Application of rice OsORR1 gene in controlling drought resistance of rice

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses application of a rice OsORR1 gene in controlling drought resistance of rice. The OsORR1 gene capable of improving the drought tolerance of rice is obtained through separation, cloning and functional verification, the nucleotide sequence of the OsORR1 gene is as shown in SEQ ID NO.1, and the sequence of protein coded by the gene is as shown in SEQ ID NO.2. The candidate gene is subjected to CRISPR mutant phenotype identification, and seedling stress phenotype identification shows that when the gene segment is deleted, the drought resistance of rice is reduced, and the drought resistance of the rice can be remarkably enhanced by overexpression of OsORR1, so that the function and the application way of the gene are proved.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of rice OsORR1 gene in controlling rice drought resistance. The present invention adopts a candidate gene screening method to clone a gene OsORR1 that positively regulates rice drought resistance, and biological function verification shows that it can improve the tolerance of rice under drought stress. Co-segregation detection experiments show that the phenotype of the osorr1 mutant is closely related to drought stress. The present invention confirms the biological function of the gene and its application approach and method. Background Art

[0002] In recent years, with the intensification of climate change and the growth of the global population, the shortage of freshwater resources has become increasingly serious, which has brought inevitable negative impacts on agricultural production and food security. Drought stress has also become the biggest abiotic stress affecting agricultural development. As an important food crop and model plant, rice will be restricted in yield and quality if it is subjected to drought stress at any stage of its growth and development (Zhu et al., The impact of high temperature and drought stress on the yield of major staple crops in northern China. J Environ Manage, 2022. 314: 115092). Although breeders have made good progress in improving and cultivating stress-resistant crops over the years, these advances still cannot guarantee food security in the face of the global problems of population growth and water shortage.

[0003] Abiotic stresses such as drought, high salt, and extreme temperature can cause cell dehydration and osmotic stress in plant cells. Osmotic stress is a complex signal transduction process. When cells perceive external osmotic stress, it will cause intracellular calcium ion bursts and ABA synthesis, which will eventually lead to plant growth retardation, aging, and death. Plants sense changes in extracellular environmental conditions and transmit them to cells through various pathways, inducing the expression of some response genes, producing some functional proteins and osmotic regulating substances that protect cells from osmotic stress damage to adapt to adverse growth environments (Xiong et al., Cell signaling during cold, drought and salt stress. Plant Cell. 14 (suppl), S165–S183, 2002). However, current research on plant osmotic stress responses mainly focuses on mid-term signal transduction of stress and long-term adaptation of plants to stress. The early stress events of osmotic stress and how cells perceive osmotic stress are still unknown.

[0004] Plants' defense against external stress depends on complex cell-environment and cell-to-cell signal transduction. As one of the largest protein families in plants, RLKs can sense extracellular signals and transduce them into cells. Since they were first discovered in corn (Walker JC, Zhang R. Relationship of a putative receptor protein kinase from maize to the S-locus glycoproteins of Bras sica. Nature, 1990, 34), RLKs have been discovered in other species and have been widely studied. Typical RLKs usually consist of three protein domains: extracellular domain (ECLB); transmembrane domain (TM); and cytoplasmic kinase domain (CKD). ECLB is located at the N-terminus and is connected to the signal peptide (SP). It senses external signals, aggregates with homologous or heterologous proteins, and starts the signal transduction process (Zhu Q, Feng Y, Xue J, Chen P, Zhang A, Yu Y. Advances in Receptor-like Protein Kinases in Balancing Plant Growth and Stress Responses. Plants. 2023; 12(3): 427.). There are 376 RLKs in rice that lack characteristic signal sequences or transmembrane sequences, which are called cytoplasmic kinases (RLCKs).The remaining RLKs are divided into 15 types according to the characteristic motifs of their extracellular domains, namely, extensin like, leucine-rich repeat (LRR), Catharanthus roseus like (Cr RLK), CRINKLY-like (CR-like), proline-rich extensin like (PERK), the domain of unknown function 26 (DUF26), lysine motif (LysM), lectin (including L-lectin and C-lectin), self-incompatibility domain (SD), wall-associated kinase (WAK), leaf rust kinase-like (LRK), receptor-like kinase in vitro (R-RK), and lectin-like kinase (R-RK). flowers, RKF), unknown receptor kinase (URK) (Gao LL, Xue HW. Global analysis of expression profiles of rice receptor-like kinase genes. Mol Plant, 2012, 5: 143-153). Among them, DUF26 receptor kinases are also called cysteine-rich receptor kinases (CRKs). The extracellular domain of its subfamily contains one or two DUF26 domains, which contain three conserved cysteine ​​residues C-X8-C-X2-C. This domain may play an important role in its perception of extracellular signals. Arabidopsis contains 46 CRKs, which play an important role in the regulation of plant growth and development, stomatal response, hormone response, defense against pathogens, and biotic and abiotic stresses.

