Efficient gene knock-in system and method

Abstract

The invention provides an efficient gene introduction system and method. Specifically, the invention provides a fusion protein with gene editing and donor recruitment effects, the fusion protein comprises a gene editing element and a sulfur-modified donor nucleic acid binding element, the sulfur-modified donor nucleic acid binding element comprises a sulfur-modified nucleic acid recognition protein, and the gene editing element is a protein with a gene editing function. According to the present invention, the specific binding of the sulfur-modified binding domain (SBD) and the sulfur-modified donor nucleic acid is firstly used to specifically recruit the donor nucleic acid so as to position the donor nucleic acid to the target site, such that the efficient gene knock-in method and the application thereof are achieved. The donor nucleic acid binding element has the advantages of miniaturization, good specificity, high gene introduction efficiency and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to a system and method for efficient gene knock-in, and in particular to a gene knock-in method utilizing the specific binding of a sulfur-modified binding domain and a sulfur-modified donor nucleic acid and an application thereof. Background Art

[0002] Gene editing is a technology that can modify the genome of a living organism. CRISPR protein and gRNA are used to specifically target specific locations in the genome and perform cutting, base editing, guide editing, etc. Currently, gene editing technology is relatively mature in the fields of gene knockout and base editing, but gene knock-in, especially large-fragment gene knock-in, still has the problem of low efficiency.

[0003] Therefore, there is an urgent need in the art to develop a method for efficient gene knock-in and its application. Summary of the invention

[0004] The purpose of the present invention is to provide a method for efficiently performing gene knock-in and its application.

[0005] In a first aspect of the present invention, a fusion protein for improving gene knock-in efficiency is provided, wherein the fusion protein comprises a sulfur-modified binding element and a gene editing element, wherein the sulfur-modified binding element comprises a sulfur-modified nucleic acid recognition protein, and the gene editing element is a gene editing effector protein.

[0006] In another preferred embodiment, the gene editing element can bind to a predetermined nucleic acid region under the guidance of the guide nucleic acid, and introduce the sulfur-modified donor nucleic acid into the vicinity of the predetermined nucleic acid region.

[0007] The sulfur-modified binding element can specifically bind to the sulfur-modified donor nucleic acid, thereby recruiting the sulfur-modified donor nucleic acid to a predetermined nucleic acid region, thereby improving the gene knock-in efficiency.

[0008] In another preferred embodiment, the gene editing element is selected from the following group: CRISPR / Cas9, CRISPR / Cas12, CRISPR / Cas14, TnpB, IscB, IsrB, Fanzor, zinc finger nuclease (Zinc-finger nuclease, ZFN), transcription activator-like effector nuclease (transcription activator-like effector nuclease, TALEN), Argonaute nuclease or its mutants.

[0009] In another preferred embodiment, the gene editing element can be a nickase or a catalytically inactive nuclease with positioning activity but lacking cleavage activity, such as dCas9 (dead cas9), a zinc finger domain, a transcriptional activator-like effector factor, and the like.

[0010] In another preferred embodiment, the gene editing effector protein is selected from the following group: SpCas9, SaCas9, LbCas12a, AsCas12a or other proteins with gene editing function.

[0011] In another preferred embodiment, the sulfur-modified donor nucleic acid contains a homology arm structure homologous to a predetermined nucleic acid region.

[0012] In another preferred embodiment, the sulfur-modified donor nucleic acid contains sulfur modification in at least one strand.

[0013] In another preferred embodiment, the sulfur modification is phosphorothioylation modification.

[0014] In another preferred embodiment, the sulfur-modified base may be a single base.

[0015] In another preferred embodiment, the sulfur-modified bases may be N consecutive bases (1≤N≤100).

[0016] In another preferred embodiment, the sulfur-modified bases may be N discontinuous bases (1≤N≤200) per KB donor synthesis length.

[0017] In another preferred embodiment, the sulfur-modified base is preferably C or G.

[0018] In another preferred embodiment, the sulfur-modified bases may be located at both ends or in the middle of the donor nucleic acid.

[0019] In another preferred embodiment, the sulfur-modified donor nucleic acid may have other chemical modifications besides sulfur modification, such as methylation modification, methoxy modification, etc.

[0020] In another preferred embodiment, based on the difference in the nucleic acid length between the two homologous arms of the sulfur-modified donor nucleic acid and the nucleic acid length between the homologous arms on the genome, the system can perform gene knock-in, deletion, replacement and the like, preferably, performing gene knock-in operations.

[0021] In another preferred embodiment, the sulfur-modified donor nucleic acid is a linear single-stranded or double-stranded nucleic acid, or a double-stranded nucleic acid with sticky ends.

[0022] In another preferred embodiment, the sulfur-modified donor nucleic acid is a circular single-stranded or double-stranded nucleic acid.

[0023] In another preferred embodiment, the sulfur-modified donor nucleic acid may encode a gene to be knocked in.

[0024] In another preferred embodiment, the sulfur-modified donor nucleic acid may contain homology arm sequences that are homologous to the sequences on both sides of the knock-in site.

[0025] In another preferred embodiment, the sulfur-modified donor nucleic acid can be directly synthesized by solid phase synthesis.

[0026] In another preferred embodiment, the sulfur-modified donor nucleic acid can be obtained by amplifying primers containing sulfur modifications.

[0027] In another preferred embodiment, the sulfur-modified donor nucleic acid can be obtained by adding α-thiol deoxynucleotide triphosphates (S-dNTP) to the amplification reaction.

[0028] In another preferred embodiment, the sulfur-modified donor nucleic acid can be obtained by fermentation in a strain having sulfur-modification function.

[0029] In another preferred embodiment, the sulfur-modified nucleic acid recognition protein is a sulfur-binding domain protein (SBD), which specifically recognizes sulfur-modified nucleic acids.

[0030] In another preferred embodiment, the sulfur-modified donor nucleic acid refers to one or more OH (O or O - ) is SH (or S - ) and / or one or more =O is replaced by =S.

[0031] In another preferred embodiment, the sulfur-modified donor nucleic acid refers to Modified to or its corresponding isomers.

[0032] In another preferred embodiment, the sulfur-binding domain protein (SBD) binds to RNA / RNA double strands or RNA / DNA hybrid double strands.

[0033] In another preferred embodiment, the sulfur-modified donor nucleic acid comprises sulfur-modified DNA, the DNA may be single-stranded or double-stranded DNA, the DNA sequence length is greater than 15 nt (15 bp) and less than 50 KB, contains one or more sulfur modifications, and may also contain homologous sequences to the targeted nucleic acid region on one or both sides.

[0034] In another preferred embodiment, the sulfur-binding domain protein (SBD) includes: SBDsco, SBDspr, SBDmmo, SBDhga, SBDeco, SBDtcu, or SBD homologous protein, preferably SBDspr or SBDmmo, SBDhga.

[0035] In another preferred example, the sulfur-binding domain protein (SBD) is derived from a species selected from the group consisting of MMoMcrA, ScoMcrA, SprMcrA, HgaMcrA, and EcoMcrA; preferably, derived from SprMcrA or HgaMcrA.

