ectopic bond, a Glu-Lys ectopic bond or a combination thereof. In one embodiment, the helicase is derived from a T4-Dda helicase, and the helicase comprises: (1) a Tyr-Tyr ectopic bond formed between x1 and x2; (2) a Lys-Gln ectopic bond formed between x3 and x4; (3) a Tyr-Lys ectopic bond formed between x1 and x3; (4) a Tyr-Gln ectopic bond formed between x1 and x4; (5) a Tyr-Lys ectopic bond formed between x2 and x3; (6) a Tyr-Gln ectopic bond formed between x2 and x4; or (7) any combination thereof.

[0123] In one embodiment, the helicase is further modified to reduce its surface negative charge. In one embodiment, one or more negative surface charges are neutralized by replacing one or more negatively charged amino acids with one or more positively charged amino acids, uncharged amino acids, non-polar amino acids and / or aromatic amino acids, or by introducing one or more positively charged amino acids near one or more negatively charged amino acids.

[0124] In one embodiment, the helicase includes any mutant of the 1A domain or any mutant of the 2A domain, as long as the helicase retains its ability to control the movement of the target analyte, preferably the target polynucleotide.

[0125] In one embodiment, the target analyte comprises a polynucleotide, a polypeptide, a polysaccharide, or a lipid, preferably a polynucleotide. In one embodiment, the polynucleotide comprises DNA and / or RNA.

[0126] Variants

[0127] A variant of a helicase, such as a variant of a Dda helicase, is an enzyme having an amino acid sequence that is varied from the amino acid sequence of a wild-type helicase and retains polynucleotide binding activity. Polynucleotide binding activity can be determined using methods known in the art. Suitable methods include, but are not limited to, fluorescence anisotropy, tryptophan fluorescence, and electrophoretic mobility shift assay (EMSA).

[0128] The variant retains helicase activity. This can be determined using a variety of methods. For example, the ability of the variant to translocate along a polynucleotide can be determined using electrophysiological methods, fluorescence analysis, or ATP hydrolysis.

[0129] The variants may include modifications that facilitate processing of the helicase encoding polynucleotide or facilitate activity of the polynucleotide at high salt concentrations and / or room temperature.

[0130] Helicase fragment

[0131] Embodiment provides the fragment of helicase, for example the fragment of Dda helicase (more preferably T4-Dda helicase), it can be used to prepare the helicase of the embodiment of the present application.In one embodiment, polypeptide comprises 1A domain and 2A domain from Dda helicase (preferably T4-Dda helicase) and does not comprise any other domain from Dda helicase, wherein ectopic bond is formed between 1A domain and 2A domain.Described polypeptide can comprise the variant of arbitrarily 1A domain and 2A domain defined above.

[0132] Constructs

[0133] The present application embodiment also provides a construct comprising a Dda helicase or a modified Dda helicase (preferably a modified T4-Dda helicase) of the present application embodiment and an adapter, wherein the helicase is connected to the adapter and the construct has the ability to control the movement of a target analyte, preferably a target polynucleotide. The construct is artificial or non-natural.

[0134] In one embodiment, the construct is a useful tool for controlling the movement of the target analyte, preferably the target polynucleotide, during the strand sequencing process. The construct of the embodiment does not free the modified helicase of the embodiment from the target analyte, preferably the target polynucleotide being sequenced. As the construct controls the displacement of the target analyte, preferably the target polynucleotide through the nanopore, the construct may even provide a longer read length of the target analyte, preferably the target polynucleotide.

[0135] Targeting constructs can also be designed to bind to specific polynucleotide sequences. As discussed in detail below, the adaptor can bind to a specific polynucleotide sequence and thereby target the helicase portion of the construct to that specific sequence.

[0136] The construct has the ability to control the movement of a target analyte, preferably a target polynucleotide. This can be determined as described above.

[0137] The constructs of the present application embodiments can be separated, substantially separated, purified or substantially purified. If the construct is completely free of any other components such as lipids, polynucleotides or pore monomers, the construct is separated or purified. If the construct is mixed with a carrier or diluent that does not interfere with its intended use, the construct is substantially separated. For example, if the construct exists in the form of containing less than 10%, less than 5%, less than 2% or less than 1% of other components such as lipids, polynucleotides or pore monomers, the construct is substantially separated or substantially purified.

[0138] The Dda helicase can be any Dda helicase. Preferred Dda helicases include, but are not limited to, T4-Dda helicase and variants thereof. The variants are as described above.

[0139] The helicase is preferably a modified Dda helicase, more preferably a T-Dda helicase. The helicase of any embodiment may be present in the construct of the embodiment of the present application.

[0140] The helicase is preferably covalently linked to the adapter. The helicase can be linked to the adapter at more than one site, such as two or a single site. The helicase can be linked to the adapter using any method known in the art.

[0141] The helicase and the adapter can be prepared separately and then connected together. The two components can be connected in any configuration. For example, they can be connected by their terminal (i.e., amino terminal or carboxyl terminal) amino acids. Suitable configurations include, but are not limited to, the amino terminal of the adapter is connected to the carboxyl terminal of the helicase and vice versa. Alternatively, the two components can be connected by the amino acids in their sequences. For example, the polynucleotide binding portion can be connected to one or more amino acids in the annular region of the helicase. In a preferred embodiment, the terminal amino acid of the polynucleotide binding portion is connected to one or more amino acids in the annular region of the helicase.

[0142] In a preferred embodiment, the helicase is chemically connected to the adapter, for example, connected by one or more connector molecules. Each connector can have two or more functional ends, such as two, three or four functional ends. Suitable terminal configurations in connectors are known in the art. In another preferred embodiment, the helicase is genetically fused to the adapter. If the entire construct is expressed from a single polynucleotide sequence, the helicase is genetically fused to the adapter. The coding sequences of the helicase and the multi-adapter can be combined in any manner to form a single polynucleotide sequence encoding the construct.

[0143] The helicase and the adapter can be genetically fused in any configuration. The helicase and the polynucleotide binding portion can be fused through their terminal amino acids. For example, the amino terminus of the polynucleotide binding portion can be fused with the carboxyl terminus of the helicase and vice versa. The amino acid sequence of the polynucleotide binding portion is preferably added to the amino acid sequence of the helicase in frame. In other words, the polynucleotide binding portion is preferably inserted into the sequence of the helicase. In this embodiment, the helicase and the distribution are usually connected at two sites, i.e., by the amino terminus and carboxyl terminus of the adapter. If the adapter is inserted into the sequence of the helicase, the amino terminus and carboxyl terminus of the preferred part are very close and are each connected to adjacent amino acids in the sequence of the helicase or its variant. In a preferred embodiment, the adapter is inserted into the annular region of the helicase.

[0144] The helicase can be directly connected to the adapter. The helicase is preferably connected to the part using one or more, such as two or three, connectors as described above. One or more connectors can be designed to limit the mobility of the part. The helicase and / or the adapter can be modified to facilitate the connection of one or more connectors as described above.

[0145] The shearable connector can be used to help separate the construct from the non-connected components and can be used to further control the synthesis reaction. For example, a heterogeneous-bifunctional connector can react with a helicase, but not with the partial reaction. If the free end of the connector is used to connect the helicase protein to a surface, the unreacted helicase from the first reaction can be removed from the mixture. Subsequently, the connector can be sheared to expose the group reacted with the adapter. In addition, according to the order of this ligation reaction, the reaction conditions with the helicase can be optimized first, and then the reaction conditions with the adapter can be optimized after the connector is sheared off. The second reaction can be carried out more directly towards the correct site for reacting with the adapter, because the connector is confined to the region where it has been connected.

[0146] The helicase can be covalently linked to the bifunctional cross-linker before the helicase / cross-linker complex is covalently linked to the adaptor. Alternatively, the moiety can be covalently linked to the bifunctional cross-linker before the bifunctional cross-linker / moiety complex is linked to the helicase. The helicase and the adaptor can be covalently linked to the chemical cross-linker simultaneously.

