ZmSSIIIb-1 gene for regulating and controlling total starch content of corn and dCAPS molecular marker of ZmSSIIIb-1 gene

Abstract

The invention discloses a ZmSSIIIb-1 gene for regulating and controlling the total starch content of corn and a dCAPS molecular marker of the ZmSSIIIb-1 gene, and belongs to the field of molecular genetic breeding of crops, the ZmSSIIIb-1 gene with remarkable variation sites is obtained through excavation, the nucleotide sequence of the ZmSSIIIb-1 gene is shown as SEQ ID NO.1, the regulation and control of the total starch content of the corn are achieved through overexpression or knockout of the ZmSSIIIb-1 gene, and the dCAPS molecular marker of the ZmSSIIIb-1 gene is applied to the field of molecular genetic breeding of crops. A new gene resource is provided for corn germplasm improvement; secondly, dCAPS molecular markers for identifying high and low starch content corn varieties are designed on the basis of significant variation sites of the ZmSSIIIb-1 gene, and the sequences are respectively shown as SEQ ID NO.19 and SEQ ID NO.20. The dCAPS molecular markers can efficiently and accurately identify the starch content in the corn varieties and promote the corn breeding process.

Description

Technical Field

[0001] The invention belongs to the field of molecular genetic breeding of crops, and specifically relates to a ZmSSIIIb-1 gene for regulating the total starch content of corn and a dCAPS molecular marker thereof. Background Art

[0002] Corn is one of the most important food crops in the world, and its total starch content is a key factor affecting yield and quality. 70% of the weight of corn kernels comes from starch, which is not only the main source of energy for humans and other animals, but also an important raw material for industries such as chemical industry. Therefore, increasing the starch content of corn has important economic value and social benefits. With the clarification of the synthesis pathway of corn starch and the function of the coding gene, more and more research is focused on the excavation and analysis of corn starch regulatory genes. Research and screening of regulatory genes for starch synthesis are of great significance for improving corn quality.

[0003] CN114149999A discloses a corn starch synthesis regulatory gene ZmSSP1 and its application. Overexpression of this gene can increase the starch content of corn kernels and the 1000-grain weight of the kernels, while knocking out this gene can reduce the starch content of corn kernels and the 1000-grain weight of the kernels, indicating that the ZmSSP1 gene has a positive regulatory effect on starch expression, providing a new theory for analyzing the starch regulation pathway of corn kernels.

[0004] Secondly, the traditional method of judging corn starch content mainly relies on chemical analysis and physical testing. Although these methods can provide accurate results to a certain extent, they also have some obvious disadvantages, such as complex operation, long time consumption, and high cost. In contrast, molecular marker technology is analyzed at the molecular genome level, which can quickly, efficiently and accurately identify certain traits and is not affected by the environment. Molecular markers are highly polymorphic, and many markers are co-dominant, which can identify homozygous and heterozygous genotypes and provide complete genetic information; molecular markers can also predict key genes and significant SNPs that regulate corn starch content through genome-wide association analysis (GWAS) and QTL positioning. In addition, the DNA samples used for molecular markers can be preserved for a long time under certain conditions, and have strong traceability and arbitration. Therefore, screening and identifying corn starch synthesis regulatory genes, mining significant variation sites, and developing target molecular markers are extremely important for breeding high-starch content high-quality corn varieties and promoting the process of corn molecular breeding. Summary of the invention

[0005] In view of the above-mentioned prior art, the present invention provides a ZmSSIIIb-1 gene and a dCAPS molecular marker for regulating the total starch content of corn. By overexpressing or knocking out the ZmSSIIIb-1 gene, the total starch content of corn is regulated, providing a new gene resource for corn germplasm improvement; secondly, the significant variation sites of the ZmSSIIIb-1 gene are excavated, and a dCAPS molecular marker for identifying the starch content of corn is developed. The marker can effectively identify the starch content in corn, and can be used for auxiliary marker selection breeding of corn to screen out high-starch content high-quality corn varieties.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect of the present invention, a ZmSSIIIb-1 gene for regulating the total starch content of corn is provided; the ZmSSIIIb-1 gene is a nucleic acid molecule as shown in a) or b) below:

[0008] a) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.1;

[0009] b) A nucleic acid molecule having a nucleotide sequence identity of more than 90% with that of a) and expressing a protein with the same function.

[0010] Furthermore, the method for obtaining the ZmSSIIIb-1 gene is as follows: extracting corn kernel RNA and reverse transcribing it into cDNA, using cDNA as a template and ZmSSIIIb-1-PCR-F and ZmSSIIIb-1-PCR-R as primers for PCR cloning; wherein the sequences of ZmSSIIIb-1-PCR-F and ZmSSIIIb-1-PCR-R primers are:

[0011] ZmSSIIIb-1-PCR-F: 5′-ATGGAGATGAATCTCCGGGCGG-3′ (SEQ ID NO. 2);

[0012] ZmSSIIIb-1-PCR-R: 5′-TCAGTTTTTGCGAGCAGAATGG-3′ (SEQ ID NO. 3).

[0013] Furthermore, the significant mutation site of the ZmSSIIIb-1 gene is a missense mutation from G (C) to A (T) on the exon.

[0014] The second aspect of the present invention provides a method for regulating the total starch content of corn by the ZmSSIIIb-1 gene, comprising:

[0015] 1) constructing a ZmSSIIIb-1 gene overexpression vector, and introducing the overexpression vector into target corn to obtain a ZmSSIIIb-1 gene overexpression plant; or:

[0016] 2) Construct a ZmSSIIIb-1 gene knockout vector, introduce the knockout vector into the target corn, and obtain a ZmSSIIIb-1 gene knockout plant.

[0017] Furthermore, the starch content of the ZmSSIIIb-1 gene overexpression plant is higher than that of the target corn; and the starch content of the ZmSSIIIb-1 gene knockout plant is lower than that of the target corn.