[0005] There are 54 members in the cysteine-rich receptor kinase CRKs family in rice, but there are few reports on CRKs related to abiotic stress responses (Ye, T., Wang, H., An, C., Tu, H., Zhang, L., Hu, D., Xiong, H. and Xiong, L. (2024), An expanded cysteine-rich receptor-like kinase gene cluster functionally differentiates in drought, cold, heat, and pathogen stress responses in rice. Plant Biotechnol. J, 22: 2672-2674). The OsORR1 (Osmotic-Responsive RLK 1) gene involved in the present invention belongs to the rice CRKs family. Phenotypic studies of mutants and transgenic plants have found that it plays an important role in osmotic stress such as drought. Therefore, identifying its role in osmotic stress such as drought and exploring its function in improving rice drought resistance will be of great significance for breeding new drought-resistant rice varieties. Summary of the invention

[0006] The object of the present invention is to provide an application of rice OsORR1 gene in controlling rice drought resistance. The protein encoded by the OsORR1 gene is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide an application of rice OsORR1 gene in creating drought-resistant rice. The protein encoded by the OsORR1 gene is shown in SEQ ID NO.2.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] By using the candidate gene screening method, the applicant cloned the rice drought resistance regulating gene OsORR1, which belongs to the CRKs protein family. The functional loss of this gene will lead to a weakening of rice resistance under drought stress. The protein encoded by the gene is shown in SEQ ID NO.2, and one of the genes encoding the protein is shown in SEQ ID NO.1.

[0010] The protection scope of the present invention includes:

[0011] Application of rice OsORR1 gene in controlling rice drought resistance, wherein the protein encoded by the OsORR1 gene is shown in SEQ ID NO.2;

[0012] The above-mentioned applications are specifically:

[0013] Increasing the expression of OsORR1 gene in rice to improve drought resistance of rice;

[0014] Specifically, a substance that increases the expression level of the OsORR1 gene in rice is introduced into the rice. Preferably, the substance is a nucleic acid molecule containing the OsORR1 gene, or an expression frame, a recombinant vector, or a recombinant microorganism thereof.

[0015] The expression vector carrying the OsORR1 gene of the present invention can be introduced into plant cells by conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, Method for Plant Molecular Biology VIII, Academy Press, New York, 1998, pp. 411-463; Geiserson and Corey, Plant Molecullar Biology (2nd Edition), 1998).

[0016] Knocking out or inhibiting the OsORR1 gene in rice can weaken the drought resistance of rice.

[0017] The knockout method includes: homologous recombination or CRISPR-Cas9 technology, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein.

[0018] The inhibition methods include: antisense RNA technology or interfering RNA technology.

[0019] In the above application, preferably, the knockout adopts the CRISPR / Cas9 system, and the gRNA target site in the system is that the target site of the Kitaake background gRNA is target site 1: AGGAGGAGCGTAGTGGTGCA and target site 2: CCCCAAGAACCCTC CCGGTC; the target site of the ZH11 background gRNA is target site 1: GCCAAGGCATGGCATTTCTG and target site 2: GCAGC TGTGCGCGTACGCCA.

[0020] In the above application, the rice with weakened drought resistance after editing by the CRISPR / Cas9 system has a polynucleotide shown by SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0021] In the above application, preferably, the OsORR1 gene is shown as SEQ ID NO.1.

[0022] Application of rice OsORR1 gene in creating drought-resistant rice varieties.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] The applicant disclosed for the first time that the OsORR1 gene of rice is related to the drought resistance of rice. This gene can be transformed into a variety of plants including rice and used to cultivate new varieties of drought-resistant plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the gene editing status of rice osorr1 CRISPR mutant;

[0026] osorr1-k is a CRISPR homozygous mutant family in Kitaake background; osorr1-22 and osorr1-40 are CRISPR homozygous mutant families in ZH11 background.