[0036] In another preferred embodiment, the sulfur-modified donor nucleic acid is a sulfur-modified DNA or a nucleic acid containing other modifications at the same time.

[0037] In another preferred embodiment, the SBD homologous protein can be bound to a sulfur-modified oligonucleotide and has one or more of the following conditions:

[0038] C1) a protein domain having a sulfur-modified oligonucleotide (including nucleotides including deoxyribonucleic acid DNA or ribonucleic acid RNA) binding activity;

[0039] C2) the identity with the amino acid sequence of any one of SBDsco, SBDspr, SBDmmo, SBDhga, SBDeco, SBDtcu is ≥20% (preferably ≥50%, more preferably ≥70%, most preferably ≥80% or ≥90%);

[0040] C3) contains a PLW motif or an ALW motif (e.g., P75-L79-W85 in SBDmmo; P79-L83-W89 in SBDspr; A73-L77-W83 in SBDtcu).

[0041] In another preferred embodiment, the gene editing element is selected from the following group: CRISPR / Cas9, CRISPR / Cas12, CRISPR / Cas14, TnpB, IscB, IsrB, Fanzor, ZFN, TALEN, Argonaute nuclease, etc.

[0042] In another preferred embodiment, the gene editing element comprises guide RNA or guide DNA.

[0043] In another preferred embodiment, the gene editing element and the sulfur-modification binding element are directly connected via a chemical bond (such as a peptide bond) or via a linker.

[0044] In another preferred embodiment, the connector includes a flexible connector and a non-flexible connector.

[0045] In another preferred embodiment, the fusion protein contains one or more SBDs.

[0046] In another preferred example, the multiple SBDs may be the same or different.

[0047] In another preferred example, the multiple SBDs may be located on the same side (eg, the left side or the right side) of the gene editing element, or may be located on both sides of the gene editing element.

[0048] In another preferred embodiment, the structure of the fusion protein is shown in the following formula I or I' or I":

[0049] ALB (I)

[0050] BLA (I')

[0051] ALBLA (I”)

[0052] In the formula,

[0053] A is a sulfur-modified binding element;

[0054] B is a gene editing element;

[0055] L is each independently none or a linker peptide;

[0056] Each "-" is independently a chemical bond.

[0057] In another preferred embodiment, the chemical bond includes a peptide bond or a covalent bond.

[0058] In another preferred embodiment, the sequence of the fusion protein is shown in SEQ ID No:4.

[0059] In a second aspect of the present invention, a reaction system for gene knock-in is provided, the reaction system comprising:

[0060] (a) the fusion protein according to the first aspect of the present invention; and

[0061] (b) a guide nucleic acid, wherein the guide nucleic acid guides the fusion protein to specifically bind to a predetermined region of the nucleic acid sequence to be gene knocked in;

[0062] (c) a donor nucleic acid to be knocked into a gene, wherein the donor nucleic acid contains a sulfur modification;

[0063] Wherein, the nucleic acid to be knocked into the gene is a linear or circular single-stranded DNA or double-stranded DNA.

[0064] In another preferred embodiment, the guide nucleic acid is a guide RNA of the CRISPR / Cas system.

[0065] In another preferred embodiment, the length of the guide RNA is 15-100 nt, preferably 16-50 nt, and more preferably 18-40 nt.

[0066] In another preferred embodiment, the donor nucleic acid is a sulfur-modified donor nucleic acid.

[0067] In another preferred embodiment, the reaction system further comprises: (d) a buffer solution.

[0068] In another preferred embodiment, the concentration of the donor nucleic acid in the reaction system (especially the in vitro reaction system) is 0.001-10000 μM, preferably 0.01-1000 μM, and more preferably 0.1-100 μM.

[0069] In another preferred embodiment, in the reaction system, the ratio of the donor nucleic acid to the cells to be knocked into the gene is 0.001 to 1000 pmol to 10 5 cells, preferably 0.01 to 100 pmol to 10 5 cells, more preferably 0.1 to 10 pmol to 10 5 cell.

[0070] In another preferred embodiment, in the reaction system, the ratio of the donor nucleic acid to the cells to be knocked into the gene is 0.001 to 1000 μg to 10 5 cells, preferably 0.01 to 100 μg to 10 5 cells, preferably 0.1 to 10 μg to 10 5 cell.

[0071] In another preferred embodiment, the length of the sulfur-modified donor nucleic acid is 20 nt (single-stranded nucleic acid) or 20 bp (double-stranded nucleic acid) to 100,000 nt or 100,000 bp.

[0072] In another preferred embodiment, the cell to be knocked into gene comprises the nucleic acid to be knocked into gene derived from a plant, an animal, an insect, a microorganism, a virus, or a combination thereof, preferably a human genomic nucleic acid.

[0073] In another preferred embodiment, the sulfur-modified nucleic acid recognition protein in the fusion protein is a sulfur-binding domain protein (SBD).

[0074] In another preferred embodiment, the SBD is selected from the following group: the identity with the amino acid sequence of any one of SBDsco, SBDspr, SBDmmo, SBDhga, SBDeco, SBDtcu or a combination thereof is ≥20%; preferably, the SBD is SBDspr and SBDhga, and more preferably, the SBD is SBDspr.

[0075] In the third aspect of the present invention, a nucleic acid is provided, wherein the nucleic acid encodes the fusion protein described in the first aspect of the present invention.

[0076] In another preferred embodiment, the nucleic acid is a linear sequence.

[0077] In another preferred embodiment, the nucleic acid has a 5'-3' (5' to 3') structure of Formula II:

[0078] P1-X1-L1-X2-X3(II)

[0079] P1-X2-L1-X1-X3(II');

[0080] Wherein, P1 is the first promoter sequence;

[0081] X1 is the coding sequence of sulfur-binding domain protein (SBD);

[0082] L1 is a coding sequence without or with a linker sequence;

[0083] X2 is the coding sequence of the gene editing element;

[0084] X3 is the terminator sequence;

[0085] Furthermore, each "-" is independently a bond.

[0086] In another preferred embodiment, the nucleic acid construct contains one or more SBD coding sequences.

[0087] In another preferred embodiment, the multiple SBD coding sequences may be the same or different.

[0088] In another preferred example, the multiple SBD coding sequences may be located on the same side (eg, the left side or the right side) of the gene editing element coding sequence, or may be located on both sides of the gene editing element coding sequence.

[0089] In the fourth aspect of the present invention, a vector is provided, wherein the vector contains the nucleic acid described in the third aspect of the present invention.

[0090] In another preferred embodiment, the vector comprises an expression vector.

[0091] In another preferred embodiment, the vector includes plasmid, mRNA, and viral vector.

[0092] In another preferred embodiment, the vector is delivered in the form of DNA, mRNA or nucleic acid-protein complex.

[0093] In another preferred embodiment, the vector further comprises sgRNA.

[0094] In the fifth aspect of the present invention, a genetically engineered cell is provided, wherein the cell contains the vector described in the fourth aspect of the present invention, or the nucleic acid described in the third aspect of the present invention is integrated into its genome.

[0095] In another preferred embodiment, the cell is transformed or transfected by the vector or nucleic acid.

[0096] In another preferred embodiment, the cells are also transfected with a guide nucleic acid or an expression vector thereof.