[0018] Furthermore, in the above method, the method for transferring the ZmSSIIIb-1 gene into the target corn includes: Agrobacterium-mediated method, polyethylene glycol method, or gene gun bombardment method.

[0019] The third aspect of the present invention provides the use of the above-mentioned ZmSSIIIb-1 gene, the recombinant expression vector overexpressing or knocking out the ZmSSIIIb-1 gene, the transgenic cell line or the genetically engineered bacteria in any of the following 1) or 2):

[0020] 1) Plant breeding;

[0021] 2) Regulate the starch content of plants.

[0022] In the above application, the plant is preferably corn.

[0023] In the fourth aspect of the present invention, a dCAPS molecular marker for identifying the starch content of corn is provided, which is designed based on the significant variation site of the ZmSSIIIb-1 gene. The dCAPS molecular marker sequence of the high starch content corn variety is shown as SEQ ID NO.19, and the dCAPS molecular marker sequence of the low starch content corn variety is shown as SEQ ID NO.20.

[0024] Furthermore, the specific primer sequences of the dCAPS molecular markers are as follows:

[0025] dCAPS-XbaⅠ-F: 5′-ATCAGAGAATGTTCTTGAGGTCTAG-3′ (SEQ ID NO. 21);

[0026] dCAPS-XbaI-R: 5′-TAATACACAGGGCTATTAGCAGGAG-3′ (SEQ ID NO. 22).

[0027] A fifth aspect of the present invention provides a method for identifying corn starch content using the above dCAPS molecular marker, comprising the following specific steps:

[0028] 1) Extracting corn genomic DNA;

[0029] 2) Using the genomic DNA extracted in step 1) as a template, PCR amplification was performed using the above-mentioned dCAPS-XbaⅠ-F and dCAPS-XbaⅠ-R;

[0030] 3) digesting the PCR amplification product obtained in step 2) with restriction endonuclease XbaⅠ, and subjecting the digestion product to gel electrophoresis;

[0031] 4) Identify the electrophoresis results of step 3): the PCR product of the corn variety with high starch content can be cut by XbaⅠ enzyme, showing two bands of 281 bp and 256 bp in size; the PCR product of the corn variety with low starch content cannot be cut by XbaⅠ enzyme, showing only one band of 281 bp in size.

[0032] Furthermore, in step 3), the enzyme cleavage temperature is 37° C. and the time is 14-16 min.

[0033] Beneficial effects:

[0034] (1) The present invention screened and cloned the corn total starch-related response gene ZmSSIIIb-1 through systematic research, and transferred the gene into corn through Agrobacterium-mediated method. Analysis showed that the starch content of corn was significantly improved by overexpressing the ZmSSIIIb-1 gene, which provided a new direction and excellent gene resources for corn germplasm improvement and provided a research basis for cultivating high-starch content corn high-quality new germplasm.

[0035] (2) The present invention provides a dCAPS molecular marker for identifying corn starch content based on the significant variation site of the ZmSSIIIb-1 gene. The dCAPS molecular marker can quickly, efficiently and accurately screen out corn varieties with high starch content in natural populations, effectively saving costs and promoting the corn breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the analysis chart of starch content of corn B73 and Mo17; ** represents the significant level of P<0.01;

[0037] Figure 2 Chromosome distribution map of starch content-related QTLs in maize IBM population in multiple environments and BLUPs; 1-9 represents chromosomes 1-9; 2020XSBN, 2021CZ, 2021YA, 2021XSBN represent the 2020 Xishuangbanna, 2021 Chongzhou, 2021 Ya'an, 2021 Xishuangbanna environments, respectively; STA represents starch content;

[0038] Figure 3 The significant SNPs affecting starch content were detected in four environments and BLUP, where a is the Manhattan plot of SNPs significantly associated with total starch content; b is the QQ plot of SNPs significantly associated with total starch content;

[0039] Figure 4 Figure 2 is the association analysis diagram of the candidate gene of ZmSSIIIb-1; a is the variation site significantly associated with starch content, the red horizontal line represents the threshold of ZmSSIIIb-1 association analysis (P=3.01), the black dotted line represents the position of significant variation, and significant variation above the threshold is marked with enlarged points; b is the LD between SNPs; cf are the comparative analysis of total starch content of materials containing allele variation C and allele variation T in 2021CZ, 2021YA, 2021XSBN, and BLUP, respectively, and ** represents a significant difference of P<0.01;

[0040] Figure 5 is a map of the overexpression vector pEGOEPubi-ZmSSIIIb-1;

[0041] Figure 6 is the map of the knockout vector pEGOsCas9Pubi-ZmSSIIIb-1;

[0042] Figure 7 The positive detection results of ZmSSIIIb-1-OE strain; a is the PCR electrophoresis diagram of the overexpression strain; b is the comparison diagram of the relative expression levels in the overexpression strains ZmSSIIIb-1-OE and B104;

[0043] Figure 8 Figure 1 is a diagram of the gene structure of the ZmSSIIIb-1-KO strain and the sequencing results of the target positive detection; a is a schematic diagram of the gene structure of ZmSSIIIb-1; bc represent the sequencing peak diagrams and sequence schematic diagrams of the knockout materials of ZmSSIIIb-1-KO#1, ZmSSIIIb-1-KO#2, and ZmSSIIIb-1-KO#3, respectively;

[0044] Fig. 9The morphological structure diagrams of mesophyll cell chloroplasts of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO materials; (ac), (gi) and (mo) represent the panoramic views of mesophyll cell chloroplasts of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO at 6DAP, 12DAP and 18DAP, respectively, with a scale bar of 10μm; (df), (jl) and (pr) represent the magnified views of mesophyll cell chloroplasts of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO at 6DAP, 12DAP and 18DAP, respectively, with a scale bar of 2μm; M represents mesophyll cell chloroplasts, and SG represents starch grains;

