Application of BnaBAN gene or protein coded by BnaBAN gene in regulation and control of oil content and fatty acid composition of rape

Abstract

The invention discloses an application of a rape anthocyanin reductase BnaBAN gene or a protein coded by the BnaBAN gene in regulating and controlling the oil content of rape and the composition of unsaturated fatty acid. The nucleotide sequence of the BnaBAN gene is as shown in SEQ ID NO.1, or the sequence as shown in SEQ ID NO.1 is subjected to substitution and / or deletion and / or addition of one or more nucleotides and expresses a homologous gene of the same functional protein. An agrobacterium tumefaciens-mediated genetic transformation method is used for editing the BnaBAN gene, and it is found that BnaBAN mutation increases the oil content of rape seeds and affects fatty acid composition. The method disclosed by the invention has very important application prospects in high-oil-content breeding and oil quality improvement of the oilseed rape.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and molecular breeding, and specifically relates to a rape anthocyanin reductase BnaBAN The invention discloses an application of a gene or a protein encoded by the gene in regulating the oil content and unsaturated fatty acid composition of rapeseed. The invention also relates to a method for increasing the oil content and polyunsaturated fatty acid content of rapeseed. Background Art

[0002] As one of the three major nutrients for humans, oils and fats have a high per capita intake. Ensuring the safety of my country's "oil bottle" is an important measure to maintain social stability and protect people's lives and health. my country is a country with a large consumption of edible vegetable oils, but its self-sufficiency rate is low. According to statistics, in 2022, domestic consumption of edible vegetable oils will account for 25% of global consumption, of which domestic edible vegetable oils will account for only 30.7%, and the contradiction between supply and demand is severe. At present, rapeseed oil accounts for more than 50% of domestic edible vegetable oils as an important oil and cash crop in my country, and double-low rapeseed oil has the advantages of low saturated fatty acid content and high unsaturated fatty acid content. It is considered to be the healthiest bulk edible vegetable oil. Therefore, rapeseed is an important strategic resource for realizing the localization of edible oil and an important industry to ensure the security of national edible oil supply. However, the average oil content of rapeseed varieties in my country is about 42%, which is still a big gap compared with the oil content of Canadian rapeseed varieties (45%~48%). There is still a lot of room for improvement in the oil content of rapeseed varieties in my country.

[0003] Seed oil content is a complex agronomic trait that is closely related to a variety of biological processes, such as photosynthesis, embryo and seed coat development, material transport, fatty acid synthesis, accumulation and degradation. At present, more than 700 genes related to oil accumulation have been reported in Arabidopsis. Hundreds of QTLs for oil content have been located in rapeseed (Yan et al 2022), but only orf188 , BnaPMT6, BnaSFAR4, BnaSFAR45 cloned (Hu et al 2017, Hu et al 2021, Tang et al 2021). In addition, homologous gene comparisons also identified some genes related to oil content, such as BnaCIPK9 , BnaTTG1 , BnaTT1 , BnaTT2 , BnaTT8 et al. (Li et al 2023, Wang et al 2023). Further identification of genes related to oil content in rapeseed and creation of new high-oil material germplasm will be one of the long-term goals of rapeseed breeding.

[0004] BANThe gene encodes anthocyanin reductase, which can reduce colored anthocyanins to epicatechins, which are further transported to the vacuole and polymerized to form proanthocyanidins (i.e. condensed tannins). It is a negative regulatory factor of anthocyanin content. BAN It is specifically expressed in seeds. Studies have shown that Arabidopsis BAN The gene mutation leads to the premature accumulation of anthocyanins in the seed coat, and the seed coat appears red during the globular and torpedo embryo stages. BAN Gene mutations also reduce seed germination rates (Albert et al 1997). BAN It is still unclear whether the gene affects oil content and fatty acid content. Blast analysis based on the published database of the Brassica napus genome (http: / / cbi.hzau.edu.cn / bnapus / ) showed that there are four BAN The homologous genes of , are located on chromosomes A01 (BnaA01G0282200ZS), A03 (BnaA03G0584100ZS), C01 (BnaC01G0345900ZS) and C04 (BnaC04G0237700ZS). The transcriptome database of Brassica napus Zhongshuang 11 (http: / / yanglab.hzau.edu.cn / ) was used for analysis. BAN The four homologous genes are all highly expressed specifically in seeds.