[0097] In another preferred embodiment, the cells are also transfected with a sulfur-modified donor nucleic acid.

[0098] In another preferred embodiment, the cells include eukaryotic cells and prokaryotic cells.

[0099] In another preferred embodiment, the cells include bacteria, yeast, mammalian cells, and plant cells.

[0100] In a sixth aspect of the present invention, a kit is provided, the kit comprising:

[0101] (a1) a first container, and the fusion protein according to the first aspect of the present invention, or its coding sequence, or a vector containing the coding sequence, located in the first container; and

[0102] (b1) a second container, and a guide nucleic acid in the second container,

[0103] Wherein, the gene editing element in the fusion protein can bind to a predetermined nucleic acid region under the guidance of the guide nucleic acid, and introduce the sulfur-modified donor nucleic acid into the vicinity of the predetermined nucleic acid region.

[0104] In another preferred embodiment, the guide nucleic acid is a guide RNA of the CRISPR / Cas system.

[0105] In a seventh aspect of the present invention, a method for improving gene knock-in efficiency is provided, comprising the steps of:

[0106] The fusion protein described in the first aspect of the present invention is specifically combined with the sulfur-modified donor nucleic acid, and the sulfur-modified donor nucleic acid is recruited to a predetermined nucleic acid region, thereby improving the gene knock-in efficiency.

[0107] In another preferred embodiment, the method further comprises the following steps: in the presence of a guide nucleic acid, the fusion protein described in the first aspect of the present invention forms a "nucleic acid to be knocked in-guide nucleic acid-gene editing element-sulfur modification binding element-sulfur modification donor nucleic acid" complex with the nucleic acid to be knocked in, so that the sulfur modification donor nucleic acid is knocked in at a predetermined nucleic acid region or adjacent position.

[0108] In another preferred embodiment, the nucleic acid to be knocked into the gene is selected from the following group: linear single-stranded DNA, linear double-stranded DNA, circular single-stranded DNA, circular double-stranded DNA, or a combination thereof

[0109] In another preferred embodiment, the nucleic acid to be gene knocked in is human genomic DNA.

[0110] In another preferred embodiment, the nucleic acid to be knocked into the gene is an isolated, intracellular, or cell-free target nucleic acid.

[0111] In another preferred embodiment, the method includes an in vivo method and an in vitro method.

[0112] In another preferred embodiment, the method is a gene therapy method.

[0113] In another preferred embodiment, the method comprises:

[0114] (i) transfecting the fusion protein or its encoding nucleic acid, guide nucleic acid, and sulfur-modified donor nucleic acid into cells;

[0115] (ii) The gene editing element of the gene knock-in system is used to target the target sequence of the cell genome and cut it, and the sulfur-modified binding element is used to recruit the sulfur-modified donor nucleic acid to the vicinity of the target sequence, thereby promoting its homologous recombination with the target sequence, thereby achieving the purpose of improving the gene knock-in efficiency.

[0116] In the eighth aspect of the present invention, a gene therapy method is provided, which comprises the steps of: administering the fusion protein or its coding sequence described in the first aspect of the present invention to a subject in need; and a guide nucleic acid that specifically binds to the nucleic acid to be gene-knocked in.

[0117] In another preferred embodiment, the method further comprises the step of administering the sulfur-modified donor nucleic acid to a subject in need thereof.

[0118] In another preferred embodiment, the guide nucleic acid binds to a predetermined region of a pathogenic gene.

[0119] In another preferred embodiment, the sulfur-modified donor nucleic acid encodes a sequence required for gene therapy.

[0120] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0121] Figure 1 The amino acid sequence alignment of SBD homologous proteins is shown. The red triangles indicate the PLW or ALW motifs.

[0122] Figure 2 The chemical structure of sulfur-modified DNA is shown.

[0123] Figure 3 The binding activity of the sulfur-modified DNA binding domain to sulfur-modified nucleic acids is shown, where Rp and Sp represent two stereo configurations, respectively. p Configuration and S p Configuration.

[0124] Figure 4 A schematic diagram of the process of gene knock-in using sulfur-modified nucleic acids and sulfur-modified nucleic acid recognition proteins is shown.

[0125] Figure 5 Schematic diagrams of delivery via plasmid, mRNA, and nucleic acid-protein complex (RNP) are shown.

[0126] Figure 6 The figure shows the binding effect of Cas9-SBDHga fusion protein (C9H) on DNA containing different numbers of sulfur modifications, where M represents marker, D represents DNA, D-2S represents DNA with 2 sulfur modifications added, and D-5S represents DNA with 5 sulfur modifications added.

[0127] Figure 7 The diagram shows the gene knock-in result of Cas9-SBDHga fusion protein (C9H), wherein (a) is the Sanger detection result, and (b) is the gel electrophoresis experiment result.

[0128] Figure 8 The result graph shows that Cas9-SBDHga fusion protein (C9H) and sulfur-modified donor nucleic acid improve the efficiency of gene knock-in in cells, wherein donor_CK indicates that there is no sulfur modification on the donor nucleic acid, and donor_S indicates that there is sulfur modification on the donor nucleic acid.

[0129] Figure 9 The figure shows the results of gene knock-in efficiency detection by flow cytometry, in which area P1 is living cells, area P2 is single cells, and area P3 is GFP-positive cells.

[0130] Figure 10 The figure shows the knock-in efficiency of the fusion protein under different sulfur-modified donor nucleic acid addition conditions (0.7, 1.8, 4.5, 9.0 μg), where C9H-2L represents the Cas9-SBDHga fusion protein.

[0131] Figure 11The results of gene knock-in efficiency of fusion proteins delivered in the form of protein-nucleic acid complexes under different sulfur-modified donor nucleic acid addition conditions (0.7, 1.8, 4.5, 9.0 μg) are shown, where C9H-2L represents Cas9-SBDHga fusion protein.

[0132] Figure 12 The figure shows the gene knock-in efficiency results of the fusion protein in the form of plasmid delivery under different sulfur-modified donor nucleic acid addition conditions (0.01, 0.02, 0.04, 0.09, 0.18, 0.45, 0.9 and 1.79 μg), where C9H-2L represents the Cas9-SBDHga fusion protein.

[0133] Figure 13 The figure shows the gene knock-in efficiency results of the fusion protein in the form of mRNA delivery under different sulfur-modified donor nucleic acid addition conditions (0.04, 0.14, 0.36, 0.90 and 1.79 μg), where C9H-2L represents the Cas9-SBDHga fusion protein.

[0134] Figure 14 The figure shows the effect of different SBDs and Cas9 coupling on the knock-in efficiency in cells under the condition of 0.04 μg sulfur-modified donor nucleic acid addition, among which SBDNa, SBDBaq, SBDEco, SBDGsu, SBDHga, SBDMmo, SBDSga, and SBDSpr represent SBDs from Anaeromyxobacter sp.K, Bacillus aquimaris, Escherichia coli, Geobactersulfurreducens, Hahella ganghwensis, Morganella morganii, Streptomycesgancidicus, and Streptomyces pristinaespiralis, respectively. DETAILED DESCRIPTION

[0135] After extensive and in-depth research and a large number of screenings, the inventors have developed for the first time a gene knock-in system with novel design and high efficiency. The gene knock-in system of the present invention is based on the sulfur-modified DNA recognition domain. By fusing the gene editing element with the sulfur-modified binding element, the sulfur-modified donor nucleic acid is recruited to the target area using the sulfur-modified binding element, thereby performing efficient gene knock-in. The experimental results show that the gene knock-in system of the present invention can efficiently knock-in the reporter gene into the human genome. On this basis, this invention is completed.