[0045] Fig.10 The morphological structure of chloroplasts in the bundle sheath of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO materials; (ac), (gi) and (mo) represent the panoramic views of chloroplasts in mesophyll cells of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO at 6DAP, 12DAP and 18DAP, respectively; the scale bar is 10μm; (df), (jl) and (pr) represent the magnified views of chloroplasts in mesophyll cells of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO at 6DAP, 12DAP and 18DAP, respectively; the scale bar is 2μm; BS represents bundle sheath cells; SG represents starch grains;

[0046] Fig.11 This is a comparison of leaf starch content in ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104 materials at 15DAP; ** represents P < 0.01;

[0047] Fig.12 Observation of starch granules in the grains of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104 materials at 16DAP; a, c and e represent the panoramic views of starch granules in the grains of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO, respectively; b, d and f represent the enlarged views of starch granules in the grains of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO, respectively; scale bar is 200μm;

[0048] Fig.13Comparison of mature grain phenotype, 100-grain weight and starch content of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104; Figures ac are comparisons of mature grain phenotype, 100-grain weight and starch content of B104, ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104, respectively; ** represents P < 0.01, * represents P < 0.05;

[0049] Fig.14 Comparison of the length of mature grains of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104; a and b are the length of 10 mature grains of B104, ZmSSIIIb-1-OE and ZmSSIIIb-1-KO; c and d are the grain width; e and f are the grain thickness; ** and * are P<0.01 and P<0.05, respectively;

[0050] Fig.15 The electrophoresis diagram of PCR amplification of the genome of the extracted population material; Lanes 1-6 are excellent haploid corn varieties with high starch content; Lanes 7-12 are non-excellent haploid corn varieties with low starch content;

[0051] Fig.16 It is the electrophoresis diagram of PCR product digestion; Lanes 1-6 are excellent haploid corn varieties with high starch content; Lanes 7-12 are non-excellent haploid corn varieties with low starch content. DETAILED DESCRIPTION

[0052] The following will combine the contents in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0053] Example 1 Mining of ZmSSIIIb-1 gene regulating total starch content in corn

[0054] The starch content of two parents of the corn IBM population, B73 and Mo17, was measured. The results showed that the total starch content of B73 was significantly higher than that of Mo17 ( Figure 1 ), indicating that the IBM population is suitable as the genetic basis for analyzing total starch content.

[0055] Firstly, the CIM method in Windows QTL Cartographer was used to conduct linkage analysis on the maize genetic map constructed by previous researchers (Liu H, Niu Y, Gonzalez-Portilla PJ, et al. An Ultra-High-Density Map as a Community Resource for Discerning the Genetic Basis of Quantitative Traits in Maize [J]. BMC genomics, 2015, 16 (1): 1-16.) and the phenotypes and BLUP values ​​of the IBM population in four environments (Xishuangbanna in 2020, Chongzhou in 2021, Ya'an in 2021, and Xishuangbanna in 2021). The results showed that 22 QTLs controlling total starch content were detected ( Figure 2 ). We then used the FarmCPU model in rMVP to perform genome-wide association analysis on the filtered 969,439 high-quality markers and the phenotypic values ​​and BLUP values ​​of starch content in four environments, and detected a total of 72 significant SNPs associated with total starch content ( Figure 3 ). A total of 32 candidate genes affecting total starch synthesis were identified by searching for genes within the 220kb region flanking the co-localized genetic loci in the B73 and Mo17 populations. The KEGG gene function enrichment analysis method was used to analyze the functions of the candidate genes, and 9 genes involved in starch synthesis were detected. Candidate gene association analysis was performed on the above 9 important candidate genes to further analyze whether the variant sites in the candidate genes would affect starch content. The results showed that there was a significant variant site in the ZmSSIIIb-1 gene, which significantly affected starch content. It was annotated as a missense variant from G(C) to A(T) on the exon, which caused the 977th amino acid to mutate from serine (Ser: AGT) to glycine (Gly: GGT) ( Figure 4 ), wherein the nucleotide sequence of ZmSSIIIb-1 gene is shown in SEQ ID NO.1.

[0056] Example 2 Cloning of ZmSSIIIb-1 gene

[0057] The kernels of corn B73 18 days after pollination were taken, and the RNA of the kernels was extracted using the Guangzhou Meiji Biotechnology Plant Total RNA Extraction Kit. The extracted RNA was reverse transcribed into cDNA using the reverse transcription kit All-in-one 1st StrandcDNASynthesis SuperMix (gDNA Purge) from Suzhou Jinan Protein Company. The above specific operation steps are shown in the kit manual. The cDNA was used as a template for PCR reaction using Phanta Max Super-Fidelity DNA Polymerase to obtain PCR amplification products.

[0058] The primer sequences are:

[0059] ZmSSIIIb-1-PCR-F: 5′-ATGGAGATGAATCTCCGGGCGG-3′ (SEQ ID NO. 2);

[0060] ZmSSIIIb-1-PCR-R:5′-TCAGTTTTTGCGAGCAGAATGG-3′ (SEQ ID NO.3);

[0061] PCR amplification system (50 μL): Phanta Max Super-Fidelity DNA Polymerase 1 μL, dNTP 1 μL, buffer 25 μL, forward primer ZmSSIIIb-1-PCR-F 2 μL, reverse primer ZmSSIIIb-1-PCR-R 2 μL, cDNA 1 μL, ddH2O 18 μL;

[0062] PCR amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s; annealing at 60°C for 15 s; extension at 72°C for 4 min; 32 cycles; annealing at 72°C for 5 min; storage at 12°C.

[0063] 8 μL of PCR product was taken and subjected to 2% polyacrylamide gel electrophoresis for 30 min, the target band was amplified to a size of 3576 bp, and the target band was recovered. The purified product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and the target gene sample after the sequence alignment was correct was saved for future use.

[0064] Example 3 Construction of overexpression vector pEGOEPubi-ZmSSIIIb-1 and knockout vector pEGOsCas9Pubi-ZmSSIIIb-1 (1) Construction of overexpression vector pEGOEPubi-ZmSSIIIb-1

[0065] Using the homologous recombination method, pEGOEPubi-B-HIS was used as the base vector, and the target gene fragment obtained in Example 2 and the pEGOEPubi-B-HIS linearized vector were connected using the 2×Uniclone Seamless Cloning Mix homologous recombination enzyme of Jinsha Biotechnology to construct an overexpression pEGOEPubi-ZmSSIIIb-1 recombinant vector. The recombinant vector construction map is shown in Figure 5 shown.

