Sensor for specific response to L-isoleucine and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a biosensor capable of specifically responding to L-isoleucine and application of the biosensor in detection of the L-isoleucine. According to the present invention, the ilvL transcription attenuation regulation system and the lacI operon of the isoleucine in Escherichia coli K-12 MG1655 are combined, gfp and the like are adopted as the reporter gene, the ilvL biosensor capable of performing gradient response on the L-isoleucine is developed, and the ilvL biosensor can be used for detecting the sample containing the L-isoleucine or screening the L-isoleucine production strain, such that the L-isoleucine production strain can be used for the detection of the L-isoleucine production strain, and the L-isoleucine production strain can be used for the detection of the L-isoleucine production strain. The detection of the L-isoleucine in a concentration range of 0-32g / L is realized.

Description

Technical field: The invention belongs to the technical field of bioengineering, and in particular relates to a biosensor specifically responding to L-isoleucine, and application thereof in L-isoleucine detection. Background technology: L-isoleucine is one of the eight essential amino acids for the human body. It plays an important role in the growth and development of the human body and life metabolism. It is also widely used in the feed industry, food and medicine. Microbial fermentation is currently the most important method for producing L-isoleucine, and breeding excellent production strains and screening out high-yield hosts are the key to increasing the yield of L-isoleucine. Biosensors have been widely used in high-throughput screening because of their characteristics of specifically responding to target compounds and outputting signals that are easy to detect. The present invention develops a specific biosensor for L-isoleucine based on the transcriptional attenuation effect of L-isoleucine, and uses it to screen high-yield strains to meet industrial needs.

[0003] A biosensor is an analytical device that combines biological recognition elements (such as enzymes, antibodies, nucleic acids, etc.) with signal converters (such as electrochemical, optical, thermal, etc.) to detect and analyze specific target molecules. Biosensors can convert chemical signals in the biological recognition process into measurable physical signals, thereby achieving qualitative or quantitative analysis of chemical substances. Biosensors can be used to transform microbial cell factories and detect a series of natural products widely used in industry, such as lysine, itaconic acid, isobutanol, alkaloids, etc. At present, the development of biosensors focuses on transcription factors, riboswitches, etc. These biosensors have poor specificity, narrow working range and low sensitivity.

[0004] Transcriptional attenuation is a common way for prokaryotes to regulate gene expression. Attenuation is usually responsible for regulating operons related to intracellular anabolism. When the cell does not need the downstream gene to continue to express, premature termination of transcription will occur. The ilvL transcriptional attenuation system from Escherichia coli involves the regulatory region of the ilvGMEDA operon, which contains the following three key parts: (1) Promoter region: There are two promoters ilvP before the ilvGMEDA operon. G 1 and ilvP G2. Responsible for initiating transcription of genes in the operon; (2) Leader-attenuation region: The ilvGMEDA operon contains a leader-attenuation region, which contains the ilvL leader peptide sequence. The regulation of ilvL by isoleucine is mainly reflected in the time it takes to pass through this region; (3) Binding site of the integration host factor (IHF): The integration host factor interacts with nucleotides in the common DNA sequence immediately downstream of the RNA polymerase transcription pause site in the leader-attenuator region. The ilvL leader peptide sequence is an important part of the attenuation system and contains 32 codons, including 5 isoleucine codons. When L-isoleucine is abundant, the translation of the ribosome on the leader sequence ilvL is blocked, resulting in the formation of the attenuator, thereby terminating the transcription of the ilvGMEDA operon; when L-isoleucine is missing, the ribosome can successfully translate the leader sequence, preventing the formation of the attenuator and allowing transcription to continue.

[0005] The present application is based on the transcriptional attenuation regulation of ilvL and combines with the lacI operon to establish an ilvL biosensor system regulated by L-isoleucine concentration. Summary of the invention: The present invention aims to provide a biosensor system that can specifically respond to L-isoleucine by Escherichia coli By combining the ilvL transcriptional attenuation regulatory system of isoleucine in K-12 MG1655 with the lacI operon and using gfp as a reporter gene, an ilvL biosensor capable of gradient response to L-isoleucine was developed.

