Application of rice OsORR1 gene in controlling drought resistance of rice
By cloning and regulating the rice OsORR1 gene, and utilizing CRISPR-Cas9 technology or increasing the expression level of OsORR1, the lack of early stress events under osmotic stress in rice drought resistance breeding was addressed, thereby improving the survival ability of rice under drought stress.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-02
- Publication Date
- 2026-03-24
AI Technical Summary
Existing technologies have insufficient research on early stress events of osmotic stress in rice drought resistance breeding, and lack effective gene regulation methods, resulting in limited yield and quality of rice under drought stress.
The rice OsORR1 gene was cloned using a candidate gene screening method. The drought resistance of rice was regulated by knocking out or inhibiting the OsORR1 gene using CRISPR-Cas9 technology, or the drought resistance of rice was enhanced by increasing the expression level of the OsORR1 gene.
It significantly improved the drought resistance of rice under drought stress, enhanced its survival ability under osmotic stress, and promoted the breeding of new drought-resistant rice varieties.
Smart Images

Figure HDA0005115743690000011 
Figure HDA0005115743690000012 
Figure HDA0005115743690000013
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the rice OsORR1 gene in controlling rice drought resistance. Using a candidate gene screening method, this invention cloned a gene, OsORR1, that positively regulates rice drought resistance. Biological function verification showed that it can improve rice's tolerance to drought stress. Co-segregation detection experiments showed that the phenotype of the OsORR1 mutant was closely associated with drought stress. This invention confirms the biological function of this gene and its application pathways and methods. Background Technology
[0002] In recent years, with the intensification of climate change and the growth of the global population, the problem of freshwater scarcity has become increasingly severe, inevitably bringing negative impacts to agricultural production and food security. Drought stress has become the most significant abiotic stress affecting agricultural development. Rice, as an important food crop and model plant, experiences reduced yield and quality at any stage of its growth and development due to drought stress (Zhu et al., The impact of high temperature and drought stress on the yield of major staple crops in northern China. J Environ Manage, 2022.314:115092). Although breeders have made considerable progress in improving and cultivating stress-resistant crops over the years, these advances still cannot guarantee food security in the face of the global challenges of population growth and water scarcity.
[0003] Drought, high salinity, and extreme temperatures are all abiotic stresses that cause cellular dehydration, leading to osmotic stress in plant cells. Osmotic stress is a complex signal transduction process. Upon sensing external osmotic stress, cells experience an intracellular calcium ion burst and ABA synthesis, ultimately resulting in inhibited growth, senescence, and death. Plants sense changes in extracellular environmental conditions and transmit these changes into the cell through various pathways, inducing the expression of response genes and the production of functional proteins and osmotic regulators that protect cells from osmotic stress to adapt to adverse growth environments (Xion g et al., Cell signaling during cold, drought, and salt stress. Plant Cell. 14(suppl), S165–S183, 2002). However, current research on plant osmotic stress responses mainly focuses on mid-stress signal transduction and long-term plant adaptation to stress. Early stress events and how cells sense osmotic stress remain unknown.
[0004] Plant defense against external stress relies on complex cell-environment and cell-to-cell signal transduction. As one of the largest protein families in plants, RLKs sense extracellular signals and transduce them into the cell. Since their initial discovery in maize (Walker JC, Zhang R. Relationship of a putative receptor protein kinase from maize to the S-locus glycoproteins of Brassica. Nature, 1990, 34), RLKs have been discovered in other species and extensively studied. Typical RLKs usually consist of three protein domains: an extracellular domain (ECLB); a transmembrane domain (TM); and a cytoplasmic kinase domain (CKD). The ECLB is located at the N-terminus and is linked to a signal peptide (SP). It senses external signals and polymerizes with homologous or heterologous proteins to initiate signal transduction (Zhu Q, Feng Y, Xue J, Chen P, Zhang A, Yu Y. Advances in Receptor-like Protein Kinases in Balancing Plant Growth and Stress Responses. Plants. 2023; 12(3):427.). 376 RLKs lacking characteristic signal sequences or transmembrane sequences exist in rice and are called cytoplasmic kinases (RLCKs).The remaining RLKs are classified into 15 types based on the characteristic motifs of their extracellular domains: extensin-like, leucine-rich repeat (LRR), Catharanthus roseus-like (Cr RLK), CRINKLY-like (CR-like), proline-rich extensin-like (PERK), domain of unknown function 26 (DUF26), lysin motif (LysM), lectin (including L-lectin and C-lectin), self-incompatible domain (SD), wall-associated kinase (WAK), leaf rust kinase-like (LRK), and flower receptor kinase. Flowers (RKF), unknown receptor kinase (URK) (Gao LL, Xue HW. Global analysis of expression profiles of rice receptor-like kinase genes. Mol Plant, 2012, 5:143-153). Among them, DUF26 receptor kinases, also known as cysteine-rich receptor kinases (CRKs), have extracellular domains containing one or two DUF26 domains, which contain three conserved cysteine residues C-X8-C-X2-C. This domain may play an important role in sensing extracellular signals. Arabidopsis contains 46 CRKs, which play important functions in regulating plant growth and development, stomatal response, hormone response, pathogen defense, and biotic and abiotic stress.