[0147] Cross-linking of the helicase or moiety itself can be prevented by maintaining a large excess of the connector concentration to the helicase and / or moiety. Alternatively, a "lock and key" setup can be used where two connectors are used. Only one end of each connector can be reacted together to form a longer connector, and the other ends of the connectors are reacted separately with different parts of the construct (i.e., the helicase or moiety).

[0148] The attachment site is selected so that, when the construct is contacted with the polynucleotide, both the helicase and the adaptor can bind to the polynucleotide and control its movement.

[0149] The helicase and the adapter can be used to promote connection. For example, complementary polynucleotides can be used to combine the helicase and the adapter together when the helicase and the adapter are hybridized. The helicase can be bound to a polynucleotide and the adapter can be bound to a complementary polynucleotide. The two polynucleotides can then hybridize with each other. This allows the helicase to be in close contact with the adapter, so that the ligation reaction is more effectively carried out. This is particularly conducive to connecting two or more helicases in the correct direction to control the movement of the target polynucleotide.

[0150] Tags can be added to the construct to facilitate purification of the construct. These tags can then be chemically or enzymatically cleaved if they need to be removed. Fluorophores or chromophores can also be included, which can also be cleaved.

[0151] A simple way to purify the construct is to include different purification tags on each protein (i.e. the helicase and the polynucleotide binding portion), such as a 6His tag and This method is particularly useful if the two proteins are different from each other. Using two tags only allows substances with both tags to be easily purified. If the two proteins do not have two different tags, other methods can be used.

[0152] The constructs can be purified from unreacted proteins based on different DNA processivity properties. In particular, the constructs can be purified from unreacted proteins based on: increased affinity for the target analyte, preferably the target polynucleotide, reduced likelihood of dissociation from the analyte, preferably the polynucleotide after binding, and / or increased read length of the analyte, preferably the polynucleotide when it controls translocation of the analyte, preferably the polynucleotide through the nanopore.

[0153] Targeting constructs can also be designed to bind to specific polynucleotide sequences. The adaptor can bind to a specific polynucleotide sequence and thereby target the helicase portion of the construct to that specific sequence.

[0154] Connector

[0155] In one embodiment, the construct includes an adapter. In one embodiment, the adapter is a polypeptide that can bind to an analyte, preferably a polynucleotide. The adapter preferably can specifically bind to a defined polynucleotide sequence. In some embodiments, the multi-adapter binds to a specific polynucleotide sequence, while binding to a different sequence cannot be detected. The portion that binds to a specific sequence can be used to design a construct that targets the sequence.

[0156] In one embodiment, the adapter has at least one property of interacting with or modifying a polynucleotide. The adapter can modify the polynucleotide by shearing it to form a single nucleotide or a shorter nucleotide chain such as two or three nucleotides. The adapter can modify the polynucleotide by positioning it or moving it to a specific position, i.e. controlling its movement.

[0157] In one embodiment, the adapter is derived from a polynucleotide binding enzyme. A polynucleotide binding enzyme is a polypeptide that can bind to a polynucleotide and can interact with the polynucleotide and modify at least one of its properties. The enzyme can modify the polynucleotide by shearing the polynucleotide into a single nucleotide or a shorter nucleotide chain, such as a dinucleotide or a trinucleotide. The enzyme can modify the polynucleotide by directing or moving it to a specific position. The polynucleotide binding portion does not need to show enzymatic activity, as long as it can bind to the polynucleotide and control its movement. For example, the portion can be derived from an enzyme that has been modified to remove its enzymatic activity or can be used under conditions that prevent it from acting as an enzyme.

[0158] In one embodiment, the adaptor is derived from a nucleolytic enzyme.In one embodiment, preferred enzymes are exonucleases, polymerases, helicases and topoisomerases, such as gyrase.

[0159] In one embodiment, the adapter is connected to the helicase and the target analyte (preferably the target polynucleotide). In one embodiment, the adapter is a nucleic acid. In one embodiment, the adapter is a polynucleotide. In another embodiment, the adapter includes a double-stranded nucleic acid region, which can connect other double-stranded nucleic acids, such as target polynucleotides. In one embodiment, the adapter is a Y-type adapter. In one embodiment, the adapter is composed of 3 DNA chains. In one embodiment, the adapter includes a spacer, preferably a spacer is inserted in the adapter, or the spacer is located at the 5' end or 3' end of a chain. In one embodiment, the adapter is a polynucleotide comprising a spacer. In one embodiment, the adapter is a Y-type polynucleotide comprising a spacer. In one embodiment, the adapter is a polynucleotide, polypeptide, polysaccharide or lipid containing a spacer. The helicase can be stagnant on the spacer of the adapter. By contacting the helicase and the polynucleotide (or polypeptide or polysaccharide or lipid) on the adapter with a transmembrane pore and applying an electric potential, the stagnant helicase can be moved through the spacer on the adapter. Since the helicase cannot pass through the transmembrane pore, the polynucleotide (or polypeptide or polysaccharide or lipid) of the adapter moves along the potential through the transmembrane pore and the force generated moves the helicase through the spacer. In one embodiment, multiple adapters are included. In one embodiment, the adapter is part of the target analyte, or is not part of the target analyte. In one embodiment, other adapters may be interspersed in the target analyte (preferably the target polynucleotide).

[0160] Polynucleotide sequence

[0161] The present application embodiment provides a polynucleotide containing a sequence encoding a helicase of the present application embodiment, a polypeptide of the present application embodiment, or a construct of the present application embodiment. The polynucleotide may contain such a sequence. The polynucleotide may be any polynucleotide discussed above.

[0162] Any of the proteins described herein can be expressed using methods known in the art. Polynucleotide sequences can be isolated and replicated using standard methods in the art. Chromosomal DNA can be extracted from organisms that produce helicases, such as Methanococcus burtonii and / or organisms that produce SSB, such as Escherichia coli. PCR with specific primers can be used to amplify the gene coding sequence of interest. The amplified sequence can then be inserted into a recombinant replication vector such as a cloning vector. The vector can be used to replicate the polynucleotide in a compatible host cell. Therefore, a polynucleotide sequence can be prepared by introducing a polynucleotide encoding a sequence of interest into a replicable vector, including introducing the vector into a compatible host cell, and growing the host cell under conditions that cause the vector to replicate. The vector can be recovered from the host cell. Suitable host cells for cloning polynucleotides are known in the art and are described in more detail below.

[0163] The polynucleotide sequence can be cloned into a suitable expression vector. In the expression vector, the polynucleotide sequence is usually operably linked to a control sequence that can provide expression of the coding sequence by a host cell. The expression vector can be used to express a construct.

[0164] The term "operably linked" refers to a juxtaposition wherein the various components described are in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is linked under conditions compatible with the control sequences in a manner that achieves expression of the coding sequence. Multiple copies of the same or different polynucleotides may be introduced into a vector.

[0165] The expression vector can then be introduced into a suitable host cell. Thus, the construct can be prepared by introducing the polynucleotide sequence encoding the construct into an expression vector, including introducing the vector into a compatible bacterial host cell and growing the host cell under conditions that induce expression of the polynucleotide sequence.

[0166] The vector can be, for example, a plasmid, virus or phage vector with a replication origin, optionally a promoter for expressing the polynucleotide sequence, and optionally a regulatory factor for the promoter. The vector can contain one or more selectable marker genes, such as an ampicillin resistance gene. Promoters and other expression control signals compatible with the host cell (for which the expression vector is designed) can be selected. T7, trc, lac, ara or k promoters are usually used.

[0167] The host cell typically expresses the construct at a high level. A host cell compatible with the expression vector used to transform the host cell is selected for polynucleotide sequence transformation. The host cell is typically bacterial and preferably E. coli. Any cell with a lambda DE3 lysogen, such as Rosetta2(DE3)pLys, C41(DE3), BL21(DE3), JM109(DE3), B834(DE3), TUNER, Origami and Origami B, can express vectors containing a T7 promoter.