[0066] The ligation system was as follows: 2 μL of linearized vector, 2 μL of target gene fragment, 5 μL of 2×Uniclone Seamless Cloning Mix, 1 μL of ddH2O; reaction procedure: 50°C for 1 h, and storage at 12°C.

[0067] The ligated recombinant vector plasmid was heat-shock transformed into DH5a competent Escherichia coli, plated and cultured overnight at 37°C, and a single clone was picked out after colonies grew out. Colony PCR verification was performed using primers Transgene-F and Transgene-R. If the band size was 3678 bp, it was positive. The bacterial solution was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The plasmid was extracted from the strain with the correct sequencing using the Guangzhou Meiji Bioplasmid Extraction Kit to obtain the pEGOEPubi-ZmSSIIIb-1 recombinant plasmid.

[0068] The primer sequences are as follows:

[0069] Transgene-F: 5′-ATATGTGGATTTTTTTAGCCCT-3′ (SEQ ID NO.4);

[0070] Transgene-R: 5′-GTTTTTGCGAGCAGAATGGTAC-3′ (SEQ ID NO. 5);

[0071] The PCR amplification system was (25 μL): 2× Rapid Taq Master Mix 12.5 μL, forward primer Transgene-F 1 μL, reverse primer Transgene-R 1 μL, the above bacterial solution template 1 μL, ddH2O 9.5 μL;

[0072] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 60 s, 34× cycles, extension at 72°C for 5 min, and storage at 12°C.

[0073] (2) Construction of knockout vector pEGOsCas9Pubi-ZmSSIIIb-1

[0074] The knockout vector pEGOsCas9Pubi-ZmSSIIIb-1 was constructed by CRISPR-Cas9 technology. First, sgRNA (target 1, target 2, target 3) was designed using the E-CRISR (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) website. Then, the sgRNA was cloned into a plasmid vector expressing Cas9 protein using pEGOEPubi-B-HIS as the basic vector to construct the knockout vector pEGOsCas9Pubi-ZmSSIIIb-1. The recombinant vector map is shown in the figure. Figure 6 The sequence information of sgRNA is as follows:

[0075] Target 1: AGCGTTGCCTTCCGCGTCCATGG (SEQ ID NO.6);

[0076] Target 2: AACGTCGGACTCACTAGCTAAGG (SEQ ID NO. 7);

[0077] Target 3: CAGGGCACAAGCAAGGTCTGAGG (SEQ ID NO. 8);

[0078] The ligated knockout recombinant vector plasmid was heat-shock transformed into DH5a competent Escherichia coli, plated and cultured overnight at 37°C, and a single clone was picked after colonies grew out. Colony PCR was performed using detection primers SP-F and SP-R. If the PCR amplification band size was about 1800 bp, it was identified as positive, and the bacterial solution was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The plasmid was extracted from the correctly sequenced strain using the Guangzhou Meiji Bioplasmid Mini Extraction Kit to obtain the pEGOsCas9Pubi-ZmSSIIIb-1 recombinant plasmid.

[0079] The primer sequences are as follows:

[0080] SP-F: 5′-GCGGTGTCATCTATGTTACTAG-3′ (SEQ ID NO.9);

[0081] SP-R: 5′-TGCAATAACTTCGTATAGGC-3′ (SEQ ID NO. 10);

[0082] PCR amplification system (25 μL): 2× Rapid Taq Master Mix 12.5 μL, forward primer SP-F 1 μL, reverse primer SP-R 1 μL, the above bacterial solution template 1 μL, ddH2O 9.5 μL;

[0083] PCR amplification program: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 40 s, 34× cycles, extension at 72°C for 5 min, and storage at 12°C.

[0084] Example 4 Agrobacterium-mediated transformation of pEGOEPubi-ZmSSIIIb-1 and pEGOsCas9Pubi-ZmSSIIIb-1 recombinant vectors in corn

[0085] 1. Introduction of recombinant vector

[0086] (1) Introduction of pEGOEPubi-ZmSSIIIb-1 and pEGOsCas9Pubi-ZmSSIIIb-1 recombinant vectors

[0087] S1 picked up the pre-activated Agrobacterium EHA105 monoclonal colony and placed it in 3 mL of YEP liquid medium containing 50 mg / L rifampicin resistance, and cultured it at 28°C and 200 r / min overnight;

[0088] S2 Take 1 mL of overnight culture solution and add it to 50 mL YEP medium. Cultivate at 28°C and 200 rpm until OD 600 The value is 0.5;

[0089] S3: The bacterial solution was dispensed into 50 mL centrifuge tubes, and then centrifuged at 5000 rpm and 4 °C for 5 min after ice bath for 30 min. The supernatant was discarded and the bacterial pellet was resuspended in a pre-cooled 100 mM CaCl2 solution. The resuspended solution was dispensed into 1.5 mL centrifuge tubes, glycerol was added, and the suspension was quickly frozen in liquid nitrogen and stored at -80 °C for later use.