[0136] the term

[0137] As used herein, the term "sulfur modification" may also be referred to as "phosphothioylation modification", which refers to the modification of the guide element of the single-base editor described herein; specifically, it refers to the modification in which the non-bridging oxygen atoms on the phosphate backbone of DNA or RNA are replaced by sulfur atoms.

[0138] As used herein, the terms "sulfur-modified nucleic acid recognition protein", "sulfur-binding domain protein" and "SBD" are used interchangeably and refer to proteins that can specifically recognize sulfur-modified nucleic acids.

[0139] As used herein, the term "sulfur-modified nucleic acid" or "nucleic acid modified with sulfur" means that the nucleic acid is modified with a sulfur group; wherein the nucleic acid can be RNA or DNA.

[0140] As used herein, "insertion" refers to the insertion of a nucleotide base within a nucleic acid. Such insertions can result in frameshift mutations within the coding region of a gene.

[0141] Gene knock-in system

[0142] As used herein, the terms "gene knock-in system of the present invention" and "fusion protein of the present invention" are used interchangeably and refer to the fusion protein described in the first aspect of the present invention, that is, comprising at least one gene editing element and at least one sulfur-modified binding element, wherein the sulfur-modified binding element comprises a sulfur-modified nucleic acid recognition protein, and the gene editing element is a gene editing effector protein.

[0143] Sulfur Binding Domain (SBD)

[0144] Sulfur-binding domain protein is abbreviated as SBD, which is the recognition domain of restriction endonucleases. In the present invention, a fusion protein is constructed, and SBD serves as a donor recruitment domain to bring sulfur-modified donor nucleic acid to the DNA region to be knocked into the gene.

[0145] The SBD can be located at the N-terminus or C-terminus of the fusion protein (the SBD is located at the C-terminus of the fusion protein in the embodiment). There can also be multiple SBD domains in the fusion protein, such as in the form of SBD-Cas9-SBD, to improve the efficiency of gene knock-in. In addition, SBD and gene editing elements can also have a variety of permutations and combinations, such as SBD-SBD-Cas9, Cas9-SBD-SBD, and the like.

[0146] In the present invention, representative sulfur-binding domain proteins (SBD) include: SBDeco, SBDmmo, SBDbaq, SBDspr, SBDsga, SBDana, SBDhga, SBDgsu, SBDtcu or other SBD homologous proteins.

[0147] The amino acid sequence alignment results of some representative SBD homologous proteins are shown in Figure 1 .

[0148] Gene editing components

[0149] The gene knock-in system of the present invention further comprises a gene editing element. It should be understood that there is no particular limitation on the gene editing element that can be used in the present invention. It should be understood that the gene editing element applicable to the present invention includes wild-type and mutant gene editing elements, as long as the gene editing element can target a specific nucleic acid region, the targeted region can be double-stranded cut, single-stranded cut, or only bound without cutting.

[0150] In the present invention, representative gene editing elements include (but are not limited to) the following gene editing proteins and their guide nucleic acids: CRISPR / Cas9, CRISPR / Cas12, CRISPR / Cas14, TnpB, IscB, IsrB, Fanzor, ZFN, TALEN, Argonaute nuclease; or mutants such as Cas9 nickase H840A, Cas9 nickase D10A, dCas9, Cas12a nickase, dCas12a, etc.

[0151] In the present invention, a preferred gene editing element is SpCas9 derived from Streptococcus pyogenes.

[0152] Sulfur-modified nucleic acids

[0153] In the present invention, the sulfur-modified nucleic acid refers to an OH (O or O - ) is SH (or S - ) and or a =0 is replaced by =S.

[0154] In another preferred embodiment, the sulfur-modified nucleic acid refers to Modified to or its corresponding isomers.

[0155] A representative structure of sulfur-modified nucleic acid is shown in Figure 2 shown.

[0156] The binding activity of the sulfur-modified DNA binding domain to certain sulfur-modified nucleic acids is as follows Figure 3 shown.

[0157] Gene knock-in methods, kits, reaction systems and applications

[0158] The present invention also provides a method for performing gene knock-in using the gene knock-in system of the present invention, a corresponding kit, a reaction system and application.

[0159] Typically, the gene knock-in system of the present invention includes the following steps: under the guidance of the guide nucleic acid, the gene knock-in system forms a "nucleic acid to be base edited-guide nucleic acid-gene editing element-sulfur modification binding element-sulfur modification donor nucleic acid" complex with the nucleic acid to be knocked-in, so that the sulfur modification donor nucleic acid is knocked-in at a predetermined nucleic acid region or adjacent position.

[0160] A representative process of gene knock-in using sulfur-modified nucleic acid donors and sulfur-modified nucleic acid recognition proteins is as follows: Figure 4 shown.

[0161] The gene knock-in system of the present invention can be delivered in the form of DNA (including circular or linear DNA, plasmid, viral DNA, etc.), mRNA (including linear or circular mRNA, self-replicating RNA, etc.), nucleic acid protein complex, etc., such as Figure 5 shown.

[0162] The gene knock-in method of the present invention can be used for gene therapy, for example, to treat certain diseases of mammals (such as humans). The method of the present invention can efficiently knock-in genes into the genome to treat genetic diseases.

[0163] The main advantages of the present invention are:

[0164] (1) The present invention proposes a novel gene knock-in system, which uses sulfur-modified nucleic acid as a donor and uses SBD as a recruitment domain to recruit the donor to the position of the nucleic acid to be knocked in.

[0165] (2) Compared with the prior art, the sulfur-modified nucleic acid used in the present invention has a longer half-life in the cell body, is more stable, is not easily degraded, and has better cellular uptake.

[0166] (3) Compared with the prior art, the SBD used in the present invention has a stronger binding affinity for sulfur-modified nucleic acids (Kd=5nM), and the SBD domain is smaller (16kDa), making it easier to operate.

[0167] (4) The method of the present invention can efficiently knock in genes at specific sites in the genome, thereby achieving the goals of disease treatment and genetic engineering.

[0168] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods for which specific conditions are not specified in the following examples are generally in accordance with conventional regulations, such as the conditions described in J. Sambrook et al., Molecular Cloning Laboratory Guide (Fourth Edition) (Science Press Co., Ltd., 2017), or in accordance with the conditions described in the product manual provided by the product manufacturer. The materials, reagents, instruments, etc. used in the examples, unless otherwise specified, can be obtained from commercial sources.

[0169] Example 1 Purification of Cas9-SBDHga fusion protein

[0170] 1. SpCas9 was synthesized into the E. coli expression vector pET28a by gene synthesis. The synthetic sequence is as follows (SEQ ID No: 1):

[0171]

[0172]

[0173]

[0174] Among them, the bold part is the vector sequence, the underlined part is the nuclear localization signal NLS, and the italic part is the SpCas9 sequence.