[0007] The technical route adopted by the present invention is as follows: One of the technical solutions provided by the present invention is a biosensor that specifically responds to L-isoleucine, wherein the biosensor comprises the following elements: ilvGMEDA operon, lacI gene, ilvL terminator, P LlacO1 promoter, and reporter gene; Furthermore, the reporter gene includes but is not limited to gfp , rfp , cfp , sfgfp , egfp , yfp , ecfp Isogenic; Furthermore, the sensor further comprises a replicon gene for controlling the initial replication of the entire biosensor; Furthermore, the biosensor further comprises a resistance gene for screening transformants comprising the biosensor; Furthermore, the replicon includes but is not limited to p15A, ori, ColE1 wait; Furthermore, the resistance genes include but are not limited to Cm r 、Amp r , Kan r wait; Preferably, the biosensor comprises: a wild-type ilvGMEDA operon, a lacI gene, an ilvLterminator, P LlacO1 promoter, gfp reporter gene, rrnB T1 terminator, P15A replication origin and cm r Resistance gene, the biosensor nucleotide sequence is shown in SEQ ID NO.9; Furthermore, the ilvGMEDA operon has a nucleotide sequence as shown in SEQ ID NO.1; Furthermore, the lacI gene has a nucleotide sequence as shown in SEQ ID NO.2; Furthermore, the ilvL terminator, the nucleotide sequence is shown in SEQ ID NO.3; Furthermore, the P LlacO1 Promoter, the nucleotide sequence is shown in SEQ ID NO.4; Furthermore, the gfp Gene, the nucleotide sequence is shown in SEQ ID NO.5; Furthermore, the rrnB T1 terminator gene has a nucleotide sequence as shown in SEQ ID NO.6; Furthermore, the P15A Gene, the nucleotide sequence is shown in SEQ ID NO.7; Furthermore, the cm r Gene, the nucleotide sequence is shown in SEQ ID NO.8; Preferably, in order to further improve the sensitivity and response strength of the sensor to meet the needs of different scenarios, ilvL in the ilvGMEDA operon is mutated to obtain corresponding mutants. Among them, the ilvL / I13S mutant with I13S mutation has a nucleotide sequence as shown in SEQ ID NO.10; the ilvL / 1B mutant with amino acids 14-17 mutated to L-isoleucine has a nucleotide sequence as shown in SEQ ID NO.11; More preferably, the biosensor comprises: an ilvGMEDA operon in which ilvL undergoes an I13S mutation, a lacI gene, an ilvL terminator, P LlacO1 promoter, gfp reporter gene, rrnB T1 terminator, P15A replication origin and cm r Resistance gene, the biosensor nucleotide sequence is shown as SEQ ID NO.12.

[0008] More preferably, the biosensor comprises: an ilvGMEDA operon in which the amino acids 14 to 17 of ilvL are all mutated to L-isoleucine, a lacI gene, an ilvL terminator, P LlacO1 promoter, gfp reporter gene, rrnB T1terminator, P15A replication origin and cm r Resistance gene, the biosensor nucleotide sequence is shown as SEQ ID NO.13.

[0009] The second technical solution provided by the present invention is the application of the biosensor described in the first technical solution, especially in detecting samples containing L-isoleucine or screening L-isoleucine producing strains; Furthermore, the L-isoleucine producing strain includes but is not limited to Escherichia coli, Corynebacterium glutamicum, Saccharomyces cerevisiae, Bacillus subtilis, etc.; Furthermore, the above biosensor is introduced into L-isoleucine producing strains, such as Escherichia coli, Corynebacterium glutamicum, Saccharomyces cerevisiae, Bacillus subtilis, etc., to detect the production of L-isoleucine.