[0005] The present invention clones the rape anthocyanin reductase gene BnaBAN , created using CRISPR-Cas9 technology BnaBAN The mutants obtained had significantly increased oil content in seeds and significantly changed fatty acid composition. The results of the applicants indicate that BnaBAN The gene plays an important role in regulating the oil content and fatty acid composition of rapeseed seeds, and it has important application prospects in creating new rapeseed germplasm with high oil content. Summary of the invention

[0006] The first object of the present invention is to provide a rape anthocyanidin reductase BnaBAN Application of genes in regulating oil content and unsaturated fatty acid composition of rapeseed.

[0007] The present invention BnaBAN The gene has one copy each on rapeseed chromosomes A01, A03, C01 and C04, respectively. BnaA01.BAN (BnaA01G0200200WE), BnaA03.BAN (BnaA03G0587200WE), BnaC01.BAN (BnaC01G0281700WE) and BnaC04.BAN(BnaC04G0232100WE). The nucleotide sequences of the gene are shown in the sequence listing SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively, and consist of 1017 bp, 1038 bp, 846 bp and 1029 bp; the protein sequences encoded by the gene are shown in the sequence listing SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively, and encode 338, 345, 281 and 342 amino acids.

[0008] The applicant used Agrobacterium-mediated genetic transformation and CRISPR / Cas9 gene editing technology to obtain genes BnaBAN Next, the oil content and fatty acid content of seeds of wild-type and mutant transformed materials were determined, and it was found that BnaBAN Negatively regulates the oil content and polyunsaturated fatty acid content of rapeseed seeds.

[0009] The second object of the present invention is to provide a method for increasing the oil content and polyunsaturated fatty acid content of rapeseed.

[0010] To achieve the above purpose: using Agrobacterium-mediated genetic transformation method to transform the BnaBAN The CRISPR / Cas9 gene editing vector of the gene was transformed into the rapeseed genome, and the CRISPR / Cas9 gene editing technology was used to obtain BnaBAN Rapeseed varieties with missing gene functions.

[0011] Specifically, the BnaBAN The method for constructing a CRISPR / Cas9 gene editing vector for a gene includes the following steps: 1) According to BnaBAN Screen gene editing targets and design primers using gene and homologous gene sequences; 2) Using the pCBC-DT1T2 plasmid as a template, PCR amplification was performed using the designed primers; 3) Ligate the PCR amplification product with the pKSE401 plasmid by restriction digestion; 4) Transform competent E. coli, screen positive clones and sequence them. The vector with the correct sequence is BnaBAN CRISPR / Cas9 gene editing vector for genes.

[0012] Wherein, the sequence of the gene editing target is: sgRNA1:TACACTTCTTCAGCTGCTG; sgRNA2:AGAGAGATAAACTGCTCGG.

[0013] Furthermore, the primer sequence is: DT1-BsF: ATATATGGTCTCGATTG TACACTTCTTCAGCTGCTG GTT DT1-F0: TG TACACTTCTTCAGCTGCTG GTTTTAGAGCTAGAAATAGC DT2-R0: AAC CCGAGCAGTTTATCTCTCT CAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAAC CCGAGCAGTTTATCTCTCT CAA.

[0014] Furthermore, the reaction system of the PCR amplification is: 2×I-5™ 2×High-Fidelity Master Mix: 25 μL DT1-BsF (10 μmol / L): 2 μL DT2-BsR (10 μmol / L): 2 μL DT1-F0 (0.5 μmol / L): 2 μL DT2-R0 (0.5 μmol / L): 2 μL pCBC-DT1T2 plasmid: 3 μL ddHO: 14 μL.

[0015] Using the above method, we obtained BnaBAN The results of oil and fatty acid content analysis of two independent mutant strains in which all four homologous genes were edited showed that BnaBAN The mutation resulted in a significant increase in the oil content of rapeseed seeds. In addition, the content of two monounsaturated fatty acids (oleic acid and erucic acid) was significantly reduced, while the content of polyunsaturated fatty acids (linoleic acid and linolenic acid) was significantly increased.