[0005] The rice cysteine-rich receptor-like kinase (CRK) family comprises 54 members, but few CRKs related to abiotic stress responses have been reported (Ye, T., Wang, H., An, C., Tu, H., Zhang, L., Hu, D., Xiong, H. and Xiong, L. (2024), An expanded cysteine-rich receptor-like kinase gene cluster functionally differentiates in drought, cold, heat, and pathogen stress responses in rice. Plant Biotechnol. J, 22:2672-2674). The OsORR1 (Osmotic-Responsive RLK 1) gene involved in this invention belongs to the rice CRK family. Phenotypic studies of mutants and transgenic plants have revealed its important role in drought-isotonic stress. Therefore, identifying its role in drought-isotonic stress and exploring its function in improving rice drought resistance is of great significance for breeding new drought-resistant rice varieties. Summary of the Invention
[0006] The purpose of this invention is to provide the application of the rice OsORR1 gene in controlling the drought resistance of rice, wherein the protein encoded by the OsORR1 gene is shown in SEQ ID NO.2.
[0007] Another object of the present invention is to provide the application of the rice OsORR1 gene in the creation of drought-resistant rice, wherein the protein encoded by the OsORR1 gene is shown in SEQ ID NO.2.
[0008] To achieve the above objectives, the present invention adopts the following technical measures:
[0009] Using a candidate gene screening method, the applicant cloned the rice drought resistance gene OsORR1, which belongs to the CRKs protein family. Loss of function of this gene leads to weakened resistance in rice under drought stress. The protein encoded by this gene is shown in SEQ ID NO.2, and one of the genes encoding this protein is shown in SEQ ID NO.1.
[0010] The scope of protection of this invention includes:
[0011] Application of the rice OsORR1 gene in controlling drought resistance in rice, wherein the protein encoded by the OsORR1 gene is shown in SEQ ID NO.2;
[0012] The applications described above are specifically as follows:
[0013] Increasing the expression level of the OsORR1 gene in rice can improve the drought resistance of rice.
[0014] Specifically, the method involves introducing substances that enhance the expression level of the OsORR1 gene into rice. Preferably, the substance is a nucleic acid molecule containing the OsORR1 gene, or its expression cassette, recombinant vector, or recombinant microorganism.
[0015] The expression vector carrying the OsORR1 gene of this invention can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, Method for Plant Molecular Biology VIII, Academy Press, New York, 1998, pp. 411-463; Geiserson and Corey, Plant Molecular Biology (2nd Edition), 1998).
[0016] Knocking out or inhibiting the OsORR1 gene in rice can weaken the drought resistance of rice.
[0017] The knockout methods include homologous recombination or CRISPR-Cas9 technology, where the knocked-out gene translates into a protein that has no original function or cannot be translated into a protein.
[0018] The methods for inhibition include: antisense RNA technology or interfering RNA technology.
[0019] In the above-described applications, preferably, the knockout is performed using the CRISPR / Cas9 system, in which the gRNA target sites are target site 1 for Kitaake background gRNA: AGGAGGAGCGTAGTGGTGCA and target site 2: CCCCAAGAACCCTC CCGGTC; and the target sites for ZH11 background gRNA are target site 1: GCCAAGGCATGGCATTTCTG and target site 2: GCAGC TGTGCGCGTACGCCA.
[0020] In the applications described above, rice with reduced drought resistance after editing with the CRISPR / Cas9 system contains the polynucleotides shown in SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5.