[0168] Helicase group

[0169] The present application embodiment also provides the group (series) of two or more helicases that have been connected (or combined) polynucleotide, wherein at least one of the two or more helicases is the helicase of the present application embodiment, preferably Dda helicase, more preferably T4-Dda helicase.The group can include any number of helicases, such as 2,3,4,5,6,7,8,9,10 or more helicases.Any number of helicases can be the helicase of the present application embodiment, preferably Dda helicase, more preferably T4-Dda helicase.All of two or more helicases are preferably the helicase of the present application embodiment, preferably Dda helicase, more preferably T4-Dda helicase.One or more helicases of the present application embodiment, preferably Dda helicase, more preferably T4-Dda helicase can be any helicase discussed above, preferably Dda helicase, more preferably T4-Dda helicase.

[0170] The two or more helicases can be the same or different helicases. For example, if the group includes two or more helicases of the present application embodiments, preferably Dda helicases, more preferably T4-Dda helicases, the helicases of the present application embodiments, preferably Dda helicases, more preferably T4-Dda helicases can be the same or different.

[0171] The group may include any number and combination of helicases of the present application embodiments, preferably Dda helicases, more preferably T4-Dda helicases. The group of two or more helicases preferably includes at least two helicases of the present application embodiments, preferably Dda helicases, more preferably T4-Dda helicases. The group may include two or more helicases, preferably Dda helicases, more preferably T4-Dda helicases. Each helicase, preferably Dda helicases, more preferably T4-Dda helicases include modifications described above, including that 1A domains and 2A domains form ectopic bonds.

[0172] In addition to one or more helicases of the present application embodiments, preferably Dda helicase, more preferably T4-Dda helicase, the group may include one or more helicases that are not a part of the present application embodiments. The one or more helicases may be or are derived from Hel308 helicase, RecD helicase, such as Tral helicase or TrwC helicase, XPD helicase or Dda helicase. The one or more helicases may be any helicase disclosed in the following international applications: International Application No. PCT / GB2012 / 052579 (published as WO 2013 / 057495); PCT / GB2012 / 053274 (published as WO 2013 / 098562); PCT / GB2012 / 053273 (published as WO 2013 / 098561); PCT / GB2013 / 051925 (published as WO 2014 / 013260); PCT / GB2013 / 051924 (published as WO 2014 / 013259) and PCT / GB2013 / 051928 (published as WO 2014 / 013269). 2014 / 013262); and UK Application No. 1318464.3 filed on October 18, 2013. In particular, the one or more helicases are preferably modified to reduce the size of the opening in the polynucleotide binding domain through which the polynucleotide can pass in at least one conformational state and be released from the helicase. This is disclosed in WO 2014 / 013260.

[0173] The two or more helicases in the group may be separated from each other. The two or more helicases in the group may be bound together by the transmembrane pore as the polynucleotide moves through the pore. The two or more helicases in the group may contact each other.

[0174] Preferably, the two or more helicases are not linked to each other except by the polynucleotide. The two or more helicases are preferably not covalently linked to each other.

[0175] The two or more helicases can be connected to each other or covalently connected to each other. The helicases can be connected in any order and using any method. A group of connected helicases can be called a team.

[0176] Method for controlling the movement of a target analyte, preferably a target polynucleotide

[0177] The present application embodiment provides a method for controlling the movement of a target analyte, preferably a target polynucleotide. The method comprises contacting the target analyte, preferably a target polynucleotide, with a helicase of the embodiment, preferably a Dda helicase, more preferably a T4-Dda helicase or a construct of the present application embodiment, and thereby controlling the movement of the target analyte, preferably a target polynucleotide. The method is preferably implemented under an electric potential applied across the hole. As described in detail below, the electric potential applied generally results in the formation of a complex between the hole and the helicase or construct. The electric potential applied can be a voltage potential. Alternatively, the electric potential applied can be a chemical potential. An example thereof is the use of a salt gradient across an amphiphilic layer. Salt gradients are disclosed in Holden et al., J Am Chem Soc. 2007 Jul 11; 129 (27): 8650-5.

[0178] The present application embodiment also provides a method for characterizing the preferred target polynucleotide of target analyte. The method includes (a) contacting the preferred target polynucleotide of target analyte with the helicase of hole and embodiment, preferably Dda helicase, more preferably T4-Dda helicase or the construct of the present application embodiment, so that the helicase or construct control the preferred target polynucleotide of target analyte through the movement of the hole. The method also includes (b) as the preferred polynucleotide of target analyte moves relative to the hole, obtaining one or more measured values, wherein the measured value represents one or more features of the preferred target nucleotide of the target analyte, and thus characterizing the preferred target polynucleotide of target analyte.

[0179] In all methods of the embodiments of the present application, the helicase can be any helicase as described above for the constructs of the embodiments of the present application, including the modified helicases of the embodiments of the present application, preferably Dda helicases, more preferably T4-Dda helicases, and helicases not modified according to the embodiments of the present application, preferably Dda helicases, more preferably T4-Dda helicases.

[0180] Can use any number of helicases of the present application embodiment in these methods, preferably Dda helicase, more preferably T4-Dda helicase.For example, 1,2,3,4,5,6,7,8,9,10 or more helicases can be used.If use two or more helicases of the present application embodiment, preferably Dda helicase, more preferably T4-Dda helicase, they can be identical or different.Suitable number and combination are as described in the group for the present application embodiment above.They can be equally applied to the method for the present application embodiment.

[0181] If two or more helicases are used, they can be connected to each other. The two or more helicases can be covalently connected to each other. The helicases can be connected in any order and using any method. Preferred helicase constructs for the embodiments of the present application are described in International Application No. PCT / GB2013 / 051925 (publication number is WO 2014 / 013260); PCT / GB2013 / 051924 (publication number is WO 2014 / 013259) and PCT / GB2013 / 051928 (publication number is WO 2014 / 013262) and UK Application No.1318464.3 submitted on October 18, 2013.

[0182] If two or more helicases are used, they are preferably not linked to each other except by the polynucleotide. The two or more helicases are more preferably not covalently linked to each other.

[0183] Steps (a) and (b) are preferably carried out under conditions where a potential is applied across the pore as described above. In some cases, the sequence of the target polynucleotide is determined using the current passing through the pore as the polynucleotide moves relative to the pore. This is strand sequencing.

[0184] The method of the embodiment of the present application is used to characterize the target analyte, preferably the target polynucleotide. The polynucleotide is as defined above.

[0185] The whole or only part of the target polynucleotide can be characterized using this method. The target polynucleotide can be any length. For example, the polynucleotide can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotide pairs in length. The polynucleotide can be 1000 or more nucleotide pairs, 5000 or more nucleotide pairs in length or 100000 or more nucleotide pairs in length.

[0186] The target polynucleotide is usually present in any suitable sample. The present application embodiment is usually implemented on a sample known to contain or suspected to contain the target polynucleotide. Alternatively, the present application embodiment can be implemented to a sample to confirm the identity of one or more target polynucleotides known or expected to be present in the sample.

[0187] The sample can be a biological sample. The present application embodiment can be implemented in vitro for samples obtained or extracted from any organism or microorganism. The organism or microorganism is usually ancient nuclear, prokaryotic or eukaryotic, and usually belongs to one of the following five kingdoms: plant kingdom, animal kingdom, fungi, ankaryotic protozoa and protists. The present application embodiment is implemented in vitro for samples obtained or extracted from any virus. The sample is preferably a liquid sample. The sample usually includes the patient's body fluid. The sample can be urine, lymph, saliva, mucus or amniotic fluid, but preferably blood, plasma or serum. Usually, the sample is derived from humans, but can alternatively be from other mammals, such as from commercially raised animals such as horses, cattle, sheep or pigs, or can be pets such as cats or dogs. Alternatively, samples of plant origin are usually obtained from commercial crops, such as cereals, beans, fruits or vegetables, such as wheat, barley, oats, Brassica, corn, soybeans, rice, bananas, apples, tomatoes, potatoes, grapes, tobacco, beans, lentils, sugarcane, cocoa, cotton.