[0027] Figure 2 The root length phenotype of the osorr1-k CRISPR rice mutant after osmotic stress at the seedling stage;

[0028] Figure A shows the osmotic stress (150 mM Mannitol) treatment of the homozygous osorr1 mutant in the Kitaake background at the seedling stage, and Kitaake was used as the control. Figure A shows the main root growth of the experimental group and the control group. Figure B shows the root length statistics of three independent seedling osmotic stress experiments. Data difference analysis was performed using Student's t-test, P<0.05.

[0029] Figure 3 The plant phenotype of the rice osorr1 CRISPR mutant after osmotic stress at the seedling stage;

[0030] Figure A shows the growth status of plants before and after osmotic stress (20% PEG6000) treatment at the seedling stage for two homozygous mutant families of osorr1 in the ZH11 background. Figure B shows the statistical values ​​of survival rate of three independent seedling osmotic stress experiments. One-way AN OVA and Tukey's t-test were used for data difference analysis, P<0.05.

[0031] Figure 4 This is the drought stress phenotype of the osorr1 CRISPR rice mutant at the seedling stage;

[0032] Figure A shows the drought stress treatment of the osorr1 homozygous mutant family in the ZH11 background at the seedling stage, and Zhonghua 11 (ZH11) was used as the control. The left and right sides of Figure A show the plant growth status before and after drought stress treatment, respectively. Figure B shows the statistical value of the survival rate of three independent seedling drought stress experiments. The data difference was analyzed by Student's t-test, P<0.05.

[0033] Figure 5 The plant phenotype of OsORR1 overexpressing rice at the seedling stage after osmotic stress;

[0034] Figure A shows the changes in OsORR1 expression in ZH11 background overexpression materials detected by real-time fluorescence quantitative PCR. The overexpression of OsORR1 in the three strains was about 20 times. The rice ACTIN7 gene was used as the internal reference gene. The data are the average of three replicates plus the standard error; Figure B shows the plant growth status of the three OsORR1 overexpression families (OE-4, OE-10, OE-13) before and after seedling osmotic stress (20% PEG6000) treatment; Figure C shows the survival rate statistics of three independent seedling osmotic stress experiments. One-way ANOVA and Tukey's t-test were used for data difference analysis, P<0.05. DETAILED DESCRIPTION

[0035] The following examples define the present invention and describe the methods of the present invention in constructing osorr1 CRISPR mutants, cloning DNA fragments containing the complete coding region of the OsORR1 gene, and verifying the function of the OsORR1 gene. Based on the following description and these examples, those skilled in the art can determine the essential characteristics of the present invention, and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to adapt it to different uses and conditions.

[0036] Example 1: Construction of osorr1 CRISPR mutants

[0037] The gene sequence of the OsORR1 gene was obtained from the rice gene database Rice Data (http: / / www.ricedata.cn / gene / ). Two target sites were selected according to CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The vector construction of the CRISPR mutant strain can refer to the relevant literature (Chen K, Ke R, Du M, Yi Y, Chen Y, Wang X, Yao L, Liu H, Hou X, Xiong L, Yang Y, Xie KA FLASH pipeline for arrayed CRISPR library construction and the gene function discovery of rice receptor-like kinases. Mol Plant. 2022 Feb 7; 15 (2): 243-257.), which is not described in detail in this manual due to limited space. The target sites selected on the CRISPR-P v2.0 website are as follows:

[0038] Kitaake background target site 1: AGGAGGAGCGTAGTGGTGCA

[0039] Kitaake background target site 2: CCCCAAGAACCCTCCCGGTC

[0040] ZH11 background target site 1: GCCAAGGCATGGCATTTCTG

[0041] ZH11 background target site 2: GCAGCTGTGCGCGTACGCCA

[0042] The two CRISPR vectors OsORR1-CRISPR-k and OsOR R1-CRISPR-z constructed above were respectively transferred into rice varieties "Kitaake" and "Zhonghua 11" (two conventional rice varieties from the Institute of Rice Science, Chinese Academy of Agricultural Sciences) by Agrobacterium-mediated rice genetic transformation method, and transgenic plants were obtained after pre-culture, infection, co-cultivation, screening of callus with hygromycin resistance, differentiation, rooting, seedling training, and transplanting. The above Agrobacterium-mediated rice genetic transformation method (system) is improved on the basis of the method reported by Hiei et al. (Hiei et al., Effective transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the bou ndaries of the T-DNA, Plant J, 6: 271-282, 1994) (see the transformation steps below).