[0021] In the above-described applications, preferably, the OsORR1 gene is shown in SEQ ID NO.1.
[0022] Application of the rice OsORR1 gene in the creation of drought-resistant rice varieties.
[0023] Compared with the prior art, the present invention has the following advantages:
[0024] The applicant disclosed for the first time that the OsORR1 gene of rice is related to the drought resistance of rice. This gene can be transformed into a variety of plants, including rice, for the purpose of breeding new drought-resistant plant varieties. Attached Figure Description
[0025] Figure 1 The status of gene editing in the rice osorr1 CRISPR mutant;
[0026] osorr1-k is a Kitaake-background CRISPR homozygous mutant family; osorr1-22 and osorr1-40 are ZH11-background CRISPR homozygous mutant families.
[0027] Figure 2 The root length phenotype of the osorr1-k CRISPR rice mutant at the seedling stage after osmotic stress;
[0028] Figure A shows the seedling osmotic stress (150 mM Mannitol) treatment of the Kitaake homozygous mutant of osorr1, with Kitaake serving as the control. Figure A also shows the taproot growth of the experimental and control groups. Figure B shows the root length statistics of three independent seedling osmotic stress experiments. Differences were analyzed using Student's t-test, with P < 0.05.
[0029] Figure 3 Phenotype of rice osorr1 CRISPR mutant seedlings subjected to osmotic stress;
[0030] Figure A shows the growth status of seedlings under osmotic stress (20% PEG6000) treatment (before and after recovery) in two homozygous mutant families of ZH11 with background osorr1. Figure B shows the survival rate statistics of three independent seedling osmotic stress experiments. Difference analysis was performed using one-way AN OVA and Tukey's t-test; P < 0.05 was considered acceptable.
[0031] Figure 4 The drought stress phenotype of the osorr1 CRISPR rice mutant during the seedling stage;
[0032] Figure A shows the seedling drought stress treatment of the ZH11 background osorr1 homozygous mutant family, with Zhonghua 11 (ZH11) as the control. The left and right sides of Figure A show the plant growth status before and after drought stress treatment, respectively. Figure B shows the statistical values of survival rate in three independent seedling drought stress experiments. Difference analysis was performed using Student's t-test, with P < 0.05.
[0033] Figure 5 The phenotype of rice seedlings overexpressing OsORR1 under osmotic stress;
[0034] Figure A shows the changes in OsORR1 expression in the ZH11 background overexpression material detected by real-time quantitative PCR. The overexpression fold of OsORR1 in the three lines was approximately 20-fold. The rice ACTIN7 gene was used as the internal reference gene. The data are the mean plus standard error of the three replicates. Figure B shows the plant growth status of the three OsORR1 overexpression families (OE-4, OE-10, OE-13) before and after treatment with osmotic stress (20% PEG6000). Figure C shows the statistical values of survival rate in three independent seedling osmotic stress experiments. Difference analysis was performed using one-way ANOVA and Tukey's t-test, with P < 0.05. Detailed Implementation
[0035] The following embodiments define the present invention and describe the methods for constructing osorr1 CRISPR mutants, cloning DNA fragments containing the complete coding region of the OsORR1 gene, and verifying the function of the OsORR1 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from the spirit and scope thereof.
[0036] Example 1: Construction of osorr1 CRISPR mutant
[0037] The gene sequence of the OsORR1 gene was obtained from the rice gene database Rice Data (http: / / www.ricedata.cn / gene / ). Two target sites were selected according to CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The vector construction of CRISPR mutant lines can be referred to the relevant literature (Chen K, Ke R, Du M, Yi Y, Chen Y, Wang X, Yao L, Liu H, Hou X, Xiong L, Yang Y, Xie KA FLASH pipeline for arrayedCRISPR library construction and the gene function discovery of rice receptor-like kinases. Mol Plant. 2022 Feb 7; 15(2):243-257.), which will not be described in detail in this manual due to space limitations. The target sites selected in the CRISPR-P v2.0 website are as follows:
[0038] Kitaake background target site 1: AGGAGGAGCGTAGTGGTGCA
[0039] Kitaake background target site 2: CCCCAAGAACCCTCCCGGTC
[0040] ZH11 background target site 1: GCCAAGGCATGGCATTTCTG
[0041] ZH11 background target site 2: GCAGCTGTGCGCGTACGCCA
[0042] Using Agrobacterium-mediated rice genetic transformation, the two constructed CRISPR vectors OsORR1-CRISPR-k and OsORR1-CRISPR-z were transformed into the rice varieties "Kitaake" and "Zhonghua 11" (two conventional rice varieties from the Rice Research Institute of the Chinese Academy of Agricultural Sciences), respectively. After pre-culture, infection, co-culture, screening for hygromycin-resistant calluses, differentiation, rooting, hardening-off, and transplanting, transgenic plants were obtained. The above Agrobacterium-mediated rice genetic transformation method (system) was improved based on the method reported by Hiei et al. (Hiei et al., Effective transformation of rice, Oryzasativa L., mediated by Agrobacterium and sequence analysis of the genes of the T-DNA, Plant J, 6:271-282, 1994) (see the transformation steps below).