[0175] The Cas9-SBDHga fusion protein expression vector was constructed based on the above plasmid, and the amplification primer sequence (5'-3') was as follows:

[0176] Hga-F1:

[0177] CGAGAGCCCTAAGAAGAAAAGAAAGGTGAGCGGAGGCTCTAGCGGCGGAA (SEQ ID No: 2)

[0178] Hga-R1:

[0179] GCCAGAACCACTGCCGTCGGCGGTTCTTTTGGATCCGCCAGACCAATGGTTGTT-3' (SEQ ID No: 3)

[0180] 2. Heterologous expression of Cas9-SBDHga fusion protein in Escherichia coli host BL21 (DE3). Pick a single clone carrying the expression vector and transfer it to LB liquid culture medium (containing 1 / 1000 50mg / mL carbenicillin), and grow it overnight at 37°C and 220rpm as a seed solution. Inoculate the seed solution into a new LB liquid culture medium (containing 1 / 1000 50mg / mL carbenicillin) at a transfer volume of 2 / 100, and place it in a shaking incubator at 37°C and 220rpm to culture until OD 600 0.5-0.6, add IPTG to a final concentration of 0.2mM, 16℃, 180rpm to induce for 18h.

[0181] 3. Purification of Cas9-SBDHga fusion protein.

[0182] Lysis of bacterial liquid: collect the bacterial liquid by centrifugation, discard the supernatant, resuspend the cells in 50 mL of protein purification Buffer A (25 mM Tris-HCl pH 8.0, 500 mM NaCl), use a pre-cooled cell disruptor to disrupt the cells, centrifuge the cell lysis solution at 4°C, 10,000 rpm for 1 h, collect the supernatant, filter it with a 0.22 μM filter membrane, and place it on ice.

[0183] Ni column purification: Equilibrate the Ni affinity column with Buffer A (25mM Tris-HCl pH 8.0, 500mM NaCl), load the cell lysate onto the Ni affinity column, and perform affinity reaction. Rinse the Ni affinity column with 40 column volumes of washing buffer A (25mM Tris-HCl pH 8.0, 500mM NaCl, 20mM imidazole) containing 20mM imidazole. Elute the target protein with 5mL of Buffer B (25mM Tris-HCl pH 8.0, 500mM NaCl, 500mM imidazole).

[0184] Heparin column purification: Buffer C (25mM Tris-HCl pH 8.0, 50mM NaCl) was used to balance the Heparin affinity chromatography column (Cytiva), and the protein purified by the Ni column was diluted 10 times with Buffer C before loading. After rinsing 5 column volumes with Buffer C, the concentration of Buffer D (25mM Tris-HCl pH 8.0, 1000mM NaCl) was linearly increased, and the Cas9-SBDHga fusion protein was eluted in the concentration range of about 70%-90%. The entire process was carried out on the AKTA purification system (Cytiva).

[0185] The sequence of the obtained Cas9-SBDHga fusion protein is shown in SEQ ID NO: 4 (the horizontal line part is the nuclear localization signal NLS, the italic part is the Cas9 sequence, the bold part is the SBDHga sequence, the bold part is the linker, and the wavy line part is the histidine tag).

[0186]

[0187]

[0188] Example 2 Affinity of Cas9-SBDHga fusion protein for sulfur-modified DNA

[0189] 1. Preparation of Sulfur-modified Double-stranded DNA

[0190] Single-stranded DNA primers with different numbers of sulfur modifications (0, 2, 5) at the 5' end were designed and synthesized. PCR was performed using the human genome as a template. The amplification primer sequences (5'-3') are as follows:

[0191] WDR-50F:ATTTACCATATTCGGGCTTAGCCAGTGCTG (SEQ ID No: 5)

[0192] WDR-50R:ACCCCCAACCGGAGGGGCTGTTCCCACTCAC(SEQ ID No: 6)

[0193] WDR-50F-T2S:A*T*TTACCATATTCGGGCTTAGCCAGTGCTG (SEQ ID No: 7)

[0194] WDR-50R-T2S:A*C*CCCCAACCGGAGGGGCTGTTCCCACTCAC(SEQ ID No: 8)

[0195] WDR-50F-T5S:A*T*T*T*A*CCATATTCGGGCTTAGCCAGTGCTG (SEQ ID No: 9)

[0196] WDR-50R-T5S:A*C*C*C*C*CAACCGGAGGGCTGTTCCCACTCAC(SEQ ID No: 10)

[0197] Note: * represents sulfur modification site.

[0198] The PCR product was purified using a silica gel column and eluted with RNase free water.

[0199] 2. Cas9-SBDHga fusion protein-DNA binding detection

[0200] Cas9 protein, Cas9-SBDHga fusion protein and sulfur-modified double-stranded substrate DNA were added to a buffer system containing 20mM Tris-HCl pH8.0, 200mM NaCl, and 1mM DTT at a molar ratio of 2:1, and the system was placed on ice for 30 minutes. After the reaction, electrophoresis was performed. If the DNA is not bound to the protein, the DNA migrates faster in the gel; when the DNA is bound to the protein, the migration rate of the complex will be significantly slower than the former, thus forming a clearly distinguished binding band.

[0201] 3. Results

[0202] The experimental results are as follows Figure 6 The results show that in the Cas9-SBDHga fusion protein experimental group (C9H), the DNA not bound to the protein (the bottom of the lane) is significantly less than that in the Cas9 group, indicating that the Cas9-SBDHga fusion protein has the ability to bind to sulfur-modified DNA, and the binding effect on sulfur-modified DNA is better than that of Cas9. At the same time, for the Cas9-SBDHga fusion protein, the reduction in the bottom band of the 5 sulfur-modified group (D-5S) is more obvious than that of the 2 sulfur-modified group (D-2S), indicating that the more sulfur modifications on the substrate DNA, the better the binding effect, and the binding effect of the fusion protein on DNA can be enhanced by adding multiple sulfur modifications to the DNA.

[0203] Example 3 Cas9-SBDHga fusion protein has genome-targeted cleavage activity in cells

[0204] 1. sgRNA (small-guide RNA) preparation

[0205] sgRNA was designed and synthesized for the human gene GAPDH, the sequence is as follows:

[0206] GAPDH-sg: 5'-AGCCCCAGCAAGAGCACAAG-3' (SEQ ID No: 11)

[0207] The sgRNA was dissolved in RNase free water to a final concentration of 25 pmol / μl and stored in a -80°C refrigerator.

[0208] 2. Donor Nucleic Acid Preparation

[0209] Based on the EGFP sequence, primers were designed to introduce 50 bp homology arms on both sides of the cleavage site by PCR. The primer sequences (5'-3') are as follows:

[0210] GAPDH-EGFP-F:

[0211] ATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCAC ATGGTGAGCAAGGGCGAGGA (SEQ ID No: 12)

[0212] GAPDH-EGFP-R:

[0213] ACTGAGTGTGGCAGGGACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTT TTACTTGTACAGCTCGTCCATG(SEQ ID No: 13)

[0214] Note: The underlined sequences represent the introduced homology arms.