[0010] The principle of the biosensor for detecting L-isoleucine is as follows: when the detection system does not contain L-isoleucine, the ilvL transcription attenuation system does not work, the ilvGMEDA operon can be transcribed normally, and its downstream LacI can also be expressed normally. The expression product of LacI is related to the promoter. P LlacO1 Binds to and represses promoters P LlacO1 On the contrary, when L-isoleucine is present in the system, the RNA in the regulatory region of the ilvGMEDA operon forms a stem-loop structure attenuator, thereby terminating transcription. LacI is restricted in expression due to the transcriptional attenuation of ilvL, thereby relieving the regulation of P LlacO1 The inhibition of gfp transcription was initiated to achieve the expression of GFP protein. Thus, a positive correlation between L-isoleucine concentration and GFP fluorescence signal output was established.

[0011] When the wild-type ilvGMEDA operon is used, the biosensor can achieve a specific response to L-isoleucine at a concentration of 4-32 g / L, but the sensitivity and response intensity of the wild-type are insufficient to meet the strain screening and detection under specific circumstances. When a sensor containing the ilvL / I13S mutant is used, the sensitivity of the biosensor is improved compared with the wild-type, and there is a sensitive response when 1 g / L of L-isoleucine is added, which can be used for the screening of strains producing L-isoleucine at lower concentrations. When a sensor containing the ilvL / 1B mutant is used, the response intensity of the biosensor is improved compared with the wild-type, and it can be used for the concentration detection of high-concentration L-isoleucine samples.

[0012] Beneficial effects: Currently, there are few biosensors for detecting L-isoleucine. The present invention has developed a biosensor based on the ilvL transcription attenuation system and the lacI operon of L-isoleucine. The wild-type ilvL biosensor pBILE-WT developed by the present invention has a gradient response to L-isoleucine in the range of 4-32 g / L. The mutant biosensor pBILE-ilvL / I13S has a higher sensitivity than the wild type, and has an L-isoleucine response in the range of 0-4 g / L. The mutant biosensor pBILE-ilvL / 1B has a higher response intensity than the wild type, and has a GFP / OD response in the range of 0-32 g / L. 600 The values ​​were higher than those of the wild type, with the highest value being 771, which can be used for the screening of strains with high levels of L-isoleucine production and the detection of sample content. Description of the drawings: Figure 1 The schematic diagram of the sensor principle and construction is shown in Figure 1. The L-isoleucine biosensor was constructed based on the isoleucine ilvL transcriptional attenuation system and the lacI operon. Figure 2 The response of wild-type pBILE-WT biosensor to different concentrations of L-isoleucine; Figure 3 The responses of mutant pBILE-ilvL / I13S and pBILE-ilvL / 1B biosensors to different concentrations of L-isoleucine; Figure 4 The response of pBILE-ilvL / I13S biosensor to L-isoleucine producing strains; Figure 5 The response of pBILE-ilvL / 1B biosensor to L-isoleucine producing strains. Specific implementation method: The present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments, without departing from the essence and scope of the present invention, also belong to the protection scope of the present invention.

[0015] The biosensor provided by the present invention is an L-isoleucine biosensor based on the ilvL transcription attenuation system, wherein the sensor comprises an ilvGMEDA operon, a lacI gene, an ilvL terminator, P LlacO1 Promoter, reporter gene gfp, rrnB T1 terminator, P15A replication origin and resistance cm r gene; when L-isoleucine is not added to the system, LacI can express normally and inhibit the promoter P LlacO1 On the contrary, after adding sufficient L-isoleucine, LacI is restricted in expression due to the transcriptional attenuation of ilvL, thus relieving the regulation of P LlacO1 The inhibitory effect of gfp transcription is initiated to achieve the expression of GFP protein. The staff in this field can select different elements and combinations in the prior art according to the actual situation. The reporter gene can also have a variety of choices. The protein molecules commonly used in this field that can generate visual detection signals or small molecules that can be detected, such as fluorescent proteins, color proteins, etc., can achieve the response of the biosensor of the present invention. Preferably, gfp , rfp , cfp , sfgfp , egfp , yfp , ecfp The above sensor also contains necessary elements for expression such as a replication initiation site, preferably, such as P15A The above sensors may also contain markers such as resistance genes, such as cm r Those skilled in the art can also add other elements to the above sensor according to actual needs, such as constructing the above elements into expression vectors in the prior art, such as pET, pUC19, pMAL, etc., to obtain a recombinant plasmid that can be used as a sensor.