[0043] The specific genetic transformation steps in this embodiment are as follows:
[0044] (1) Electroporation: The final CRISPR target vectors OsORR1-CRISPR-k and OsORR1-CRISPR-z were electroporated into Agrobacterium EHA105 strain at 1800V. The cells were then plated onto LA medium with corresponding resistance selection, and positive clones were screened for use in the following callus transformation.
[0045] (2) Callus induction: Remove the shells from mature rice seeds Kitaake and Zhonghua 11, then treat them with 70% ethanol for 1 minute, and then disinfect the seed surface with 0.15% mercuric chloride (HgCl2) for 15 minutes. Wash the seeds with sterile water 4-5 times. Place the disinfected seeds on the induction medium. Place the inoculated callus induction medium in the dark for 4 weeks at a temperature of 25±1℃.
[0046] (3) Callus subculture: Select bright yellow, firm and relatively dry embryogenic callus, place it on subculture medium and culture it in the dark for 2 weeks at a temperature of 25±1℃.
[0047] (4) Pre-culture: Select firm and relatively dry embryogenic callus, place it on pre-culture medium and culture it in the dark for 2 weeks at a temperature of 25±1℃.
[0048] (5) Agrobacterium culture: Agrobacterium EHA105 (derived from CAMBIA, a commercial strain carrying the CRISPR vectors OsORR1-CRISPR-k and OsORR1-CRISPR-z of the present invention) was pre-cultured on LA medium with corresponding resistance selection for two days at a temperature of 28°C; the Agrobacterium was then transferred to suspension medium and cultured on a shaker at 28°C for 2-3 hours.
[0049] (6) Agrobacterium infection: Transfer the pre-cultured callus to a sterilized bottle; adjust the Agrobacterium suspension to OD. 600 0.8-1.0; Soak the callus in Agrobacterium suspension for 30 minutes; Transfer the callus to sterilized filter paper and blot dry; Then place it on co-culture medium and incubate for 3 days at a temperature of 19-20℃.
[0050] (7) Callus washing and selection culture: Wash the callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer the callus to sterile filter paper and blot dry; transfer the callus to selection medium and select 2-3 times, each time for 2 weeks (the concentration of carbenicillin for the first screening is 400 ppm, and the concentration of hygromycin is 250 ppm for the second and subsequent screenings).
[0051] (8) Differentiation: Transfer the resistant callus to the pre-differentiation medium and culture it in the dark for 5-7 weeks; transfer the pre-differentiated callus to the differentiation medium and culture it under light at a temperature of 26℃.
[0052] (9) Rooting: Cut off the roots that are produced during differentiation; then transfer them to a rooting medium and culture them under light for 2-3 weeks at a temperature of 26℃.
[0053] (10) Transplanting: Wash off the residual culture medium on the roots and transfer the seedlings with good root systems to the greenhouse, while keeping them moist for the first few days.
[0054] Based on the aforementioned gene editing target sites, primers were designed to detect the editing status of the OsORR1 gene in mutants. In the ZH11 background mutant, the OsORR1 gene was specifically amplified by PCR using primers (OsORR1-CR-F: 5'-CTTTGTCGTCTGACCCGGATC-3' and OsORR1-CR-R: 5'-GTCACG TTCCGCACCTTGC-3'), and the amplified PCR products were sequenced. Sequencing results showed that in the osorr1-22 CRISPR homozygous mutant family, the OsORR1 gene had a large deletion of 248 bases between target sites 1 and 2, resulting in a frameshift mutation and premature termination of translation at amino acid position 178; in the osorr1-40 CRISPR homozygous mutant family, the OsORR1 gene had a large deletion of 264 bases between target sites 1 and 2, resulting in a partial deletion of the extracellular DUF26 domain.