[0215] The PCR product was purified using a silica gel column and eluted with RNase free water.

[0216] 3. Cell Culture

[0217] HEK293T cells with good vitality were cultured in DMEM (gibco) supplemented with 10% fetal bovine serum, 1% penicillin and 1% streptomycin, and passaged every two days.

[0218] 4. Delivery of protein-nucleic acid complexes into cells

[0219] When the confluence of HEK293T cells reached 80%-90%, the cells were digested with 0.25% trypsin, and the digestion was terminated with DMEM containing 10% fetal bovine serum. The cells were counted and 1*10 6 The cells were harvested by centrifugation at 1000 rpm for 3 min.

[0220] 20pmol Cas9-SBDHga fusion protein was mixed with 60pmol sgRNA and incubated at room temperature for 10min, and then 5pmol donor nucleic acid was added to the system and incubated at room temperature for 10min to form a protein-nucleic acid complex. 100μl electroporation buffer (Lonza) was mixed with cells and the above protein-nucleic acid complex, transferred to an electroporation cup, and the protein-nucleic acid complex was delivered to the cells using the Lonza2b Nucleofector nuclear transfer system.

[0221] 5. Gene knock-in detection

[0222] 72 hours after the delivery of the protein-nucleic acid complex, the cells were digested with 0.25% trypsin, and the digestion was terminated with DMEM containing 10% fetal bovine serum. The cells were centrifuged at 1000 rpm for 3 minutes, the supernatant was removed, the cells were harvested, and the cell genome was extracted.

[0223] Design primers (GAPDH-F3 / R3) that match the editing site. Use the edited cell genome as a template to perform PCR and Sanger sequencing to confirm whether the editing has occurred successfully. If editing occurs, the cell genome will randomly generate base insertions and deletions, and the sequencing peak graph will have overlapping peaks downstream of the editing site. The primer sequences used (5'-3') are as follows:

[0224] GAPDH-F3: GGCTGTGGGCAAGGTCATCCCT (SEQ ID No: 14)

[0225] GAPDH-R3: CGAGCCCTGACTTCCTCCAC (SEQ ID No: 15)

[0226] Design primers (EGFPq-Fa and GAPDH-R2) that match the editing site and the inside of the inserted fragment, and perform electrophoresis after PCR to confirm whether the target fragment has been successfully inserted into the cell genome. The primer sequences (5'-3') used are as follows:

[0227] EGFPq-Fa:ACCCTGAAGTTCATCTGCACCA (SEQ ID No: 16)

[0228] GAPDH-R2: AAGGGGTCTACATGGCAACTGT (SEQ ID No: 17)

[0229] 6. Results

[0230] like Figure 7 As shown. The results of the Sanger sequencing experiment showed that the wild-type cell genome did not produce cleavage, the sequencing peak graph was flat, and there was no overlapping peak. The sequencing peak graph of the experimental group showed overlapping peaks downstream of the editing site, indicating that the Cas9-SBDHga fusion protein successfully completed the cutting of the target site in the cell ( Figure 7 The results of gel electrophoresis experiments showed that no amplification products were produced when the wild-type cell genome was used as an amplification template; specific amplification products were produced when the knock-in experimental group cell genome was used as an amplification template, and the size was consistent with expectations, indicating that the target gene was accurately knocked in ( Figure 7 (middle (b) figure).

[0231] Example 4: Improving the efficiency of gene knock-in in cells using Cas9-SBDHga and sulfur-modified donor nucleic acid

[0232] 1. Preparation of sgRNA (small-guide RNA) was the same as in Example 3.

[0233] 2. Preparation of Sulfur-modified Donor Nucleic Acid

[0234] Based on the EGFP sequence, sulfur-modified primers (GAPDH-EGFP-FS / RS) were designed and synthesized. 50 bp homology arms on both sides of the cleavage site were introduced by PCR. The prepared donor nucleic acid was 820 bp in length. The primer sequences (5'-3') were as follows:

[0235] GAPDH-EGFP-FS:

[0236] A*T*G*G*C*CTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCAC ATGGTGAGCAAGGGCGAGGA (SEQ ID No: 18)

[0237] GAPDH-EGFP-RS:

[0238] A*C*T*G*A*GTGTGGCAGGGACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTT TTACTTGTACAGCTCGTCCATG(SEQ ID No: 19)

[0239] Note: The underlined sequences represent the introduced homology arms, and * represents the sulfur modification site.

[0240] 3. Cell culture: Delivery of protein-nucleic acid complexes into cells is consistent with that in Example 3.

[0241] 4. Gene knock-in efficiency detection

[0242] 72 hours after the delivery of the protein-nucleic acid complex, the cells were digested with 0.25% trypsin, and the digestion was terminated with DMEM containing 10% fetal bovine serum. The cells were centrifuged at 1000 rpm for 3 minutes, the supernatant was removed, the cells were harvested, and the cell genome was extracted.

[0243] qPCR was used to characterize the knock-in efficiency. Primers for the ACTB site of the human genome (ACTB-qpcrF1 / R1) were designed as internal references to characterize the number of genomes; primers matching the sides of the editing site and the inside of the inserted fragment (EGFPq-Fb and GAPDH-R3) were designed to characterize the number of genomes containing the target knock-in fragment; after qPCR quantification, the knock-in efficiency = the number of genomes containing the knock-in fragment / the total number of genomes. The primer sequences used are as follows:

[0244] ACTB-qpcrF1: 5'-CATGTACGTTGCTATCCAGGC-3' (SEQ ID No: 20)

[0245] ACTB-qpcrR1: 5'-CTCCTTAATGTCACGCACGAT-3' (SEQ ID No: 21)

[0246] EGFPq-Fb: 5'-TTCAAGATCCGCCACAACATCGA-3' (SEQ ID No: 22)

[0247] GAPDH-R3: 5'-CGAGCCCTGACTTCCTCCAC-3' (SEQ ID No: 15)

[0248] 5. Results

[0249] like Figure 8 The results showed that the knock-in efficiency of the group of fusion protein Cas9-SBDHga and sulfur-modified donor nucleic acid (C9H+donor_S) was the highest, and the overall knock-in efficiency of the group of sulfur-modified donor nucleic acid (C9H+donor_S, Cas9+donor_S) was higher than that of the group without sulfur modification on the donor nucleic acid (C9H+donor_CK, Cas9+donor_CK), indicating that the use of Cas9-SBDHga and sulfur-modified donor nucleic acid can improve the efficiency of gene knock-in in cells.

[0250] Example 5: Delivery of Cas9-SBDHga by protein-nucleic acid complex (RNP) can improve the efficiency of gene knock-in in cells under different sulfur-modified donor nucleic acid concentration conditions

[0251] 1. Preparation of sgRNA (small-guide RNA) was the same as in Example 3.