[0090] S4 respectively took 6 μL of the pEGOEPubi-ZmSSIIIb-1 and pEGOsCas9Pubi-ZmSSIIIb-1 recombinant plasmids prepared in Example 3 and added them to the prepared Agrobacterium competent medium, placed them in an ice bath for 5 min, put them in liquid nitrogen for 5 min, heat-shocked them at 37°C for 5 min, added 1 mL of non-resistant YEP liquid medium, and revived them at 28°C for 3 h;

[0091] After S4 was revived, it was centrifuged at 4500r / min for 2min, 800μL of the supernatant was discarded, and the remaining bacteria were resuspended and applied to the YEP solid medium containing 50mg / L Kan and Rif resistance prepared in advance, and cultured at 28℃ for 48h;

[0092] S5: Pick the monoclonal colonies from the pEGOEPubi-ZmSSIIIb-1 and pEGOsCas9Pubi-ZmSSIIIb-1 groups and culture them in YEP containing Kan and Rif resistance for colony PCR amplification. Finally, take the PCR products for polyacrylamide gel electrophoresis to screen the colonies. If the PCR product band size of the overexpression colony is 3678bp, it is identified as positive; if the PCR product band size of the knockout colony is about 1800bp, it is identified as positive;

[0093] Overexpression colony PCR amplification system (25 μL): 2× Rapid Taq Master Mix 12.5 μL, forward primer Transgene-F 1 μL, reverse primer Transgene-R 1 μL, the above bacterial solution template 1 μL, ddH2O 9.5 μL;

[0094] PCR amplification program: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 60 s, 34× cycles, 72°C extension for 5 min, 12°C storage;

[0095] Knockout colony PCR amplification system (25 μL): 2× Rapid Taq Master Mix 12.5 μL, forward primer SP-F 1 μL, reverse primer SP-R 1 μL, the above bacterial solution template 1 μL, ddH2O 9.5 μL;

[0096] PCR amplification program: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 40 s, 34× cycles, 72°C extension for 5 min, 12°C storage;

[0097] S6: Cultivate and expand the positive colonies screened in the previous step, culture at 28°C for 4 h, and 200 r / min until OD 600 =0.6, divided into 10 mL sterile centrifuge tubes, centrifuged at 3000 r / min for 10 min, discarded the supernatant, added an equal amount of infection solution containing AS (100 mg / L) and resuspended for later use, to obtain pEGOEPubi-ZmSSIIIb-1 infection solution and pEGOsCas9Pubi-ZmSSIIIb-1 infection solution.

[0098] The above-mentioned infection solution formula is as follows: N6+2,4-D 1.5mg / L+inositol 120mg / L+L-proline 0.69g / L+hydrolyzed casein 100mg / L+sucrose 68.5g / L+glucose 30g / L+acetosyringone 100umol / L, pH 5.2;

[0099] N6 formula: potassium nitrate 2800 mg / L + ammonium sulfate 463 mg / L + potassium dihydrogen phosphate 400 mg / L + magnesium sulfate (MgSO4·7H2O) 185 mg / L + calcium chloride (CaCl2·2H2O) 165 mg / L + disodium ethylenediaminetetraacetic acid 37.3 mg / L + ferrous sulfate (FeSO4·7H2O) 27.8 mg / L + manganese sulfate (MnSO4·H2O) 4.4 mg / L + zinc sulfate (ZnSO4·7H2O) 1.5 mg / L + boric acid 1.6 mg / L + potassium iodide 0.8 mg / L + vitamin B1 (thiamine hydrochloride) 1.0 mg / L + vitamin B6 (pyridoxine hydrochloride) 0.5 mg / L + niacin 0.5 mg / L + glycine 2.0 mg / L, pH 5.8.

[0100] (2) Agrobacterium infection and transformation of maize embryos and seedling transplantation

[0101] S1: Take the female ears of the wild type B104 inbred line that has been pollinated for about 13 days, and after sterilization, pick out the young embryos of about 1.5 mm and place them on the co-culture medium prepared in advance for use;

[0102] S2: drop the pEGOEPubi-ZmSSIIIb-1 infection solution and pEGOsCas9Pubi-ZmSSIIIb-1 infection solution prepared in advance onto the young embryos, shake them slightly to make the infection solution fully contact with the young embryos, incubate them in the dark for 15 minutes, absorb the remaining infection solution with filter paper, and place them in the co-culture medium for dark incubation at 22°C for 3 days;

[0103] S3 Select the young embryos without bacteria and growing normally and place them in the recovery medium for dark culture at 28℃ for 7 days. The recovery culture can be carried out 2-3 times according to the growth of the young embryos.

[0104] S4: Transfer the callus tissue after recovery culture to the screening medium containing 2 mg / L glyphosate, and culture it in the dark at 28°C for 20 days. Select the surviving resistant callus tissue and place it back on the screening medium containing 3 mg / L and 5 mg / L glyphosate, and culture it in the dark at 28°C for 20 days.

[0105] S5 The resistant callus tissue that grows well after screening is transferred to the differentiation medium. After culturing at 28°C in the dark for 7 days, the callus tissue is transferred to an environment of 28°C and alternating darkness (16 hours of light and 8 hours of dark culture) and cultured for 20 days.

[0106] S6 When the regenerated seedlings and roots were observed to be about 2-3 cm long, the callus tissue was separated and the seedlings were transferred to the rooting and seedling growth medium for cultivation and observation;

[0107] After the S7 seedlings grew at least 3 roots and the root length exceeded 15 cm, sterile water containing nystatin was added to the bottle to prevent bacterial contamination and water evaporation. After 6 days of cultivation, the seedlings were transferred to potted plants prepared in advance. When the seedlings grew to the stage of two true leaves and one heart leaf, they were transplanted into the greenhouse, covered with mulch, and field management was carried out. Overexpressed and knocked-out T0 generation transgenic seeds were harvested by self-pollination.

[0108] The culture medium formula used in the above steps is as follows:

[0109] Basic culture: N6 + sucrose 30g / L + agar 7g / L;

[0110] Subculture medium: basic medium + 2,4-D1.5mg / L + inositol 120mg / L + L-proline 0.69g / L + hydrolyzed casein 100mg / L + mannitol 20g / L;

[0111] Co-culture medium: subculture medium + acetosyringone 100umol / L + cysteine ​​400mg / L + silver nitrate 0.85mg / L;

[0112] Recovery medium: subculture medium + silver nitrate 0.85 mg / L + MES 0.5 g / L + cephalosporin 250 mg / L;

[0113] Screening medium: subculture medium + silver nitrate 0.85 mg / L + cephalosporin 250 mg / L + glyphosate (2, 3, 5 mg / L);

[0114] Differentiation medium: basic medium + KT 1mg / L + hydrolyzed casein 250mg / L + L-proline 0.69g / L;

[0115] Rooting and seedling strengthening culture medium: 1 / 2MS basic culture medium + ABT rooting powder 0.5 mg / L + hydrolyzed casein 30 mg / L + sucrose 2% + agar 0.6%.