[0188] The sample may be a non-biological sample. The non-biological sample is preferably a liquid sample. Examples of non-biological samples include surgical fluids, water such as drinking water, sea water or river water, and reagents for laboratory tests.

[0189] The sample is usually processed before being used in the present application embodiment, for example, by centrifugation or filtering through a membrane to remove unwanted molecules or cells, such as red blood cells. The test can be performed immediately after obtaining the sample. The sample can also be stored before analysis, preferably below -70°C.

[0190] A pore is a structure that spans a membrane to some extent. It allows hydrated ions to flow across or within the membrane by being driven by an applied potential. A pore typically spans the entire membrane so that hydrated ions can flow from one side of the membrane to the other side of the membrane. However, a pore does not necessarily span the membrane. It can be closed at one end. For example, a pore can be a well in the membrane along which hydrated ions can flow or flow.

[0191] Any pore may be used in the embodiments of the present application. The pore may be biological or artificial. Suitable pores include, but are not limited to, protein pores, polynucleotide pores, and solid-state pores.

[0192] Suitable membranes are preferably amphiphilic layers. An amphiphilic layer is a layer formed by amphiphilic molecules, such as phospholipids, which have hydrophilicity and lipophilicity. Amphiphilic molecules can be synthetic or naturally occurring. An amphiphilic layer can be a monolayer or a bilayer. An amphiphilic layer is typically planar. An amphiphilic layer can be curved. The amphiphilic layer can be supported. The membrane can be a lipid bilayer. A lipid bilayer is formed by two opposing layers of lipids. The two layers of lipids are arranged so that their hydrophobic tail groups face each other to form a hydrophobic interior. The hydrophilic head groups of the lipids face outward toward the aqueous environment on each side of the bilayer. The membrane includes a solid layer. The solid layer can be formed by organic and inorganic materials. If the membrane includes a solid layer, holes are typically present in the amphiphilic membrane or in a layer included in the solid layer, such as holes, wells, gaps, channels, grooves or slits in the solid layer.

[0193] The polynucleotide may be attached to the membrane. This may be accomplished using any known method. If the membrane is an amphiphilic layer, such as a lipid bilayer, the polynucleotide is preferably attached to the membrane via a polypeptide present in the membrane or via a hydrophobic anchor present in the membrane. The hydrophobic anchor is preferably a lipid, a fatty acid, a sterol, a carbon nanotube or an amino acid.

[0194] The polynucleotide can be directly connected to the membrane. The polynucleotide is preferably connected to the membrane through a connector. Preferred connectors include, but are not limited to, polymers, such as polynucleotides, polyethylene glycol (PEG) and polypeptides. If the polynucleotide is directly connected to the membrane, due to the distance between the membrane and the helicase, the characterization cannot be carried out to the end of the polynucleotide, and some data will be lost. If a connector is used, the polynucleotide can be fully characterized. If a connector is used, the connector can be connected to any position of the polynucleotide. The connector is usually connected to the tail polymer of the polynucleotide.

[0195] The connection can be stable or temporary. For some applications, the temporary nature of the connection is preferred. If the stable linker is directly connected to the 5' end or 3' end of the polynucleotide, then due to the distance between the active site of the membrane and the helicase, the characterization can not proceed to the end of the polynucleotide, which will cause the loss of data. If the connection is temporary, then when the end of the connection randomly becomes without membrane, the polynucleotide can be characterized completely. In a preferred embodiment, the polynucleotide is connected to an amphiphilic layer.

[0196] Transmembrane pores or nanopores are preferably transmembrane protein pores that define a channel or pore that allows molecules and ions to translocate from one side of the membrane to the other. The translocation of ionic species through the pore can be driven by a potential difference applied to either side of the pore. A "nanopore" is a protein pore or transmembrane pore in which the smallest diameter of the channel through which a molecule or ion passes is on the order of nanometers (10 -9In some embodiments, the protein pore can be a transmembrane protein pore or a transmembrane pore or a nanopore. The transmembrane protein structure of the transmembrane pore can be a monomer or an oligomer in nature. Typically, the pore comprises a plurality of polypeptide subunits arranged around a central axis, thereby forming a protein-lined channel extending substantially perpendicular to the membrane in which the pore resides. There is no limit to the number of polypeptide subunits. Typically, the number of subunits is 5 to 30, and the number of subunits is suitably 6 to 10. Alternatively, the number of subunits is not defined as in the case of perfringolysin or related large membrane pores. The protein subunit portion that forms the protein-lined channel in the pore typically comprises a secondary structural motif that may include one or more transmembrane β-barrels and / or α-helical portions.

[0197] The method of the embodiment can measure two, three, four or five or more characteristics of the polynucleotide. The one or more characteristics are preferably selected from (i) the length of the polynucleotide, (ii) the identity of the polynucleotide, (iii) the sequence of the polynucleotide, (iv) the secondary structure of the polynucleotide, and (v) whether the polynucleotide is modified. In one embodiment, any combination of (i) to (v) can be measured.

[0198] For (i), the length of the polynucleotide may be measured, for example, by determining the number of interactions between the polynucleotide and the pore or the duration of interactions between the polynucleotide and the pore.

[0199] With respect to (ii), the identity of a polynucleotide can be measured in a variety of ways, and the identity of a polynucleotide can be measured in conjunction with or without measurement of the polynucleotide sequence. The former is relatively simple; the polynucleotide is sequenced and identified. The latter can be accomplished in several different ways. For example, the presence of a particular motif in a polynucleotide can be measured (without measuring the rest of the sequence of the polynucleotide). Alternatively, the measurement of a specific electrical and / or optical signal in the method can identify that the polynucleotide is from a particular source.

[0200] For (iii), the sequence of the polynucleotide can be determined as previously described. Suitable sequencing methods, in particular sequencing methods using electrical measurement methods, are described in Stoddart D et al., ProC Natl Acad Sci, 12; 106 (19) 7702-7, Lieberman KR et al, J Am Chem SoC. 2010; 132 (50) 17961-72, and in International Application WO2000 / 28312.

[0201] For (iv), secondary structure can be measured using a variety of methods. For example, if the method involves an electrical measurement method, the secondary structure can be measured using a change in residence time or a change in the current flowing through the pore. This allows for the differentiation of regions of single-stranded and double-stranded polynucleotides.

[0202] For (v), the presence or absence of any modification may be measured. The method preferably comprises determining whether the polynucleotide is modified by methylation, oxidation, damage, treatment with one or more proteins or with one or more markers, tags or is abasic or lacking nucleobases and sugars. Specific modifications will result in specific interactions with the pore, which can be measured using the following methods. For example, methylcytosine can be distinguished from cytosine based on the current flowing through the pore during its interaction with each nucleotide.

[0203] Various different types of measurements can be performed. This includes, but is not limited to, electrical measurements and optical measurements. Electrical measurements include voltage measurements, capacitance measurements, current measurements, impedance measurements, tunneling measurements (Ivanov AP et al., Nano Lett. 2011 Jan 12; 11 (I): 279-85) and FET measurements (International Application WO 2005 / 124888). Optical measurements can be combined with electrical measurements (Soni GV et al., Rev Sci Instrum. 2010 Jan; 81 (1) 014301). The measurement can be a transmembrane current measurement, such as a measurement of an ion current flowing through the pore. In one embodiment, the electrical measurement or optical measurement can be a conventional electrical or optical measurement.

[0204] Electrical measurements can be performed using standard single-channel recording equipment as described in Stoddart D et al., ProC Natl Acad Sci, 12; 106 (19) 7702-7, Lieberman KR et al, J Am Chem SoC. 2010; 132 (50) 17961-72 and international application WO 2000 / 28312. Alternatively, electrical measurements can be performed using a multi-channel system, such as described in international application WO 2009 / 077734 and international application WO 2011 / 067559.