[0252] 2. Preparation of Sulfur-modified Donor Nucleic Acid

[0253] Based on the internal ribosome entry site (IRES) and EGFP sequence, sulfur-modified primers were designed and synthesized. 50 bp homology arms on both sides of the cleavage site were introduced by PCR. The prepared donor nucleic acid was 1454 bp in length. The primer sequences (5'-3') are as follows:

[0254] GAPDH-IRES-FS:

[0255] A*T*G*G*C*CTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCAC CGATAATGTAAGAGTCTGGT (SEQ ID No: 23)

[0256] GAPDH-EGFP-RS:

[0257] A*C*T*G*A*GTGTGGCAGGGACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTT TTACTTGTACAGCTCGTCCATG(SEQ ID No: 19)

[0258] Note: The underlined sequences represent the introduced homology arms, and * represents the sulfur modification site.

[0259] The PCR product was purified using a silica gel column and eluted with RNase free water.

[0260] 3. Cell culture was the same as in Example 3.

[0261] 4. Delivery of protein-nucleic acid complexes into cells

[0262] When preparing the protein-nucleic acid complex system, different amounts (0.7, 1.8, 4.5, 9.0 μg) of sulfur-modified donor nucleic acid were added to different experimental groups to form protein-nucleic acid complexes containing different concentrations of sulfur-modified donor nucleic acid. The remaining delivery steps were consistent with Example 3.

[0263] 5. Detection of gene knock-in efficiency by flow cytometry

[0264] 72 hours after the delivery of protein-nucleic acid complexes, the cells were digested with 0.25% trypsin, and the digestion was terminated with DMEM containing 10% fetal bovine serum. The cells were centrifuged at 1000 rpm for 3 min, the supernatant was removed, and the cells were harvested. The cells were washed twice with 1× PBS solution. The washed cells were resuspended in an appropriate volume of 1× PBS solution and transferred to a flow cytometer tube for analysis.

[0265] BD LSRFortessa five-laser analytical flow cytometer was used to collect and analyze 5,000-10,000 cells in each experimental group, and cells expressing EGFP were detected through the FITC channel, i.e., cells in which the target gene was successfully knocked in. Flowjo software was used to analyze the data, and gene knock-in efficiency = number of cells expressing EGFP / total number of cells collected.

[0266] 6. Results

[0267] like Figure 9 When using flow cytometry to detect gene knock-in efficiency, first use FSC-A and SSC-A to eliminate cell debris and dead cells and distinguish live cells (P1). Among live cells, single cells are distinguished based on SSC-A and SSC-H (P2) and cell adhesions are removed. Finally, among single cells, GFP-positive cells (P3) are distinguished based on FITC-A and SSC-A, i.e., cells in which the target gene has been successfully knocked in.

[0268] like Figure 10 , Figure 11As shown. In the form of protein-nucleic acid complex delivery, 1354bp gene knock-in was performed in HEK293T cells. Under different sulfur-modified donor nucleic acid addition conditions (0.7, 1.8, 4.5, 9.0 μg, converted to molar concentrations of 0.8, 2, 5, 10 pmol), the knock-in efficiency of the Cas9-SBDHga fusion protein (C9H-2L) group was higher than that of the Cas9 group, indicating that Cas9-SBDHga can improve the knock-in efficiency in cells, up to 1.72 times, and the highest knock-in efficiency is 43.9%.

[0269] Example 6: Through plasmid delivery, Cas9-SBDHga can improve the efficiency of gene knock-in in cells under different sulfur-modified donor nucleic acid concentration conditions

[0270] 1. Construction of intracellular expression vector of Cas9-SBDHga fusion protein

[0271] The pBR322 plasmid was selected as the starting plasmid to construct the Cas9-SBDHga fusion protein intracellular expression plasmid. The amplification primer sequences (5'-3') are as follows:

[0272] pU6-Hga-F:

[0273] ATCGACCTGTCTCAGCTGGGAGGCGACTCTGGAGGATCTAGCGGAG (SEQ ID No: 24)

[0274] pU6-Hga-R:

[0275] CGGCCTTTTTCGTTGCTGCCGGCCTTTTGCCAGAACCACTGCCGTC (SEQ IDNo: 25)

[0276] 2. The preparation of sulfur-modified donor nucleic acid was consistent with that in Example 5.

[0277] 3. Cell culture was the same as in Example 3.

[0278] 4. Delivery of plasmids into cells

[0279] In a 24-well plate, approximately 1x10 5 HEK293T cells were transfected with Lipofectamine 3000 transfection reagent (Thermo Fisher) 16-20 hours later when the cell confluence reached 70-90%. For each well of cells, 500 ng of plasmid was co-transfected with different amounts (0.05, 0.10, 0.14, 0.36, 1.79 μg) of sulfur-modified donor nucleic acid.

[0280] 5. The gene knock-in efficiency detected by flow cytometry was consistent with that in Example 5.

[0281] 6. Results

[0282] like Figure 12 As shown. In the form of plasmid delivery, 1354bp gene knock-in was performed in HEK293T cells. Under different sulfur-modified donor nucleic acid dosages (0.01, 0.02, 0.04, 0.09, 0.18, 0.45, 0.90, 1.79 μg), the knock-in efficiency of the Cas9-SBDHga fusion protein (C9H-2L) group was higher than that of the Cas9 group, indicating that Cas9-SBDHga can improve the knock-in efficiency in cells. The knock-in enhancement effect was more significant under low donor nucleic acid dosage conditions, up to 10.39 times, and the highest knock-in efficiency was 52.0%.

[0283] Example 7: Through mRNA delivery, Cas9-SBDHga can improve the efficiency of gene knock-in in cells under different sulfur-modified donor nucleic acid concentration conditions

[0284] 1. Preparation of Cas9-SBDHga mRNA

[0285] The plasmid encoding T7 promoter and Cas9-SBDHga was linearized with NheI and used as a transcription template to transcribe mRNA using a T7 mRNA in vitro transcription kit.

[0286] 2. Preparation of sgRNA (small-guide RNA) is consistent with that in Example 3.

[0287] 3. The preparation of sulfur-modified donor nucleic acid was consistent with that in Example 5.

[0288] 4. Cell culture was the same as in Example 3.

[0289] 5. Delivery of mRNA into cells

[0290] In a 24-well plate, about 1x105 HEK293T cells were seeded per well. After 16-20 hours, when the cell confluence reached 70-90%, Lipofectamine 3000 transfection reagent (Thermo Fisher) was used for transfection. For each well of cells, 500 ng of mRNA was co-transfected with different amounts (0.04, 0.14, 0.36, 0.90, 1.79 μg) of sulfur-modified donor nucleic acid.

[0291] 6. The gene knock-in efficiency detected by flow cytometry was consistent with that in Example 5.

[0292] 7. Results

[0293] likeFigure 13 As shown. In the form of mRNA delivery, 1354bp gene knock-in was performed in HEK293T cells. Under the conditions of different sulfur-modified donor nucleic acid additions (0.04, 0.14, 0.36, 0.90, 1.79 μg), the knock-in efficiency of the Cas9-SBDHga fusion protein (C9H-2L) group was higher than that of the Cas9 group, indicating that Cas9-SBDHga can improve the knock-in efficiency in cells, up to 4.22 times, and the highest knock-in efficiency is 40.3%.