[0055] Kitaake background mutants underwent specific PCR amplification of the OsORR1 gene using primers (OsORR1-KCR-F: 5'-AAAAAGATTACGCGGGGATAATCGA-3' and OsORR1-KCR-R: 5'-AATCTAGACATATATATGAATGCGG-3'). Sequencing results showed that in the osorr1-k CRISPR homozygous mutant family, the OsORR1 gene had a deletion of bases 21 to 23 at target site 1, resulting in a deletion of a threonine residue, and a deletion of bases 683 to 689 at target site 2, resulting in a frameshift mutation that prematurely terminated translation at amino acid position 285.
[0056] That is, the OsORR1 gene was mutated in all three mutant families (osorr1-22, osorr1-40 and osorr1-k), and the mutated OsORR1 gene is shown in SEQ ID NO.3-5.
[0057] Example 2: Cloning of the OsORR1 gene and construction of an overexpression vector
[0058] According to the Rice Gene Database (Rice Data) http: / / www.ricedata.cn / gene / Primers OsORR1-F (5'-ATCCAGAT CCAGTGGGATCCATGGCGATGCACCCGTGC-3') and OsORR1-R (5'-GCGGCCGCACTAGTAAGCTTTC TAGGATAGGGATCAGTATTGG-3') were designed. Using cDNA from leaves of rice variety Zhonghua 11 as a template, the CDS sequence encoded by the OsORR1 gene was amplified using primers OsORR1-F and OsORR1-R. The sequence is shown in SEQ ID NO.1, and the encoded protein is shown in SEQ ID NO.2.
[0059] The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, for 35 cycles. The obtained PCR product was ligated into the pU1301 vector digested with restriction endonucleases HindIII and BamHI using the Gibson Assembly method. The vector was sequenced for confirmation, and finally, an OsORR1 gene overexpression vector suitable for genetic transformation was obtained.
[0060] Example 3: Root length phenotype identification of Kitaake background osorr1 mutant under osmotic stress
[0061] The homozygous mutant osorr1-k, whose genotype had been identified in Example 1, and wild-type rice Kitaake were germinated. Seeds with consistent germination were sown in 96-well plates. The hydroponic experiment was repeated in triplicate. The growth chamber conditions were 28°C, light / dark: 16 / 8h, and humidity 50%. Seeds with consistent germination were subjected to 150mM Mannitol osmotic stress. After 4-5 days of growth, the root length of the plants was photographed and recorded.
[0062] The results showed that, compared with the Kitaake control, the CRISPR homozygous mutant plants exhibited a phenotype of osmotic stress sensitivity in their taproot growth. Figure 2 (A). Under normal conditions for 5 days, the taproot growth and development of the osorr1-k homozygous mutant and the wild-type Kitaake were similar, both reaching approximately 10 cm. Under osmotic stress treatment for 5 days, the root lengths of the osorr1-k homozygous mutant and the Kitaake control were 4.2 cm and 6.7 cm, respectively. Statistical results indicate that under osmotic stress, the root length of the osorr1-k mutant was significantly shorter than that of the wild-type Kitaake control. Figure 2 (B)
[0063] Example 4: Phenotypic identification of ZH11 background osorr1 seedling mutants under osmotic stress
[0064] Homozygous mutants (osorr1-22, osorr1-40) with identified genotypes from Example 1 and wild-type rice Zhonghua 11 (ZH11) were germinated, and seeds with consistent germination were seeded in 96-well plates. The hydroponic experiment was replicated in triplicate. The growth chamber conditions were 28°C, light / dark cycle: 16 / 8 h, and humidity: 50%. Healthy plants at the 4-leaf stage were subjected to 20% PEG6000 osmotic stress treatment. After three days (the exact time depending on the seedling condition), the roots were flushed with PEG, and the plants were rehydrated for 5-7 days. Photographs were taken, and the survival rate of the plants was assessed.