[0016] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0017] The present invention will be further explained below through specific examples.

[0018] Example 1 Design and construction of wild-type biosensor pBILE-WT The wild-type biosensor pBILE-WT contains the following parts: ilvGMEDA operon, lacI, ilvLterminator, P LlacO1 Promoter, reporter gene gfp, rrnB T1 terminator, P15A replication origin and resistance cm r Gene, the order of connection of each part is as follows Figure 1 The specific construction steps are as follows: Primestar Max enzyme was used for gene amplification, the amplification time was 10s / 1kb, and the annealing temperature was 55°C: (1) Escherichia coli K-12 The ilvGMEDA operon was amplified from the MG1655 genome using the following primers: ilvL-F: aagccctccttgagtcacca; ilvL-R: tgtctgctcctcggttatgtt; by Escherichia coli K-12 The MG1655 genome was used as a template to amplify the lacI-ilvL terminator fragment containing lacI and ilvL terminator. The amplification primers were: 510-lacI-F: cataaccgaggagcagacaatgaaaccagtaacgttatacgatgtcg; 510-lacI-R: ggtaggcctgataagcgaagcgctatcaggcatttttcctcactgcccgctttccag; Artificially synthesized P L The fragments of lacO1 (SEQ ID NO.4) and gfp (SEQ ID NO.5) were used as templates to amplify P L lacO1-gfp fragment, amplification primers are: 510-F: cttcgcttatcaggcctacccgcgcgacaacgctgccaacttactgatttagtgtatga; YSZ-61:atttgatgcctctagagtcattatttgtatagttcatccatgccat; The synthetic peptide contains P15A (SEQ ID NO.7), cm r (SEQ ID NO.8) and rrnB T1terminator (SEQ ID NO.6) were used as templates to amplify rrnB T1 terminator-P15A-cm r Fragment, amplification primers are: YSZ-63:tgactctagaggcatcaaataaaacgaaagg; 510-R:gtgactcaaggagggcttcatcacccgacgcactttg.

[0019] (2) Use overlap extension PCR (OE-PCR) to connect the above gene fragments, using primestar enzyme, amplification time of 10 s / 1 kb, and annealing temperature of 55°C: ilvGMEDA operon, lacI-ilvL terminator, P LlacO1 -gfp three gene fragments were connected into fragment 1 by OE-PCR; rrnB T1 terminator-P15A-cm r As skeleton fragment 2; (3) Use the Gibson assembly method to connect fragment 1 and fragment 2, and incubate at 50°C for 50 minutes for chemical transformation; Chemical transformation steps: transfer this connection system into 100 μL JM109 competent cells, ice bath for 30 minutes, heat shock at 42°C for 1 minute, quickly ice bath for 2 minutes, add 1ml LB, and put in a 37°C shaker to recover for 1 hour. After the recovery, the cells are concentrated to a volume of 100 μL and spread on a plate containing cm r On a solid culture dish, culture overnight in a 37°C constant temperature incubator; (4) Colony PCR verifies the correctness of the single clone on the culture dish. Taq enzyme is used for gene amplification, the amplification time is 15s / 1kb, and the annealing temperature is 55℃. The verification primers are F: aacctcttacgtgccgatca; R: gcgaggaagcggaatatatc. After amplification, the target band is verified by agarose gel electrophoresis, and the band size is 3007bp. The single clone with the correct band size is sent to the sequencing company for sequencing.

[0020] (5) Insert the correctly sequenced monoclonal clone into cm r The cells were then incubated in 4 ml of liquid LB at 37°C for 12 hours to incubate the cells. Transformants containing the wild-type biosensor pBILE-WT (nucleotide sequence shown in SEQ ID NO. 9) were obtained.

[0021] Example 2 Concentration gradient experiment to determine the change in the detection limit of L-isoleucine The specific response of the wild-type ilvL-based biosensor pBILE-WT to L-isoleucine was verified experimentally.