[0043] The specific genetic transformation steps of this embodiment are as follows:

[0044] (1) Electrotransformation: The final CRISPR target vectors OsORR1-CRISPR-k and OsORR1-CRISPR-z were electrotransformed into the Agrobacterium EHA105 strain using a voltage of 1800 V, spread on LA medium with corresponding resistance selection, and screened for positive clones for the following transformation callus.

[0045] (2) Callus induction: The mature rice seeds Kitaake and Zhonghua 11 were shelled and then treated with 70% ethanol for 1 minute and 0.15% mercuric chloride (HgCl2) for 15 minutes; the seeds were washed with sterile water for 4-5 times; the sterilized seeds were placed on an induction medium; the inoculated callus induction medium was cultured in the dark for 4 weeks at a temperature of 25±1°C.

[0046] (3) Callus subculture: Select bright yellow, compact and relatively dry embryonic calli and culture them on subculture medium in the dark at 25±1℃ for 2 weeks.

[0047] (4) Preculture: Select compact and relatively dry embryonic calli and culture them on preculture medium in the dark at 25±1°C for 2 weeks.

[0048] (5) Agrobacterium culture: Agrobacterium EHA105 (derived from CAMBIA, a commercial strain, carrying the CRISPR vectors OsORR1-CRISPR-k and OsORR1-CRISPR-z of the present invention) was pre-cultured on LA medium with corresponding resistance selection for two days at a culture temperature of 28° C. The Agrobacterium was transferred to a suspension culture medium and cultured on a shaker at 28° C. for 2-3 hours.

[0049] (6) Agrobacterium infection: transfer the pre-cultured callus into a sterilized bottle; adjust the Agrobacterium suspension to an OD of 600 0.8-1.0; soak the callus in the Agrobacterium suspension for 30 minutes; transfer the callus to the sterilized filter paper and dry it; then place it on the co-culture medium and culture it for 3 days at a culture temperature of 19-20°C.

[0050] (7) Callus washing and selective culture: Wash callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer callus to sterilized filter paper and blot dry; transfer callus to selective medium for selection 2-3 times, each time for 2 weeks (the first screening carbenicillin concentration is 400 ppm, the second and subsequent screenings are 250 ppm, and the hygromycin concentration is 250 ppm).

[0051] (8) Differentiation: Transfer the resistant calli to the pre-differentiation medium and culture in the dark for 5-7 weeks; transfer the pre-differentiation culture calli to the differentiation medium and culture under light at 26°C.

[0052] (9) Rooting: Cut off the roots produced during differentiation; then transfer them to rooting medium and culture them under light at 26°C for 2-3 weeks.

[0053] (10) Transplantation: Wash off the residual culture medium on the roots and transfer the seedlings with good root system into the greenhouse while keeping them moist for the first few days.

[0054] According to the above gene editing target sites, primers were designed to detect the editing of OsORR1 gene in mutants. The primers (OsORR1-CR-F: 5'-CTTTGTCGTCTGACCCGGATC-3' and OsORR1-CR-R: 5'-GTCACG TTCCGCACCTTGC-3') were used to perform specific PCR amplification of OsORR1 gene in ZH11 background mutants, and the amplified PCR products were sequenced. The sequencing results showed that in the osorr1-22 CRISPR homozygous mutant family, the OsORR1 gene had a large fragment deletion of 248 bases between target 1 and target 2, resulting in a frameshift mutation and premature termination of translation at amino acid 178; in the osorr1-40 CRISPR homozygous mutant family, the OsORR1 gene had a large fragment deletion of 264 bases between target 1 and target 2, resulting in a partial deletion of the extracellular DUF26 domain.

[0055] Kitaake background mutants were amplified by PCR using primers (OsORR1-KCR-F: 5'-AAAAAGATTACGCGGGGATAATCGA-3' and Os ORR1-KCR-R: 5'-AATCTAGACATATATATGAATGCGG-3') for the OsORR1 gene. Sequencing results showed that in the osorr1-k CRISPR homozygous mutant family, the OsORR1 gene had a deletion of bases 21 to 23 at target site 1, resulting in a deletion encoding a threonine, and a deletion of bases 683 to 689 at target site 2, resulting in a frameshift mutation, and translation terminated prematurely at amino acid 285.