[0205] The method is preferably performed using an applied potential across the membrane. The applied potential may be a voltage potential. Alternatively, the applied potential may be a chemical potential. An example of this is the use of a salt gradient across the membrane, such as a layer of amphiphilic molecules. Salt gradients are disclosed in Holden et al., J Am Chem SoC. 2007 Jul 11; 129(27): 8650-5. In some cases, the current flowing through the pore as the polynucleotide moves relative to the pore is used to estimate or determine the sequence of the polynucleotide. This is strand sequencing.

[0206] The method may include measuring the current flowing through the hole when the polynucleotide moves relative to the hole. Therefore, the equipment used for the method may also include a circuit capable of applying an electric potential and measuring the electrical signal passing through the membrane and the hole. The method may be performed using a patch clamp or a voltage clamp.

[0207] Can comprise measuring the current flowing through described hole when polynucleotide moves relative to described hole.Suitable conditions for measuring the ion flow through transmembrane protein hole are known in the art and disclosed in the embodiment.Described method is usually carried out by the voltage applied on described film and described hole.The voltage used is usually from +5V to -5V, for example from from +4V to -4V, from +3V to -3V or from +2V to -2V.The voltage used is usually from -600mV to +600V or -400mV to +400mV. The voltage used is preferably in a range having a lower limit selected from -400mV, -300mV, -200mV, -150mV, -100mV, -50mV, -20mV and 0mV and an upper limit independently selected from +10mV, +20mV, +50mV, +100mV, +150mV, +200mV, +300nV and +400mV. The voltage used is more preferably in the range of 100mV to 240mV and most preferably in the range of 120mV to 220mV. By using an increased applied potential, the recognition of different nucleotides by the hole can be increased.

[0208] The method is generally carried out in the presence of any charge carrier, such as a metal salt such as an alkali metal salt, a halide salt such as a chloride salt, such as an alkali metal chloride salt. The charge carrier may include an ionic liquid or an organic salt, such as tetramethylammonium chloride, trimethylphenylammonium chloride, phenyltrimethylammonium chloride or 1-ethyl-3-methylimidazolium chloride. In the exemplary device described above, the salt is present in an aqueous solution in the chamber. Potassium chloride (KCl), sodium chloride (NaCl), cesium chloride (CsCl) or a mixture of potassium ferrocyanide and potassium ferrocyanide are generally used. KCl, NaCl and a mixture of potassium ferrocyanide and potassium ferrocyanide are preferred. The charge carrier may be asymmetric on the membrane. For example, the type and / or concentration of the charge carrier may be different on each side of the membrane.

[0209] The concentration of the salt may be saturated. The concentration of the salt may be 3 M or less, and is typically 0.1 to 2.5 M, 0.3 to 1.9 M, 0.5 to 1.8 M, 0.7 to 1.7 M, 0.9 to 1.6 M or 1 M to 1.4 M. The concentration of the salt is preferably 150 mM to 1 M. The method is preferably performed using a salt concentration of at least 0.3 M, such as at least 0.4 M, at least 0.5 M, at least 0.6 M, at least 0.8 M, at least 1.0 M, at least 1.5 M, at least 2.0 M, at least 2.5 M or at least 3.0 M. High salt concentrations provide a high signal-to-noise ratio and allow the presence of nucleotides to be identified in the context of normal current fluctuations to be indicated by current.

[0210] The method is usually carried out in the presence of a buffer. In the exemplary device described above, the buffer is present in an aqueous solution in the chamber. Any buffer can be used in the method of the present application embodiment. Typically, the buffer is a phosphate buffer. Other suitable buffers are HEPES or Tris-HCl buffer. The method is usually carried out at a pH of 4.0 to 12.0, 4.5 to 10.0, 5.0 to 9.0, 5.5 to 8.8, 6.0 to 8.7, 7.0 to 8.8 or 7.5 to 8.5. The pH used is preferably about 7.5.

[0211] The method can be carried out at a temperature of 0°C to 100°C, 15°C to 95°C, 16°C to 90°C, 17°C to 85°C, 18°C ​​to 80°C, 19°C to 70°C or 20°C to 60°C. The method is typically carried out at room temperature. The method is optionally carried out at a temperature that supports enzyme function, such as about 37°C.

[0212] In one embodiment, the method includes:

[0213] (a) contacting the target analyte, preferably the target polynucleotide, with a pore and a helicase of an embodiment of the present application or a construct of an embodiment of the present application, such that the target analyte, preferably the target polynucleotide, moves through the pore and the helicase or construct controls the target analyte, preferably the target polynucleotide, to move through the pore; and

[0214] (b) acquiring an electric current across the pore as the target analyte, preferably the polynucleotide, moves relative to the pore, wherein the electric current represents one or more characteristics of the target analyte, preferably the polynucleotide, and thereby characterizes the target analyte, preferably the polynucleotide.

[0215] The method can be implemented using any device suitable for studying a membrane / pore system in which the pore is embedded in the membrane. The method can be implemented using a device suitable for sensing the pore. For example, the device comprises a chamber comprising an aqueous solution and a barrier that divides the chamber into two parts. The barrier typically has a gap in which a membrane comprising the pore is formed. Or the barrier forms a membrane in which the pore is present. The method can be implemented using the device described in International Application No. PCT / GB08 / 000562 (WO 2008 / 102120).

[0216] The method may include measuring the current through the hole as the target analyte, preferably the polynucleotide, moves relative to the hole. Therefore, the device may also include a circuit capable of applying a potential across the membrane and the hole and measuring the current signal. The method may be implemented using a patch clamp or a voltage clamp. The method preferably comprises the use of a voltage clamp. The target polynucleotide may be contacted with a helicase or construct and the hole in any order. Preferably, when the target analyte, preferably the target polynucleotide, contacts the helicase or construct and the hole, the target analyte, preferably the target polynucleotide, first forms a complex with the helicase or construct. When a potential is applied across the hole, the target analyte, preferably the target polynucleotide / helicase or construct complex then forms a complex with the hole and controls the target analyte, preferably the polynucleotide, to move through the hole.

[0217] sensor

[0218] The present application embodiment also provides the sensor and method thereof formed for characterizing the preferred target polynucleotide of target analyte.Described method is included in the helicase of hole and embodiment, preferably Dda helicase, more preferably forms complex between the construct of T4-Dda helicase, enzyme or the present application embodiment.Described helicase can be any helicase described above for the construct of the present application embodiment, comprises the helicase of the present application embodiment and the helicase not modified according to the present application embodiment.The Dda helicase of the present application embodiment discussed for the group and method of the present application embodiment of any number and combination can be used.

[0219] The complex can be formed by contacting a hole and a helicase or a construct in the presence of a target analyte, preferably a target polynucleotide, and then applying an electric potential to the hole. The applied electric potential can be a chemical potential or a voltage potential as described above. Alternatively, the complex can be formed by covalently connecting to the helicase or the construct through a hole. The method of covalent connection is known in the art and, for example, disclosed in International Application No. PCT / GB09 / 001679 (publication number is WO2010 / 004265) and PCT / GB10 / 000133 (publication number is WO 2010 / 086603). The complex is a sensor for characterizing a target analyte, preferably a target polynucleotide. The method preferably includes forming a complex between a hole derived from Msp and a helicase of the present application embodiment or a construct of the present application embodiment. Any embodiment of the present application embodiment method discussed above is equally applicable to the method. The present application embodiment also provides a sensor prepared using the method of the present application embodiment.

[0220] Reagent test kit

[0221] The present application embodiment also provides a test kit for characterizing the preferred target polynucleotide of target analyte. The test kit includes the helicase of (a) hole and (b) embodiment, preferably Dda helicase, more preferably T4-Dda helicase, or the construct of the present application embodiment. Any embodiment discussed above for the present application embodiment method is equally applicable to the test kit. The helicase can be any helicase described for the construct of the present application embodiment above, including the helicase of the present application embodiment and the helicase not modified according to the present application embodiment. The test kit can include the helicase of the present application embodiment discussed for the group and method of the present application embodiment using any number and combination, preferably Dda helicase, more preferably T4-Dda helicase.