[0022] (1) The biosensor pBILE-WT was transferred into Escherichia coli K-12 The MG1655 strain was cultured in a 37°C constant temperature incubator overnight.

[0023] (2) Pick a single clone from the culture dish and inoculate it into 4 mL LB (100 μg / mL Cm) liquid culture medium. Culture it at 37°C and 220 rpm for 8 h as seed solution.

[0024] (3) Centrifuge the bacterial solution at 4000 rpm for 5 minutes, discard the supernatant, gently pipette and resuspend the bacteria in M9NY medium (containing 1× M9 salt, 1 mMMgSO4, 0.1 mM CaCl2, 10 mg / L VB1, 10 g / L glucose) and repeat the above steps. Then transfer the resuspended bacterial solution after two washes to a 96-well plate for further processing. Add fresh M9NY (100 μg / mL Cm r ) medium, and then add different concentrations of L-isoleucine to the medium to make the final concentrations 0, 1, 2, 4, 8, 16, and 32 g / L, respectively. Finally, take an appropriate amount of seed solution and inoculate it into each well, and ensure that the OD after inoculation is 600 After sealing the sealing film, the deep-well plate was placed in a shaker at 30°C and 220 rpm for 20 h.

[0025] (4) Pipette 200 μL of sample into a black 96-well plate and measure the OD in an ELISA reader. 600 The parameters were set as follows: 470 nm excitation wavelength and 510 nm emission wavelength, gain value of 50, and 3 replicates were performed on each well to measure GFP / OD 600 The values ​​represent relative fluorescence intensity. 600 The vertical axis is the final concentration of L-isoleucine, and the horizontal axis is the final concentration of L-isoleucine. The graph was drawn using GraphPad Prism 8 software ( Figure 2 ). Depend on Figure 2 It can be seen that within the concentration range of 1-32 g / L of L-isoleucine, the response intensity of the wild-type biosensor pBILE-WT to L-isoleucine gradually increases. It can be seen that the biosensor pBILE-WT constructed in the present invention can be used for L-isoleucine detection.

[0026] However, from Figure 2 It can also be seen that the wild-type pBILE-WT sensor has a high GFP / OD 600 There is no gradient increase in the value of , that is, pBILE-WT cannot respond to low concentrations of L-isoleucine in a gradient manner and is not sensitive enough.

[0027] In addition, the response intensity is expressed as GFP / OD 600 The highest response value of pBILE-WT at 32 g / L was 651, which was a low response and might not meet the needs of subsequent experiments. Therefore, rational mutations of ilvL were designed to improve sensitivity and response strength.

[0028] Example 3 Construction of mutant sensor and concentration gradient detection The ilvL regulatory element itself encodes 5 L-isoleucine codons. By making a point mutation in the L-isoleucine coding region, it encodes 4 L-isoleucine codons. The reduction of L-isoleucine codons reduces the ribosome translation rate. It is speculated that the sensitivity of the entire expression system to the L-isoleucine concentration will be higher than that of the wild type. In addition, all codons in the 1B region (amino acids 14-17) of ilvL are mutated to L-isoleucine codons, so that the ilvL mutant has 9 L-isoleucine codons. At this time, the ribosome translation rate is increased, and it is speculated that the response intensity of this mutant will be higher. The specific operations are as follows: (1) In order to replace the L-isoleucine codon at position 13 in the leader peptide sequence of ilvL with an L-serine codon, the biosensor plasmid pBILE-WT based on the wild-type ilvL was used as a template and amplified with primers 13-F: tcgtgagcagcgtggtggtgattattatcc and primers 13-R: accacgctgctcacgaccaggctaatcactc. The amplified product was first digested with DpnI at 37°C for 1 hour, and 10 μL of the digested product was chemically transformed into JM109 to obtain a single clone. After verifying the correctness of the single clone, the mutant biosensor pBILE-ilvL / I13S (nucleotide sequence shown in SEQ ID NO.12) was obtained. This mutant can form a terminator loop when L-isoleucine is sufficient, but cannot form a terminator loop when L-isoleucine is deficient.