[0056] That is, the OsORR1 genes in the three mutant families (osorr1-22, osorr1-40 and osorr1-k) all mutated, and the mutated OsOR R1 genes are shown in SEQ ID NO.3-5.

[0057] Example 2: Cloning of OsORR1 gene and construction of overexpression vector

[0058] According to the Rice Data ( http: / / www.ricedata.cn / gene / ) Primers OsORR1-F (5'-ATCCAGAT CCAGTGGGATCCATGGCGATGCACCCGTGC-3') and OsORR1-R (5'-GCGGCCGCACTAGTAAGCTTTC TAGGATAGGGATCAGTATTGG-3') were designed. The cDNA of rice variety Zhonghua 11 leaves was used as a template to amplify the CDS sequence encoded by the OsORR1 gene using primers OsORR1-F and OsORR1-R. The sequence is shown in SEQ ID NO.1, and the encoded protein is shown in SEQ ID NO.2.

[0059] The PCR reaction conditions were: 95°C pre-denaturation for 3 min; 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 35 cycles. The obtained PCR product was connected to the pU1301 vector digested with restriction endonucleases HindⅢ and BamHI by the Gibson Assembly method, and the vector was sequenced to confirm, and finally the OsORR1 gene overexpression vector that can be used for genetic transformation was obtained.

[0060] Example 3: Identification of root length phenotype of osorr1 mutant in Kitaake background under osmotic stress

[0061] The homozygous mutant osorr1-k and wild-type rice Kitaake with identified genotypes in Example 1 were germinated, and the seeds with consistent germination were planted in 96-well plates. The hydroponic test was repeated 3 times. The growth chamber culture conditions were 28°C, light / dark: 16 / 8h, and humidity 50%. The seeds with consistent germination were subjected to 150mM Mannitol osmotic stress, and photos were taken after 4-5 days of growth to record the root length of the plants.

[0062] The results showed that compared with the Kitaake control, the taproot growth of the CRISPR homozygous mutant plants showed an osmotic stress-sensitive phenotype ( Figure 2 Middle A). After 5 days of cultivation under normal conditions, there was no difference in the growth and development of the taproot between the osorr1-k homozygous mutant and the wild-type Kitaake, both of which were about 10 cm. Under 5 days of osmotic stress treatment, the root lengths of the osorr1-k homozygous mutant and the Kitaake control were 4.2 cm and 6.7 cm, respectively. The statistical results showed that under osmotic stress, the root length of the osorr1-k mutant was significantly shorter than that of the wild-type Kitaake control ( Figure 2 (middle B).

[0063] Example 4: Phenotypic identification of osorr1 seedling mutants in ZH11 background under osmotic stress

[0064] The homozygous mutants (osorr1-22, osorr1-40) and wild-type rice Zhonghua 11 (ZH11) with identified genotypes in Example 1 were germinated, and seeds with consistent germination were planted in 96-well plates. The hydroponic test was repeated 3 times. The culture conditions in the growth chamber were 28°C, light / dark: 16 / 8h, and humidity 50%. The healthy 4-leaf plants were subjected to 20% PEG6000 osmotic stress treatment. After three days (depending on the seedling conditions), the root PEG was rinsed and rehydrated for 5-7 days, and the survival rate of the plants was investigated.

[0065] The results showed that compared with the ZH11 control, the CRISPR homozygous mutant plants showed an osmotic stress-sensitive phenotype ( Figure 3 (A). After osmotic stress recovery, the average survival rates of osorr1-22, osorr1-40 mutants and the control ZH11 were 15.8%, 32.8% and 51.4%, respectively. The statistical results showed that the survival rate of the osorr1 mutant after osmotic stress rehydration was significantly lower than that of the wild-type ZH11 control ( Figure 3 Middle B), indicating that knockout of OsORR1 would lead to weakened anti-hyperosmotic ability.