[0116] Example 5 Positive detection of T0 generation overexpression and knockout transgenic lines

[0117] (1) Genomic DNA extraction: The T0 generation transgenic seeds of the above-mentioned overexpression and knockout and the wild-type B104 were grown as seedlings and then transferred to the field for cultivation. An appropriate amount of leaves were taken and the genomic DNA in the corn leaves was extracted using the SLS method. The specific steps are as follows:

[0118] S1 Take appropriate amount of young corn leaves of overexpression strain, knockout strain and wild type B104, cut into pieces and put into 2 mL tubes, add steel beads, put into liquid nitrogen for quick freezing, and grind thoroughly twice with a tissue sampler (45 Hz / min, 1 min each time);

[0119] S2: Add 800 μL of SLS extract to the 2 mL tube after grinding and mix by inversion for 3 min;

[0120] S3. Add 800 μL of a mixture of phenol: chloroform: isoamyl alcohol (25:24:1) to the 2 mL tube (remove the lower layer after sealing and use), and mix by inversion for 3 min.

[0121] S4 was placed in a centrifuge and centrifuged at 12000r / min for 10min.

[0122] S5: Pipette 600 μL of the supernatant into a 1.5 mL centrifuge tube, add an equal volume of pre-cooled isopropanol, and mix by inversion for 5 min to precipitate the DNA;

[0123] S6 was placed in a centrifuge and centrifuged at 12000r / min for 5min.

[0124] S7: Pour off the supernatant, wash the precipitate with 75% ethanol, pour off the washing solution, wash the precipitate again with anhydrous ethanol, and dry at room temperature;

[0125] After S8 is completely dried, add 50 μL ddH2O to dissolve the DNA precipitate, take 1 μL of genomic DNA to check its quality by electrophoresis, and keep it for later use.

[0126] (2) Positive identification of overexpression strains: The genomic DNA of the overexpression strains extracted above was positively detected. After PCR amplification, the overexpression strains were able to amplify a target band of 3678 bp ( Figure 7 a).

[0127] To further verify the accuracy of the positive results, qRT-PCR quantitative analysis was performed on the overexpression strains and wild-type B104. Leaves of the overexpression strains and wild-type B104 were taken for RNA extraction and reverse transcription of cDNA (the kit used in this process was the same as in Example 2). RT-qPCR analysis was performed using cDNA as a template. If the expression level of the ZmSSIIIb-1 gene in the overexpression strain was higher than that of the wild-type B104 ( Figure 7 b), then the strain was identified as positive ZmSSIIIb-1-OE.

[0128] PCR amplification system (25 μL): 2× Rapid Taq Master Mix 12.5 μL, forward primer Transgene-F 1 μL, reverse primer Transgene-R 1 μL, the above genomic DNA 1 μL, ddH2O 9.5 μL;

[0129] PCR amplification program: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 60 s, 34× cycles, 72°C extension for 5 min, 12°C storage;

[0130] qRT-PCR experimental group system (20 μL): 2×NovoStart SYBR qPCR SuperMix Plus (Low ROX Premixed) 10 μL, Transgene-qPCR-F 1.5 μL, Transgene-qPCR-R 1.5 μL, cDNA template 2 μL, RNase Free Water 5 μL;

[0131] qRT-PCR control group system (20 μL): 2× NovoStart SYBR qPCR SuperMix Plus (Low ROX Premixed) 10 μL, Actin-F 1.5 μL, Actin-R 1.5 μL, cDNA template 2 μL, RNase Free Water 5 μL;

[0132] The reaction procedure was as follows: denaturation at 95°C for 1 min; annealing at 95°C for 10 s, reaction at 60°C for 30 s, and 40 cycles.

[0133] Table 1Positive detection primer sequences of ZmSSIIIb-1-OE strain

[0134]

[0135]

[0136] (3) Positive identification of knockout strains: The genomic DNA of the knockout strain extracted above was positively detected. After PCR amplification, the knockout strain target 1 PCR can amplify a band of 377 bp, and the target 2 and 3 PCR can amplify a band of 791 bp. The PCR products of the knockout strains with correct target detection were gel-recovered and purified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. If there is an insertion or deletion of nucleotides at the editing target site, such as Figure 8 As shown in the figure, the strain was identified as the knockout positive plant ZmSSIIIb-1-KO.

[0137] Target 1 detection PCR amplification system (25 μL): 2× Rapid Taq Master Mix 12.5 μL, forward primer QC1-F 1 μL, reverse primer QC1-R 1 μL, genomic DNA 1 μL, ddH2O 9.5 μL;

[0138] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 15 s, 34× cycles, extension at 72°C for 5 min, and storage at 12°C;

[0139] PCR amplification system for target 2 and 3 detection (25 μL): 2× Rapid Taq Master Mix 12.5 μL, forward primer QC23-F 1 μL, reverse primer QC23-R 1 μL, genomic DNA 1 μL, ddH2O 9.5 μL;

[0140] PCR amplification program: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, 34× cycles, extension at 72°C for 5 min, and storage at 12°C.