[0029] (2) In order to replace all codons at positions 14-17 in the ilvL leader peptide sequence with L-isoleucine codons, the ilvL biosensor plasmid pBILE-WT template was used in this example to amplify with primers 1B-F: cgtgattattattattattattattattatcccaccgtgcggg and primers 1B-R: ggtgggataataataataataataataatcacgaccaggctaatcact. The amplified product was first digested with DpnI at 37°C for 1 hour, and 10 μL of the digested product was chemically transformed into JM109 to obtain a single clone. After verifying the correctness of the single clone, the mutant biosensor pBILE-ilvL / 1B (nucleotide sequence shown in SEQ ID NO.13) was obtained.

[0030] (3) The concentration gradient experiment was used to determine the changes in the detection limit and response intensity of pBILE-ilvL / I13S and pBILE-ilvL / 1B to L-isoleucine. The specific implementation steps were the same as those in Example 2. 600 The vertical axis is the final concentration of L-isoleucine, and the horizontal axis is the final concentration of L-isoleucine. The graph was drawn using GraphPad Prism 8 software ( Figure 3 ).

[0031] Depend on Figure 3 It can be seen that the pBILE-ilvL / I13S sensor has a high GFP / OD 600 The values ​​of have a gradient response, that is, the sensitivity of pBILE-ilvL / I13S to low concentrations of L-isoleucine is higher than that of the wild type.

[0032] Depend on Figure 3 It can be seen that the pBILE-ilvL / 1B sensor has a high GFP / OD 600 The values ​​of GFP / OD increased, with the highest value being 771, indicating that the response intensity of pBILE-ilvL / 1B to L-isoleucine was higher than that of the wild type. In particular, within the L-isoleucine concentration range of 2-32 g / L, the GFP / OD 600 The gradient difference and response value are improved compared with the wild type, which is more conducive to the application of the sensor in L-isoleucine detection.

[0033] Example 4 Application of mutant sensor pBILE-ilvL / I13S in detection of L-isoleucine producing strains (1) First, the pBILE-ilvL / I13S plasmid was introduced into the production strain YD capable of producing L-isoleucine by chemical transformation to obtain the recombinant strain YD-pBILE-ilvL / I13S; (2) Inoculate the single clone YD-pBILE-ilvL / I13S obtained in step 1 into a shaking tube containing LB and culture overnight.

[0034] (3) The seed solution obtained from the overnight culture in step 2 was transferred to a deep-well plate containing M9NY fermentation medium for fermentation culture for 20 hours. Samples were taken every 4 hours to detect the L-isoleucine production (HPLC method) and the OD was detected at the same time. 600 and GFP fluorescence values.

[0035] (4) Process the data to analyze the GFP / OD 600 The final concentration of L-isoleucine was used as the ordinate, and the sampling time was used as the abscissa. GraphPad Prism 8 software was used to draw the graph ( Figure 4 The Pearson correlation coefficient was used for analysis. The correlation coefficient r represents the statistic of the linear correlation strength and direction between two random variables. It is between -1 and 1. 0 means no correlation at all. A value greater than 0.8 indicates a strong correlation. A value less than 0.3 indicates a weak correlation. The closer the absolute value of the correlation coefficient is to 1, the higher the correlation. After calculation, the L-isoleucine production of the strain is related to the individual fluorescence value (GFP / OD 600 ) is 0.93, indicating that the correlation between the two is very high, verifying the accurate monitoring function of the sensor system in the actual fermentation process.

[0036] Example 5 Application of mutant sensor pBILE-ilvL / 1B in detection of L-isoleucine producing strains (1) First, the pBILE-ilvL / 1B plasmid was introduced into the production strain YD capable of producing L-isoleucine by chemical transformation to obtain the recombinant strain YD-pBILE-ilvL / 1B; (2) Inoculate the single clone YD-pBILE-ilvL / 1B obtained in step 1 into a shaking tube containing LB and culture overnight.