[0222] The kit may further include components of the membrane, such as phospholipids required to form an amphiphilic layer such as a lipid bilayer. The kit of the present application embodiment may additionally include one or more other reagents or instruments that enable any of the embodiments described above to be implemented. The reagents or instruments include one or more of the following: a suitable buffer (aqueous solution), an instrument for obtaining a sample from a receptor (such as a catheter or an instrument containing a needle), an instrument for amplifying and / or expressing polynucleotides, a membrane as defined above or a voltage clamp or patch clamp device. The reagent present in the kit may be dry so that the liquid sample resuspends the reagent. The kit may also optionally include an instrument that enables the kit to be used in the present application embodiment method or instructions for which patients the method may be used for. The kit may optionally include nucleotides.

[0223] Device

[0224] The present application embodiment also provides a device for characterizing the target analyte, preferably a target polynucleotide. The device includes multiple holes and multiple helicases, preferably Dda helicases, more preferably T4-Dda helicases, multiple helicases of the present application embodiment or multiple constructs of the present application embodiment. The device preferably further includes a specification for implementing the method of the present application embodiment. The device can be any conventional device for the analysis of target analytes, preferably polynucleotides, such as an array or a chip. Any embodiment of the method of the present application embodiment discussed above can be equally applicable to the device of the present application embodiment. The helicase can be any helicase described above for the construct of the present application embodiment, including the helicase of the present application embodiment and the helicase that is not modified according to the present application embodiment. The device may include the helicase of the present application embodiment discussed above for the group and method of the present application embodiment using any number and combination, preferably Dda helicase, more preferably T4-Dda helicase. The device is preferably assembled into a method for implementing the present application embodiment.

[0225] In one embodiment, the device preferably comprises:

[0226] A sensor device capable of supporting a plurality of pores and operable to use the pores and the helicase or construct to characterize a target analyte, preferably a polynucleotide; and

[0227] At least one port for delivering a material to be characterized.

[0228] Alternatively, the device preferably comprises:

[0229] A sensor device capable of supporting a plurality of pores and operable to use the pores and the helicase or construct to characterize a target analyte, preferably a polynucleotide; and

[0230] At least one memory for storing materials for characterization.

[0231] The device more preferably comprises:

[0232] a sensor device capable of supporting the membrane and the plurality of pores and operable to characterize a target analyte, preferably a polynucleotide, using the pores and the helicase or construct;

[0233] at least one memory storing materials for characterization;

[0234] A fluidics system configured to controllably supply material to the sensor device from at least one reservoir; and one or more containers for receiving each sample, the fluidics system being configured to selectively supply samples from one or more containers to the sensor device. The device may be any of those described in International Application No. PCT / GB08 / 004127 (published as WO2009 / 077734), PCT / GB10 / 000789 (published as WO 2010 / 122293), International Application No. PCT / GB10 / 002206 (published as WO 2011 / 067559) or International Application No. PCT / US99 / 25679 (published as WO 00 / 28312).

[0235] Method for preparing helicase

[0236] The present application also provides a method for preparing the modified helicase of the present application. The method includes providing a helicase, preferably a Dda helicase, more preferably a T4-Dda helicase to form the modified helicase of the present application.

[0237] The method preferably further comprises determining whether the helicase can control the movement of the target analyte, preferably a polynucleotide. The analysis performed on it is described above. If the movement of the target analyte, preferably a polynucleotide, can be controlled, the helicase is correctly modified and the helicase of the present application embodiment is obtained. If the movement of the target analyte, preferably a polynucleotide, cannot be controlled, the helicase of the present application embodiment is not obtained.

[0238] Methods of making constructs

[0239] The present application also provides a method for preparing the construct. The method comprises connecting, preferably covalently connecting, a helicase of the present application, preferably a Dda helicase, more preferably a T4-Dda helicase to an adapter. Any helicase and adapter as described above can be used in the method.

[0240] The method preferably further comprises determining whether the construct can control the movement of the target analyte, preferably polynucleotide. The analysis performed on it is described above. If the movement of the target analyte, preferably polynucleotide, can be controlled, the helicase and adapter are correctly connected, and the construct of the present application embodiment is obtained. If the movement of the target analyte, preferably polynucleotide, cannot be controlled, the construct of the present application embodiment is not obtained.

[0241] The above-mentioned prior art is incorporated herein by reference in its entirety.

[0242] The following examples are used to illustrate the embodiments of the present application but are not intended to be limiting.

[0243] Embodiment 1:

[0244] Enzyme cross-linking mediated by different catalytic systems

[0245] Main strand S1: 5'-333333333333333333333333333333- GCGGAGTCAAACGGTAGAAG TCGTTTTTTTTTT(SEQ ID NO:1)-8888- ACTGCTCATTCGGTCCTGCTGAC T(SEQ ID NO:2)-3'

[0246] Antisense strand S2: 5'- CGACTTCTACCGTTTGACTCCGC (SEQ ID NO:3)-3'

[0247] Connector YB: 5'P- GTCAGCAGGACCGAATGA (SEQ ID NO: 4) / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeU / / i2OMeA / / i2OMeG / / i2OMeU / / i2OMeC / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeC / / i2OMeC / / i2OMeG / / i2OMeA / / i2OMeC / / i2OMeC / -3' respectively synthesize the main strand S1, the antisense strand S2 and the connecting strand YB, and mix and anneal the three at a ratio of 1:1.1:1.1 to form an adapter. The annealing treatment is specifically to slowly cool from 95°C to 25°C, during which the cooling amplitude does not exceed 0.1°C / s.

[0248] Four reaction systems were prepared, each with 1uM adapter, 7.5 times the amount of T53 (T4 DDA-E94Y / N365Y, the wild-type T4DDA sequence is shown in SEQ ID NO: 5), and no catalyst was added. 100uM H2O2, 50uM Hemin / 100uM H2O2, 0.1U HRP / 100uM H2O2 were added, mixed and placed at 30°C for 18h, and then TBE PAGE gel was run at 160V for 40min to detect the enzyme cross-linking. The results are shown in Figure 1 As shown. Figure 1 As shown, the nucleic acid protein complex is a complex of an adaptor and a helicase. After adding H2O2, an effective cross-linking product can be formed, and the effect of HRP enzyme catalysis is significantly better than other catalysts.

[0249] Two reaction systems were prepared, each with 1uM adapter, 5 times the amount of Q1 (T4DDA-E93Q) protein, and no catalyst, 0.1U microbial transglutaminase as a catalyst, mixed and incubated at 37°C for 36h, then run TBE PAGE gel at 160V for 40min and detect the enzyme cross-linking. The results are as follows Figure 2 As shown, the nucleic acid-protein complex is a complex of an adaptor and a helicase. After adding microbial transglutaminase, an effective cross-linking product can be formed.

[0250] Two reaction systems were prepared, each with 1uM adapter, 5 times the amount of Q11 (T4DDA-E94G) protein, and no catalyst, 5mM EDC as a catalyst, mixed and incubated at 30°C for 4h, and then run TBE PAGE gel at 160V for 40min to detect the enzyme cross-linking. The results are shown in Figure 3 As shown, the nucleic acid-protein complex is a complex of an adaptor and a helicase, and an effective cross-linking product can be formed after adding EDC.

[0251] Example 2: Ru-catalyzed Tyr-amino lock enzyme reaction

[0252] Main chain S1: 5'-333333333333333333333333333333-GCGGAGTCAAACGGTAGAAGTCGTTTTTTTTTT (SEQ ID NO: 1)-8888-ACTGCTCATTCGGTCCTGCTGAC T (SEQ ID NO: 2)-3'

[0253] Antisense strand S2: 5'-Ru-CGACTTCTACCGTTTGACTCCGC (SEQ ID NO: 3)-3'

[0254] Connecting chain YB: 5'P-GTCAGCAGGACCGAATGA(SEQ ID NO:4) / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeU / / i2OMeA / / i2OMe G / / i2OMeU / / i2OMeC / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeC / / i2OMeC / / i2OMeG / / i2OMeA / / i2OMeC / / i2OMeC / -3'

[0255] The main strand S1, antisense strand S2 and connecting strand YB are synthesized separately, and the three are mixed and annealed at a ratio of 1:1.1:1.1 to form a linker. The annealing treatment is specifically to slowly cool from 95°C to 25°C, during which the cooling amplitude does not exceed 0.1°C / s.