[0066] Example 5: Phenotypic identification of osorr1 mutants under drought stress at the seedling stage in the ZH11 background

[0067] The homozygous mutant (osorr1-22) and wild-type rice Zhonghua 11 (ZH11) with identified genotypes in Example 1 were germinated and then directly seeded into small round barrels. The soil used in the experiment was a mixture of paddy soil in southern China and coarse sand in a volume ratio of 2:3. An equal amount of uniform sandy soil was added to each round barrel with an equal volume of water. The water leaked by itself to ensure the consistency of soil compaction. The experiment was repeated 3 times. The healthy 4-leaf stage plants were deprived of water and drought stress for 6-10 days (depending on the weather conditions), and then rehydrated for 5-7 days, photographed and investigated the survival rate of the plants.

[0068] The results showed that compared with the ZH11 control, the CRISPR homozygous mutant plants showed a drought stress-sensitive phenotype ( Figure 4 (A). After drought stress recovery, the average survival rates of osorr1-22 and the control ZH11 were 17.8% and 51.1%, respectively. The statistical results showed that the survival rate of the osorr1 mutant after drought rehydration was significantly lower than that of the wild-type ZH11 ( Figure 4 Middle B), indicating that knockout of OsORR1 would lead to weakened drought resistance.

[0069] Example 6: Phenotypic Identification of OsORR1 Overexpressing Rice at Seedling Stage after Osmotic Stress

[0070] In order to screen the materials with overexpression of OsORR1 gene, the expression of OsORR1 in young leaves of T0 rice was detected by real-time fluorescence quantitative PCR. The results showed that the expression level of OsORR1 gene in OE-4, OE-10 and OE-13 lines was significantly increased (see Figure 5 Figure A in Figure 1). The identified overexpression materials (OE-4, OE-10 and OE-13) and wild-type rice Zhonghua 11 (ZH11) were germinated and planted in 96-well plates. The hydroponic experiment was repeated three times. The growth chamber culture conditions were 28°C, light / dark: 16 / 8h, and humidity 50%. The healthy 4-leaf stage plants were subjected to 20% PEG6000 osmotic stress treatment. After three days (depending on the seedling conditions), the root PEG was washed and rehydrated for 5-7 days. Figure 5 The left and right pictures in B were taken before and after osmotic stress treatment, respectively.

[0071] The results showed that after recovery from osmotic stress, the average survival rates of the overexpression lines OE-4, OE-10, OE-13 and wild-type ZH11 were 70.9%, 87.5%, 85.4% and 47.9%, respectively. The survival rate of the overexpression plants was significantly lower than that of the wild-type ZH11 control, indicating that overexpression of OsORR1 can improve the osmotic resistance of rice ( Figure 5 Medium B and Figure 5 Middle C).

Claims

1. Rice OsORR1 Application of genes in controlling drought resistance of rice, the OsORR1 The protein encoded by the gene is shown as SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: Improve rice OsORR1 The expression level of genes can be used to improve the drought resistance of rice.

3. The use according to claim 2, characterized in that: It will increase rice OsORR1 Gene expression levels of substances introduced into rice.

4. The use according to claim 3, characterized in that: The substance described is OsORR1 A nucleic acid molecule of a gene, or an expression frame thereof, a recombinant vector, or a recombinant microorganism.

5. The use according to claim 1, characterized in that: Knockout or suppression of rice OsORR1 Genes to reduce rice's drought resistance.

6. The use according to claim 5, wherein the knockout method comprises: Homologous recombination or CRISPR-Cas9 technology, the protein translated from the knocked-out gene has no original function or cannot be translated into protein.

7. The use according to claim 5, wherein the method of suppressing comprises: Antisense RNA technology or interfering RNA technology.

8. The use according to claim 6, wherein the knockout is carried out using the CRISPR / Cas9 system, if the rice variety to be knocked out is Kitaake , its gRNA target sites are target site 1: AGGAGGAGCGTAGTGGTGCA and target site 2: CCCCAAGAACCCTCCCGGTC; if the rice variety to be knocked out is ZH11, its gRNA target sites are target site 1: GCCAAGGCATGGCATTTCTG and target site 2: GCAGCTGTGCGCGTACGCCA.

9. The use according to claim 1, characterized in that: The OsORR1 The gene is shown as SEQ ID NO.

1.

10. Rice OsORR1 The application of genes in creating drought-resistant rice, the OsORR1 The protein encoded by the gene is shown as SEQ ID NO.2.

Images