[0037] (3) The seed solution obtained from the overnight culture in step 2 was transferred to a 250 ml conical flask containing M9NY fermentation medium for fermentation culture for 24 hours. Samples were taken every 6 hours to detect the L-isoleucine production (HPLC method) and the OD was measured at the same time. 600 and GFP fluorescence values.

[0038] (4) Process the data to analyze the GFP / OD 600The final concentration of L-isoleucine was used as the ordinate, and the sampling time was used as the abscissa. GraphPad Prism 8 software was used to draw the graph ( Figure 5 The Pearson correlation coefficient was used for analysis. The correlation coefficient r represents the statistic of the linear correlation strength and direction between two random variables. It is between -1 and 1. 0 means no correlation at all. A value greater than 0.8 indicates a strong correlation. A value less than 0.3 indicates a weak correlation. The closer the absolute value of the correlation coefficient is to 1, the higher the correlation. After calculation, the L-isoleucine production of the strain is related to the individual fluorescence value (GFP / OD 600 ) is 0.957, indicating that the correlation between the two is very high, verifying the accurate monitoring function of the sensor system in the actual fermentation process.

[0039] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent. It should be pointed out that, for ordinary technicians in this field, the above-mentioned implementation methods can also be modified, combined and improved without departing from the concept of this patent, which all belong to the protection scope of this patent. Therefore, the protection scope of this patent shall be based on the claims.

Claims

1. A biosensor responsive to L-isoleucine, characterized in that The biosensor comprises the following elements: ilvGMEDA operon, lacI gene, ilvL terminator, P LlacO1 promoter, and reporter gene.

2. A biosensor responsive to L-isoleucine as claimed in claim 1, characterized in that: The reporter genes include but are not limited to gfp , rfp , cfp , sfgfp , egfp , yfp , ecfp Isogenic.

3. A biosensor responsive to L-isoleucine as claimed in claim 1, characterized in that: The sensor further comprises a replicon gene, and / or a resistance gene.

4. A biosensor responsive to L-isoleucine as claimed in claim 1, characterized in that: The biosensor comprises: a wild-type ilvGMEDA operon, a lacI gene, an ilvL terminator, P LlacO1 promoter, gfp reporter gene, rrnB T1 terminator, P15A replication origin and cm r Resistance gene, the biosensor nucleotide sequence is shown as SEQ ID NO.

9.

5. A biosensor responsive to L-isoleucine as claimed in claim 4, characterized in that: The ilvL in the ilvGMEDA operon undergoes an I13S mutation, or the 14th to 17th amino acids of the ilvL in the ilvGMEDA operon are all mutated to L-isoleucine.

6. A biosensor responsive to L-isoleucine as claimed in claim 4, characterized in that: The biosensor comprises: an ilvGMEDA operon in which ilvL undergoes an I13S mutation, a lacI gene, an ilvL terminator, P LlacO1 promoter, gfp reporter gene, rrnB T1 terminator, P15A replication origin and cm r Resistance gene, the biosensor nucleotide sequence is shown in SEQ ID NO.12; or, The biosensor comprises: an ilvGMEDA operon in which the 14th to 17th amino acids of ilvL are mutated to L-isoleucine, a lacI gene, an ilvL terminator, P LlacO1 promoter, gfp reporter gene, rrnB T1 terminator, P15A replication origin and cm r Resistance gene, the biosensor nucleotide sequence is shown as SEQ ID NO.

13.

7. Use of the biosensor according to any one of claims 1 to 6 in detecting a sample containing L-isoleucine or screening an L-isoleucine-producing strain.

8. The use according to claim 7, characterized in that The biosensor is introduced into an L-isoleucine-producing strain to detect the production of L-isoleucine.

9. An ilvL mutant, characterized in that: Specifically, it is an ilvL / I13S mutant with I13S mutation, the nucleotide sequence of which is shown in SEQ ID NO.10; or an ilvL / 1B mutant with amino acids at positions 14-17 mutated to L-isoleucine, the nucleotide sequence of which is shown in SEQ ID NO.

11.

10. Use of the ilvL mutant according to claim 9 in detecting L-isoleucine.

Images