[0065] The results showed that, compared with the ZH11 control, the CRISPR homozygous mutant plants exhibited a phenotype that was sensitive to osmotic stress. Figure 3 (A). After recovery from osmotic stress, the mean survival rates of osorr1-22, osorr1-40 mutants and the control ZH11 were 15.8%, 32.8%, and 51.4%, respectively. Statistical results indicate that the survival rate of the osorr1 mutant after rehydration under osmotic stress was significantly lower than that of the control wild-type ZH11. Figure 3 (B) indicates that knocking out OsORR1 leads to a weakening of its resistance to high permeability.
[0066] Example 5: Phenotypic Identification of ZH11 Background Osorr1 Mutant Seedlings Under Drought Stress
[0067] The homozygous mutant (osorr1-22) with identified genotypes from Example 1 and wild-type rice Zhonghua 11 (ZH11) were directly sown into small cylindrical containers after germination. The soil used in the experiment was a mixture of paddy soil from southern China and coarse sand at a volume ratio of 2:3. An equal volume of water was added to each container with uniformly distributed sand, allowing the water to seep out naturally to ensure consistent soil compaction. The experiment was repeated three times. Healthy plants at the 4-leaf stage were subjected to drought stress for 6-10 days (depending on weather conditions), followed by rehydration for 5-7 days. Photographs were taken and the survival rate of the plants was investigated.
[0068] The results showed that, compared with the ZH11 control, the CRISPR homozygous mutant plants exhibited a phenotype that was sensitive to drought stress. Figure 4 (A). After recovery from drought stress, the mean survival rates of osorr1-22 and the control ZH11 were 17.8% and 51.1%, respectively. Statistical results indicate that the survival rate of the osorr1 mutant after drought rehydration was significantly lower than that of the wild-type control ZH11. Figure 4 (B) indicates that knocking out OsORR1 leads to a decrease in its drought resistance.
[0069] Example 6: Phenotypic identification of OsORR1 overexpressing rice seedlings under osmotic stress
[0070] To screen for OsORR1 gene overexpression materials, the expression level of OsORR1 in T0 generation rice seedlings was detected by real-time quantitative PCR. The results showed that the expression level of OsORR1 gene was significantly increased in the OE-4, OE-10, and OE-13 lines (see...). Figure 5 (See Figure A in the text). Identified overexpression materials (OE-4, OE-10, and OE-13) and wild-type rice Zhonghua 11 (ZH11) were germinated and then sown in 96-well plates. The hydroponic experiment was replicated three times. The growth chamber conditions were 28℃, light / dark: 16 / 8h, and humidity 50%. Healthy plants at the 4-leaf stage were subjected to 20% PEG6000 osmotic stress treatment. After three days (the exact time depending on the seedling condition), the PEG was flushed from the roots, and the plants were rehydrated for 5-7 days to recover. Figure 5 The left and right images in B are photos taken before and after osmotic stress treatment, respectively.
[0071] The results showed that after recovery from osmotic stress, the average survival rates of the overexpressing lines OE-4, OE-10, OE-13, and wild-type ZH11 were 70.9%, 87.5%, 85.4%, and 47.9%, respectively. The survival rate of the overexpressing plants was significantly lower than that of the control wild-type ZH11, indicating that overexpression of OsORR1 can improve the osmotic resistance of rice. Figure 5 China B and Figure 5 (C)
Claims
1. Rice OsORR1 The application of genes in controlling drought resistance in rice, as described OsORR1 The gene encodes the protein shown in SEQ ID NO.2, and the control is achieved by increasing the concentration of the protein in rice. OsORR1 The expression level of genes can be used to improve the drought resistance of rice.
2. The application according to claim 1, characterized in that: This will improve the quality of rice. OsORR1 Substances that increase gene expression levels are introduced into rice.
3. The application according to claim 2, characterized in that: The substance mentioned contains OsORR1 Gene expression cassettes, recombinant vectors, or recombinant microorganisms.
4. The application according to claim 1, characterized in that: The aforementioned OsORR1 The gene is shown in SEQ ID NO.
1.
5. Rice OsORR1 The application of genes in the creation of drought-resistant rice, as described OsORR1 The protein encoded by the gene is shown in SEQ ID NO.2.
Citation Information
Patent Citations
Application of OsCRK31 gene in controlling drought resistance of rice
CN117904070A
Application of OsER2 gene in controlling rice environment tolerance
CN118222621A