[0256] Prepare two reaction systems, take 2uM adapter, add 4 times the amount of T49 (T4 DDA-E94Y) or 4 times the amount of T53 protein / 1mM 1,4-diamine, mix and incubate at 30℃ for 30min, then add 1.25mM sodium persulfate and place under LED 450nM light for crosslinking (light power 50mw / cm 2 ; distance 15cm), then run TBEPAGE gel at 160V for 40min and detect its enzyme cross-linking. The results are as follows Figure 4 As shown. The nucleic acid protein complex is a complex of the adapter and the helicase. Under Ru photocatalysis, it can be clearly found that the enzyme is cross-linked (Y94-K364 in T49; Y94 and N365Y in T53 are cross-linked with 1,4-butanediamine).

[0257] Example 3: HRP cross-linking reaction of different Tyr-Tyr mutants

[0258] Three reaction systems were prepared, each with 1uM adapter, 7.5 times the amount of T52 (T4DDA-E94Y / G357Y) / T53 / T61 (T4DDA-A372Y) protein, and 0.1U HRP / 100uM H2O2 added, mixed and incubated at 30°C for 18h, then run TBE PAGE gel at 160V for 40min and detect the enzyme cross-linking. The results are as follows: Figure 5 As shown, for the three selected Tyr-Tyr mutants, good lock-enzyme cross-linking effects can be seen under the catalysis of HRP / H2O2.

[0259] Example 4: Preparation of nucleic acid-protein complex based on Tyr-Tyr cross-linking

[0260] The enzyme cross-linking product catalyzed by HRP / H2O2 in Example 1 was added to a DNAPac PA200 column and purified using an elution buffer to remove impurities such as the enzyme that was not bound to the adapter and the incompletely reacted EDC from the column.

[0261] The nucleic acid-protein complex was then eluted with a mixture of 10 column volumes of buffer A and buffer B. The main elution peaks were then pooled, their concentrations were measured, and TBE PAGE gel was run at 160V for 40 minutes. Buffer A: 20mM Na-CHES, 250mM NaCl, 4% (W / V) glycerol, pH 8.6; Buffer B: 20mM Na-CHES, 1M NaCl, 4% (W / V) glycerol, pH 8.6. The elution process was as follows: Figure 6 As shown, each peak in the elution process was collected and detected by TBE PAGE gel running at 160V for 40min. The results are shown in Figure 7 As shown, E3 is the required nucleic acid-protein complex.

[0262] Example 5: On-machine testing of nucleic acid-protein complexes based on Tyr-Tyr cross-linking

[0263] A 10 kb library was prepared by end repair, and the nucleic acid protein complex and library in Example 4 were connected to construct a library. Finally, sequencing was performed on the QNome-3841 of Qi Carbon Technology Co., Ltd., and the actual sequencing signal is as follows Figure 8 As shown, the nucleic acid-protein complex can generate sequencing signals normally, and the signal steps are clear for subsequent base inference. The complete library pass-through signal can be seen. This shows that the helicase that forms the Tyr-Tyr ectopic bond between the 1A domain and the 2A domain can control the movement of the target polynucleotide and can be used for nanopore sequencing of polynucleotides. We subsequently analyzed its sequencing signal and found that it is superior to the traditional disulfide cross-linking (referring to the nucleic acid-protein complex formed by T4Dda-E94C / A360C) in terms of noise and signal-to-noise ratio. The analysis results are shown in Table 3.

[0264] Example 6: Analysis of sequencing accuracy based on Tyr-Tyr cross-linking

[0265] A randomly interrupted Human genome library was prepared by end repair, and the nucleic acid-protein complex or disulfide-crosslinked SAC-M1 (nucleic acid-protein complex formed by T4Dda-E94C / A360C) in Example 4 was connected to the library. Finally, sequencing was performed on QNome-3841 of Qi Carbon Technology Co., Ltd. Under the same small data set training scale, the accuracy based on Tyr-Tyr cross-linking was higher than that of the traditional disulfide cross-linking form, and the analysis results are shown in Table 4.

[0266] Table 3 - Sequencing signals of nucleic acid-protein complexes based on Tyr-Tyr crosslinking

[0267] index T53_35T disulfide-locked enzyme Normalized noise 0.245 0.274 noise 1.991 2.359 Signal-to-Noise Ratio 8.893 7.757

[0268] Table 4 - Analysis of sequencing accuracy based on Tyr-Tyr cross-linking

[0269] name Train loss Val loss Acc Traditional disulfide bond lock enzyme 0.261 0.324 85.36 T53 lock enzyme 0.222 0.279 86.96

[0270] The meanings of the parameters in Table 3 and Table 4 are as follows:

[0271] 1. Normalized noise: The signal value of each read is normalized by the Median Absolute Deviation (MAD), the signal and noise are separated by median filtering, and the root mean square (RMS) value of the noise is calculated as an indicator of normalized noise. The smaller the normalized noise value, the less noise interference the signal level is, that is, the higher the signal clarity.

[0272] 2. Noise: Perform median filtering on the signal value of each read to obtain the filtered noise signal. Calculate the root mean square (RMS) value of the noise signal as an indicator of noise, reflecting the relative intensity of noise. The smaller the noise value, the smaller the noise interference.

[0273] 3. Signal-to-noise ratio: The signal value of each read is normalized by the median absolute deviation (MAD), and the signal and noise are separated by median filtering. The signal-to-noise ratio is expressed as the ratio of signal power to noise power. The larger the signal-to-noise value, the better the signal quality and the smaller the noise interference.

[0274] 4.Train loss: It is the error between the predicted results of the neural network model and the actual results during the training of the training data set.

[0275] 5.val loss: It is the error between the predicted result of the validation data set through the neural network model and the actual result.

[0276] 6.ACC: It is the accuracy of the predicted results of the validation dataset compared with the actual results through the neural network model.

Claims

1. A helicase, wherein (a) comprising a polynucleotide binding domain and two RecA-like domains, wherein two or more amino acid residues on the surface of the helicase surrounding the polynucleotide binding domain are connected by an ectopic bond, so that the polynucleotide bound to the polynucleotide binding domain is surrounded by the structure formed after the connection; or (b) comprising a polynucleotide binding domain and two RecA-like domains, wherein two or more amino acid residues on the surface of the helicase surrounding the polynucleotide binding domain can be connected by an ectopic bond, so that the polynucleotide bound in the polynucleotide binding domain is surrounded by the connected structure, and at least one of the two or more amino acid residues is a mutant amino acid residue; or (c) comprises a polynucleotide binding domain, wherein the polynucleotide binding domain comprises an opening in at least one conformational state through which a polynucleotide can be debound by the helicase, wherein the helicase forms an ectopic bond between two or more amino acids at the opening, and wherein the helicase retains its ability to control the movement of the target polynucleotide; or (d) comprising a polynucleotide binding domain, wherein the polynucleotide binding domain comprises an opening in at least one conformational state, through which a polynucleotide can be debound by the helicase, wherein the helicase is modified so that it can form an ectopic bond between two or more amino acids at the opening, and wherein the helicase retains its ability to control the movement of the target polynucleotide.