[0294] Example 8: Coupling of different SBDs with Cas9 can improve the efficiency of gene knock-in in cells to a certain extent

[0295] 1. Construction of intracellular expression vector of Cas9-SBD fusion protein

[0296] The pBR322 plasmid was selected as the starting plasmid to construct the intracellular expression plasmids of Cas9-SBDAna, Cas9-SBDBaq, Cas9-SBDEco, Cas9-SBDGsu, Cas9-SBDHga, Cas9-SBDMmo, Cas9-SBDSga, and Cas9-SBDSpr fusion proteins.

[0297] 2. The preparation of sulfur-modified donor nucleic acid was consistent with that in Example 5.

[0298] 3. Cell culture was the same as in Example 3.

[0299] 4. Delivery of plasmids into cells

[0300] In a 24-well plate, about 1x105 HEK293T cells were seeded per well, and after 16-20 hours, when the cell confluence reached 70-90%, transfection was performed using Lipofectamine 3000 transfection reagent (Thermo Fisher). For each well of cells, 500 ng of plasmid and 0.04 μg of sulfur-modified donor nucleic acid were co-transfected.

[0301] 5. The gene knock-in efficiency detected by flow cytometry was consistent with that in Example 5.

[0302] 6. Results

[0303] like Figure 14 As shown in the figure. Under the condition of 0.04 μg sulfur-modified donor nucleic acid, coupling of different SBDs with Cas9 can improve the knock-in efficiency in cells to a certain extent.

[0304] Example 9 Preparation of different forms of sulfur-modified donor nucleic acids

[0305] 1. Blunt-ended double-stranded DNA with different amounts of sulfur modification at the ends

[0306] Based on the internal ribosome entry site (IRES) and EGFP sequence, sulfur-modified primers were designed and synthesized. 50 bp homology arms on both sides of the cleavage site were introduced by PCR to prepare donor nucleic acid primer sequences (5'-3') containing 2, 5, and 10 sulfur modifications at the ends as follows:

[0307] GAPDH-IRES-F2S:

[0308] A*T*GGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCAC CGATAATGTAAGAGTCTGGT (SEQ ID No: 26)

[0309] GAPDH-EGFP-R2S:

[0310] A*C*TGAGTGTGGCAGGGACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTT TTACTTGTACAGCTCGTCCATG(SEQ ID No: 27)

[0311] GAPDH-IRES-FS:

[0312] A*T*G*G*C*CTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCAC CGATAATGTAAGAGTCTGGT (SEQ ID No: 23)

[0313] GAPDH-EGFP-RS:

[0314] A*C*T*G*A*GTGTGGCAGGGACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTT TTACTTGTACAGCTCGTCCATG(SEQ ID No: 19)

[0315] GAPDH-IRES-F10S:

[0316] A*T*G*G*C*C*T*C*C*A*AGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCAC CGATAATGTAAGAGTCTGGT (SEQ ID No: 28)

[0317] GAPDH-EGFP-R10S:

[0318] A*C*T*G*A*G*T*G*T*G*GCAGGGACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTT TTACTTGTACAGCTCGTCCATG(SEQ ID No: 29)

[0319] Note: The underlined sequences represent the introduced homology arms, and * represents the sulfur modification site.

[0320] The PCR product was purified using a silica gel column and eluted with RNase free water.

[0321] 2. Blunt-ended double-stranded DNA with random sulfur modification positions

[0322] The plasmid containing homology arms, IRES, and EGFP sequences was transformed into the E. coli host B7A, and the single clone carrying the target plasmid was picked and placed in LB liquid medium, grown overnight at 37°C and 220rpm, and the bacteria were collected to extract the plasmid. The plasmid was linearized with restriction endonuclease EcoRI, and the digested product was purified using a silica gel chromatography column and eluted with RNase free water.

[0323] 3. Double-stranded DNA with sulfur-modified sticky ends

[0324] Based on IRES and EGFP sequences, sulfur-modified primers were designed and synthesized, and double-stranded DNA with five sulfur-modified blunt ends at 10 nt from the end was prepared by PCR. The primer sequences (5'-3') are as follows:

[0325] GAPDH-IRES-stiF5S:

[0326] ATGGCCTCCAA*G*G*A*G*TAAGACCCCTGGACCACCAGCCCCAGCAAGAGCAC CGATAATGTAAGAGTCTGGT (SEQ ID No: 30)

[0327] GAPDH-EGFP-stiR5S:

[0328] ACTGAGTGTGG*C*A*G*G*GACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTT TTACTTGTACAGCTCGTCCATG(SEQ ID No: 31)

[0329] The PCR product was digested with T7 Exo to convert the nucleic acid from a blunt-ended double-stranded form to a sticky-ended form. The digested product was purified using a silica gel chromatography column and eluted with RNase free water.

[0330] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A fusion protein for improving gene knock-in efficiency, characterized in that: The fusion protein includes a sulfur-modified binding element and a gene editing element, wherein the sulfur-modified binding element comprises a sulfur-modified nucleic acid recognition protein, and the gene editing element is a gene editing effector protein.

2. The fusion protein according to claim 1, characterized in that The gene editing element is selected from the following group: CRISPR / Cas9, CRISPR / Cas12, CRISPR / Cas14, TnpB, IscB, IsrB, Fanzor, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), Argonaute nuclease or its mutants.

3. The fusion protein according to claim 1, characterized in that The sulfur-binding domain protein (SBD) includes: SBDsco, SBDspr, SBDmmo, SBDhga, SBDeco, SBDtcu, or SBD homologous protein, preferably SBDspr, SBDmmo or SBDhga.

4. The fusion protein according to claim 1, characterized in that The structure of the fusion protein is shown in the following formula I or I' or I": ALB(I) BLA(I') ALBLA(I”) In the formula, A is a sulfur-modified binding element; B is a gene editing element; L is each independently none or a linker peptide; Each "-" is independently a chemical bond.

5. A reaction system for gene knock-in, comprising: (a) the fusion protein according to claim 1; and (b) a guide nucleic acid, wherein the guide nucleic acid guides the fusion protein to specifically bind to a predetermined region of the nucleic acid sequence to be gene knocked in; (c) a donor nucleic acid to be knocked into a gene, wherein the donor nucleic acid contains a sulfur modification; Wherein, the nucleic acid to be knocked into the gene is a linear or circular single-stranded DNA or double-stranded DNA.

6. A nucleic acid, characterized in that The nucleic acid encodes the fusion protein according to claim 1.

7. A carrier, characterized in that The vector contains the nucleic acid according to claim 6.

8. A genetically engineered cell, characterized in that: The cell contains the vector of claim 7, or the nucleic acid of claim 6 is integrated into its genome.

9. A kit, characterized in that: The kit comprises: (a1) a first container, and the fusion protein of claim 1, or its coding sequence, or a vector containing the coding sequence, located in the first container; and (b1) a second container, and a guide nucleic acid in the second container, Wherein, the gene editing element in the fusion protein can bind to a predetermined nucleic acid region under the guidance of the guide nucleic acid, and introduce the sulfur-modified donor nucleic acid into the vicinity of the predetermined nucleic acid region.

10. A method for improving gene knock-in efficiency, characterized in that: Includes steps: The fusion protein of claim 1 is specifically combined with the sulfur-modified donor nucleic acid, and the sulfur-modified donor nucleic acid is recruited to a predetermined nucleic acid region, thereby improving the gene knock-in efficiency.

Images