[0141] Table 2 Positive detection primer sequences of ZmSSIIIb-1-KO strain

[0142] Primer name Sequence (5′-3′) QC1-F CAGAGCAGGAACAATGAAGGTG(SEQ ID NO.15) QC1-R TTGAACTGCCATGTTCCTCAGA(SEQ ID NO.16) QC23-F TCTGAAGATGATCCAGAAGTGCT(SEQ ID NO.17) QC23-R TCTACATACCACCAATCGCCTTC(SEQ ID NO.18)

[0143] Example 6 Phenotypic Identification of Transgenic Maize Lines

[0144] (1) Detection of corn chloroplast starch content

[0145] The wild-type B104, ZmSSIIIb-1-OE overexpression and ZmSSIIIb-1-KO knockout maize materials were self-pollinated and the ear leaves were observed under a lens electron microscope at 6DAP, 12DAP and 18DAP. Fig. 9 As shown, the chloroplast cell structure and size of mesophyll cells of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104 did not change significantly during the three sampling periods; Fig.10 As shown, there are obvious differences in the size and number of starch granules in the chloroplast cells of the vascular sheath of the above three materials. It can be seen that the size and number of starch granules in ZmSSIIIb-1-OE are significantly higher than those in the other two materials.

[0146] To further verify the accuracy of the analysis results of transmission electron microscopy, the ear leaves of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104 were taken at 17:00 pm on 15 DAP of pollination, and the starch content was measured using the TotalStarch Assay Kit of Megazyme Company. Fig.11 As shown, the results showed that the starch content of ear leaves of ZmSSIIIb-1-OE was significantly higher than that of the other two materials.

[0147] (2) Detection of corn starch granule number

[0148] The self-pollinated grains of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and wild-type B104 were observed by scanning electron microscopy at 16 DAP. Fig.12 As shown, it was found that the number of starch granules in ZmSSIIIb-1-OE was more than that in the other two materials, among which the number of starch granules in ZmSSIIIb-1-KO grains was less than that in B104, but there was no significant difference in granule size.

[0149] (3) Size, 100-kernel weight, and starch content of mature corn kernels

[0150] The size, 100-grain weight, and starch content of mature kernels of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO, and B104 maize lines were measured, and the kernel phenotypes were also investigated, such as Fig.13 , 14 As shown, it can be seen that the size, 100-grain weight, starch content and grain length of ZmSSIIIb-1-KO are higher than those of the other two materials. The results show that overexpression and knockout of ZmSSIIIb-1 affect the starch content of corn grains, and also cause different degrees of changes in the grain shape of corn grains, and mainly affect the grain length.

[0151] Example 7 Development of dCAPS molecular markers for identifying high and low corn starch content

[0152] (1) Development of dCAPS molecular markers:

[0153] Based on Example 1, a significant variation site on the exon of the coding region of the ZmSSIIIb-1 gene was located through candidate gene association analysis, which was annotated as a missense variation from G (C) to A (T) on the exon. This variation caused the 977th amino acid to mutate from serine (Ser: AGT) to glycine (Gly: GGT). Using the dCAPS molecular marker principle, the variation site was converted into a dCAPS molecular marker.

[0154] The dCAPS molecular marker sequence of corn varieties with high starch content in natural populations is as follows (SEQ ID NO.19), and the nucleotide polymorphism is A:

[0155] ATCAGAGAATGTTCTTGAGGGCAAG AGTGCTGCAAAAAAGGCATTGCAGCAGATGCTTGGATTACAGCAAACTGATAGCCCTGTTGTTGGAATCATCACTCGTCTAACAGTGCAGAAGGGAATCCACCTTATCAAACATGCAATGCATCGAGCTCTTGAACGCAATGGGCAGGTCTTATCTTTTTCTTGCTCAGGAATTGCAAGTTTGTTATGTTTCATCCACACTATGTTCATATTTCTCAGAACTGATGTGTGTGTGTTTCTACATTAGGTGGTTTTAC; the underlined ones are significant variation sites.

[0156] The dCAPS molecular marker sequence of low starch content corn varieties in natural populations is as follows (SEQ ID NO.20), and the nucleotide polymorphism is G:

[0157] ATCAGAGAATGTTCTTGAGGGCAAG G GTGCTGCAAAAAAGGCATTGCAGCAGATGCTTGGATTACAGCAAACTGATAGCCCTGTTGTTGGAATCATCACTCGTCTAACAGTGCAGAAGGGAATCCACCTTATCAAACATGCAATGCATCGAGCTCTTGAACGCAATGGGCAGGTCTTATCTTTTTCTTGCTCAGGAATTGCAAGTTTGTTATGTTTCATCCACACTATGTTCATATTTCTCAGAACTGATGTGTGTGTGTTTCTACATTAGGTGGTTTTAC; the underlined ones are significant variation sites.

[0158] (2) Design of primer pairs specific for dCAPS molecular markers

[0159] 1. Use the online enzyme recognition system website dCAPS Finder 2.0 (https: / / helix.wustl.edu / dcaps / ) to design the forward primer dCAPS-XbaⅠ-F, and use SnapGene software to design the reverse primer dCAPS-XbaⅠ-R at the same time. The specific primer sequences are as follows:

[0160] dCAPS-XbaⅠ-F:5′-ATCAGAGAATGTTCTTGAGG T C TAG-3′ (SEQ ID NO. 21), wherein the underlined bases are designed mismatches;

[0161] dCAPS-XbaⅠ-R: 5′-TAATACACAGGGCTATTAGCAGGAG-3′ (SEQ ID NO. 22), the reverse primer has no mismatch.

[0162] 2. According to the design of dCAPS Finder 2.0 website, the appropriate restriction endonuclease XbaⅠ was screened. The recognition enzyme sequence of Xba I is: TCTAGA.

[0163] Example 8 Verification of dCAPS Molecular Marker for Screening Corn Starch Content

[0164] 1. Genome preparation of natural population materials

[0165] The applicant used the SLS method to extract genomic DNA from the leaves of excellent haploid corn varieties with high starch content and non-excellent haploid corn varieties with low starch content in natural populations. The above corn materials used for the experiment were all stored in the Corn Research Institute of Sichuan Agricultural University. The specific extraction steps were the same as the genomic DNA extraction method in corn leaves in Example 5.