2. The helicase according to claim 1, wherein the ectopic bond does not include an ectopic bond formed with the participation of cysteine, and the ectopic bond includes an ectopic bond formed with the participation of any natural amino acid except cysteine, The arbitrary natural amino acid except cysteine ​​is selected from the group consisting of the following amino acids: Ile, Val, Leu, Phe, Met, Ala, Gly, Thr, Ser, Trp, Tyr, Pro, His, Glu, Gln, Asp, Asn, Lys, Arg, Preferably, the ectopic bond comprises Lys-His, Lys-Ser, Lys-Thr, Lys-Tyr, Lys-Lys, Lys-Glu, Lys-Asp, Lys-Gln, Lys-Arg, Arg-Glu, Lys-Met, Arg-Asp, Arg-Arg, Tyr-Tyr, Tyr-Trp, Met-Met ectopic bond or a combination thereof; and / or, the helicase consists of one or more monomers, And / or, the two amino acids forming the isopeptide bond are located in the same domain or in different domains.

3. The helicase according to any one of the preceding claims, wherein the helicase is derived from a member of the natural or modified helicase family of the following group: Dda helicase, Pifl-like helicase, Upfl-like helicase, UvrD / Rep helicase, Ski-like helicase, Rad3 / XPD helicase, NS3 / NPH-II helicase, DEAD helicase, DEAHi RHA helicase, RecG-like helicase, REcQ-like helicase, T1R-like helicase, Swi / Snf-like helicase and Rig-I-like helicase, preferably Dda helicase, more preferably T4-Dda helicase; And / or, the helicase is derived from a natural or modified member of the helicase family of the following group: RecD helicase, Upfl helicase, PcrA helicase, Rep helicase, UvrD helicase, Hel308 helicase, Mtr4 helicase, XPD helicase, NS3 helicase, Mssl 16 helicase, Prp43 helicase, RecG helicase, RecQ helicase, T1R helicase, RapA helicase and Hef helicase.

4. The helicase according to any one of the preceding claims, wherein the helicase is derived from a T4-Dda helicase and comprises: (1) Tyr-Tyr heterotopic bond formed by x1 and x2; (2) Lys-Gln heterotopic bond formed by x3 and x4; (3) Tyr-Lys heterotopic bond formed by x1 and x3; (4) Tyr-Gln heterotopic bond formed by x1 and x4; (5) Tyr-Lys heterotopic bond formed by x2 and x3; (6) a Tyr-Gln ectopic bond formed between x2 and x4; or (7)Any combination of the above.

5. A helicase according to any of the preceding claims, wherein the helicase comprises any mutant of the 1A domain and / or any mutant of the 2A domain, as long as the helicase retains its ability to control the movement of polynucleotides.

6. A polypeptide comprising the 1A domain and the 2A domain that form an ectopic bond, and a polynucleotide binding domain from the helicase according to any one of the preceding claims, and excluding other domains of the helicase.

7. A construct comprising a helicase or polypeptide as described in any one of claims 1-6, and a target polynucleotide bound to its polynucleotide binding domain, wherein two or more amino acid residues on the surface of the helicase surrounding the polynucleotide binding domain are connected by an isopeptide bond, and the bound target polynucleotide is surrounded by the structure after the isopeptide bond connection. 8 . The construct according to claim 7 , comprising an adapter, the target polynucleotide being connected to the adapter, and the construct having the ability to control the movement of the target polynucleotide.

9. The construct according to claim 7, wherein the construct comprises two or more helicases or polypeptides according to any one of claims 1-6.

10. The construct according to claim 8, wherein the target polynucleotide in the adapter is linked to a target analyte, and the construct has the ability to control the movement of the target analyte.

11. A polynucleotide comprising a sequence encoding the helicase according to any one of claims 1 to 5, the polypeptide according to claim 6, or the construct according to any one of claims 7 to 10, or consisting of a sequence thereof.

12. A vector comprising the polynucleotide of claim 11 operably linked to a promoter.

13. A host cell comprising the vector according to claim 12.

14. A method for preparing the helicase according to any one of claims 1 to 5, the polypeptide according to claim 6, or the construct according to any one of claims 7 to 10, comprising expressing the polynucleotide according to claim 11, transfecting cells with the vector according to claim 12, or culturing the host cell according to claim 13.

15. A method for controlling the movement of a target analyte, comprising contacting the target analyte with the helicase or polypeptide described in any one of claims 1-6, or the construct described in any one of claims 7-10, and thereby controlling the movement of the target analyte.

16. The method of claim 15, wherein the method is used to control the movement of a target analyte through a pore.

17. A method for characterizing a target analyte, comprising: (a) contacting a target analyte with a pore and a helicase or polypeptide according to any one of claims 1 to 6 or a construct according to any one of claims 7 to 10, such that the helicase controls the movement of the target analyte through the pore; and (b) obtaining one or more measurements as the target analyte moves relative to the pore, wherein the measurements represent one or more characteristics of the target analyte and thereby characterize the target analyte.

18. The construct according to claim 10, or the method according to 15-17, wherein the target analyte is selected from one or more of polynucleotides, polypeptides, polysaccharides and lipids, preferably polynucleotides or polypeptides, polysaccharides and lipids linked to polynucleotides, more preferably single-stranded polynucleotides, double-stranded polynucleotides or partially double-stranded polynucleotides; or The target analyte is a target polynucleotide, and the one or more characteristics are selected from (i) the length of the target polynucleotide, (ii) the identity of the target polynucleotide, (iii) the sequence of the target polynucleotide, (iv) the secondary structure of the target polynucleotide; and (v) whether the target polynucleotide is modified.

19. The method of any one of claims 17-18, wherein one or more characteristics of the target analyte are measured by electrical and / or optical measurements.

20. The method of claim 19, wherein the electrical measurement is a current measurement, an impedance measurement, a tunneling measurement, or a field effect transistor measurement.

21. A method according to any one of claims 17 to 20, wherein the method further comprises the step of applying a voltage across the pore to form a complex between the pore and the helicase or construct.

22. The method according to any one of claims 17 to 21, wherein the pore is a nanopore or a transmembrane pore, or the pore is selected from a biological pore, a solid-state pore or a hybrid biological and solid-state pore.

23. The method of claim 22, wherein the biological pore is derived from hemolysin, leukocidin, CsGG, Mycobacterium smegmatis porin A (MspA), porin B, porin C, porin D, outer membrane porin F, outer membrane porin G, outer membrane phospholipase A, Neisseria autotransporter, and WZA; The solid-state pores are derived from graphene nanopores, MoS2 nanopores, BN nanopores or PA63 nanopores.

24. A method of forming a sensor for characterizing a target analyte, comprising forming a complex between (a) a pore and (b) a helicase or polypeptide as described in any one of claims 1 to 6 or a construct as described in any one of claims 7 to 10 and thereby forming a sensor for characterizing the target analyte.

25. A sensor for characterizing a target analyte, comprising a complex between (a) a pore and (b) a helicase or polypeptide according to any one of claims 1 to 6, or a construct according to any one of claims 7 to 10.

26. Use of a helicase or polypeptide as claimed in any one of claims 1 to 6, or a construct as claimed in any one of claims 7 to 10, for controlling the movement of a target analyte through a pore.

27. A kit for characterizing a target analyte, comprising (a) a pore and (b) a helicase or polypeptide according to any one of claims 1 to 6, or a construct according to any one of claims 7 to 10.

28. A device for characterizing a target analyte, comprising (a) a plurality of pores and (b) a plurality of helicases or polypeptides according to any one of claims 1-6, or constructs according to any one of claims 7-10.

29. A method for preparing the helicase according to any one of claims 1 to 5, comprising: (a) providing a helicase, preferably a Dda helicase, more preferably a T4-Dda helicase; and (b) forming an ectopic bond within the protein of the helicase to prepare the helicase according to any one of claims 1 to 5; Preferably, in step (b), the step of contacting the helicase with the polynucleotide is also included. Preferably, the ectopic bond is formed by catalysis using H2O2, Hemin and H2O2, HRP enzyme and H2O2, transglutaminase, EDC, or Ru, more preferably, HRP enzyme and H2O2.

30. A method for preparing the construct of any one of claims 7-10, comprising connecting the helicase or polypeptide of any one of claims 1-6 to the adaptor and thereby preparing the construct.

31. A group of two or more helicases attached to a target analyte, wherein at least one of the two or more helicases is the helicase described in any one of claims 1-5.

Images