[0166] 2. The genomic DNA extracted above was amplified by PCR using the specific primer pairs dCAPS-XbaⅠ-F and dCAPS-XbaⅠ-R designed in Example 7 to obtain PCR products. The amplification system and procedure are as follows:

[0167] PCR amplification system (25 μL): 2× Rapid Taq Master Mix 12.5 μL, forward primer dCAPS-XbaⅠ-F 1 μL, reverse primer dCAPS-XbaⅠ-R 1 μL, the above genomic DNA template 1 μL, ddH2O 9.5 μL;

[0168] PCR amplification program: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 45 s, cycle 34×, 72°C extension for 5 min, and 4°C cooling and storage.

[0169] 3. Take 2 μL of PCR product and run it on 2% polyacrylamide gel electrophoresis for 45 min. Fig.15 As shown, the amplified band is single and has a size of 281 bp, which proves that this primer pair has good specificity.

[0170] 4. Use the restriction endonuclease XbaⅠ screened in Example 7 to digest the PCR product to obtain a digestion product;

[0171] The enzyme digestion system was (10 μL): 10×QuickCut Green buffer 1 μL, PCR amplification product 2.5 μL, XbaⅠ enzyme 0.3 μL, ddH2O 6.2 μL; the enzyme digestion program was: 37°C digestion for 15 min, and storage at 4°C.

[0172] 5. Take 4 μL of PCR product and run it on 2% polyacrylamide gel electrophoresis for 45 min.

[0173] The results show that: Fig.16 It can be seen that lanes 1-6 are excellent haploid corn varieties with high starch content (AA type), which can be cut by XbaⅠ. By controlling the enzyme cutting time, the PCR product is guaranteed to be incompletely cut, so there are two bands, one 281bp and the other 256bp, which can more intuitively identify the results; lanes 7-12 are non-excellent haploid corn varieties with low starch content (GG type), which cannot be cut by XbaⅠ, and only have one band of 281bp in size; the obtained enzyme cutting electrophoresis results are consistent with the phenotypic screening results, confirming the identification reliability of the dCAPS molecular marker of the present invention.

[0174] In summary, the present invention provides a gene ZmSSIIIb-1 for regulating the total starch content of corn and its dCAPS molecular marker. The screening and acquisition of the ZmSSIIIb-1 gene provides a new direction and gene resource for corn germplasm improvement. The dCAPS molecular marker can effectively identify the starch content of corn, and can be used for auxiliary marker selection breeding of corn to promote the corn breeding process.

Claims

1. A ZmSSIIIb-1 gene for regulating the total starch content of corn; the ZmSSIIIb-1 gene is a nucleic acid molecule as shown in a) or b) below: a) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.1; b) A nucleic acid molecule having a nucleotide sequence identity of more than 90% with that of a) and expressing a protein with the same function.

2. The ZmSSIIIb-1 gene according to claim 1, characterized in that: The significant mutation site of the gene is a missense mutation from G to A in the exon.

3. The method for obtaining the ZmSSIIIb-1 gene according to claim 1, characterized in that: Extract corn kernel RNA and reverse transcribe it into cDNA. Use cDNA as template and ZmSSIIIb-1-PCR-F and ZmSSIIIb-1-PCR-R as primers for PCR cloning. The sequences of ZmSSIIIb-1-PCR-F and ZmSSIIIb-1-PCR-R primers are as follows: ZmSSIIIb-1-PCR-F: 5′-ATGGAGATGAATCTCCGGGCGG-3′ (SEQ ID NO. 2); ZmSSIIIb-1-PCR-R: 5′-TCAGTTTTTGCGAGCAGAATGG-3′ (SEQ ID NO. 3).

4. A method for regulating the total starch content of corn by using the ZmSSIIIb-1 gene according to claim 1, characterized in that: constructing a ZmSSIIIb-1 gene overexpression vector, and introducing the overexpression vector into target corn to obtain a ZmSSIIIb-1 gene overexpression plant; Alternatively: construct a ZmSSIIIb-1 gene knockout vector, introduce the knockout vector into the target corn, and obtain a ZmSSIIIb-1 gene knockout plant; The starch content of the ZmSSIIIb-1 gene overexpression plant is higher than that of the target corn; and the starch content of the ZmSSIIIb-1 gene knockout plant is lower than that of the target corn.

5. Use of the ZmSSIIIb-1 gene, the recombinant expression vector overexpressing or knocking out the ZmSSIIIb-1 gene, the transgenic cell line or the genetically engineered bacteria according to claim 1 in any one of the following 1) or 2): 1) Plant breeding; 2) Regulate the starch content of plants.

6. A dCAPS molecular marker for identifying corn starch content designed based on the ZmSSIIIb-1 gene according to claim 1 or 2, characterized in that: The dCAPS molecular marker sequence of the high starch content corn variety is shown as SEQ ID NO.19; the dCAPS molecular marker sequence of the low starch content corn variety is shown as SEQ ID NO.

20.

7. The dCAPS molecular marker according to claim 6, characterized in that: The specific primers of the dCAPS molecular marker are as follows: dCAPS-XbaⅠ-F: 5′-ATCAGAGAATGTTCTTGAGGTCTAG-3′ (SEQ ID NO. 21); dCAPS-XbaI-R: 5′-TAATACACAGGGCTATTAGCAGGAG-3′ (SEQ ID NO. 22).

8. A method for identifying corn starch content using dCAPS molecular markers according to claim 6, characterized in that: The specific steps include: 1) Extracting corn genomic DNA; 2) Using the genomic DNA extracted in step 1) as a template, PCR amplification was performed using the above-mentioned dCAPS-XbaⅠ-F and dCAPS-XbaⅠ-R; 3) digesting the PCR amplification product obtained in step 2) with restriction endonuclease XbaⅠ, and subjecting the digestion product to gel electrophoresis; 4) Identify the electrophoresis results of step 3): the PCR product of the corn variety with high starch content can be cut by XbaⅠ enzyme, showing two bands of 281 bp and 256 bp in size; the PCR product of the corn variety with low starch content cannot be cut by XbaⅠ enzyme, showing only one band of 281 bp in size.

9. The method according to claim 8, characterized in that: Step 3) The enzyme cleavage temperature is 37°C and the time is 14-16 minutes.

Images