[0016] The beneficial effects of the present invention are: The present invention first discovered BnaBAN The gene regulates the oil content and unsaturated fatty acid composition of seeds. The gene can be used to promote the accumulation of oil content in rapeseed seeds, obtain high-oil rapeseed germplasm, and at the same time, increase the polyunsaturated fatty acid content in rapeseed oil. The invention has very important application prospects in the breeding of high-oil rapeseed and the improvement of rapeseed oil quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 :rape BnaBAN Identification of mutants. sgRNA1 and sgRNA2 are located in genes BnaBANThe third and fourth exon regions of BnaA01.BAN, BnaA03.BAN and BnaC01.BAN Three homologous genes matched, and sgRNA2 matched BnaBAN Four homologous genes matched. ban-1 and ban-2 Both BnaBAN Edited homozygous quadruple mutant.

[0018] Figure 2 :rape BnaBAN Phenotypic identification of oil content and fatty acid content of mutant materials. (A) Measurement of oil content of rapeseed seeds by GC-FID. (B) Determination of fatty acid content of seeds. * indicates that the t Testing P <0.05, ** indicates that the t Testing P <0.01. DETAILED DESCRIPTION

[0019] The present invention is further defined below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in the reference book "Molecular Cloning: A Laboratory Guide" (New York: Cold Spring Harbor Laboratory, 1989), or according to the methods recommended in the operating manual provided by the manufacturer.

[0020] Example 1 BnaBAN- Construction of CRISPR vectors Using the sgRNA-Cas9 system of Chen Qijun's team from the College of Life Sciences of China Agricultural University to create rapeseed BnaBAN Mutants. The experimental steps are as follows: (1) Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / and screen the target sgRNA1: TACACTTCTTCAGCTGCTG and sgRNA2: AGAGAGATAAACTGCTCGG. sgRNA1 is located in the gene BnaA01.BAN, BnaA03.BAN and BnaC01.BAN The third exon of , and sgRNA2 is located in BnaBAN The fourth exon region of the four homologous genes. Therefore, sgRNA2 can target BnaBAN All homologous genes of BnaA01.BAN, BnaA03.BAN and BnaC01.BAN .

[0021] (2) Primer design DT1-BsF: ATATATGGTCTCGATTG TACACTTCTTCAGCTGCTG GTT DT1-F0: TG TACACTTCTTCAGCTGCTG GTTTTAGAGCTAGAAATAGC DT2-R0: AAC CCGAGCAGTTTATCTCTCT CAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAAC CCGAGCAGTTTATCTCTCT CAA (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100 times as the template. DT1-BsF and DT2-BsR were normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20 times. The amplification system was: 2×I-5™ 2×High-Fidelity Master Mix: 25 μL DT1-BsF (10 μmol / L): 2 μL DT2-BsR (10 μmol / L): 2 μL DT1-F0 (0.5 μmol / L): 2 μL DT2-R0 (0.5 μmol / L): 2 μL pCBC-DT1T2 plasmid: 3 μL ddH2O: 14 μL PCR amplification program: total denaturation at 98°C for 1 min; denaturation at 98°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 40 s, 34 circles; total extension at 72°C for 5 min.

[0022] (4) Purify and recover the PCR product and establish the following restriction-ligation system: PCR fragment: 2 μL pKSE401: 2 μL 10×NEB T4 Buffer: 1.5 μL 10×BSA: 1.5 μL BsaI (NEB): 1 μL T4Ligase (NEB): 1 μL ddH2O: 6 μL Reaction conditions: 5 h at 37°C, 5 min at 50°C, 10 min at 80°C (5) Transformation of E. coli DH5α: Take 5 μL of the ligation product and add it to 50 μL of DH5α competent cells, pipette and mix, and place on ice for 30 min; in a 42°C water bath for 1.5 min, and place on ice for 3 min; add 400 μL of antibiotic-free liquid LB medium, and revive in a shaker at 37°C, 150 r / min for 45-60 min; take 200 μL of the activated bacterial liquid and spread it on a Kan-resistant solid LB medium, and incubate it at 37°C for 12-16 h. Positive clones are identified by PCR and sequenced, and the vector with the correct sequencing is BnaBAN CRISPR vectors.

[0023] (6) Introduce the correctly constructed recombinant plasmid vector into the Agrobacterium strain GV3101, select the positive single clone and store it in a -80℃ refrigerator. The introduction method is as follows: a. Clean the electric rotating cup: clean it twice with ultrapure water, clean it once with anhydrous ethanol, and place it on a clean bench to dry; b. Take 50 μl of competent Agrobacterium GV3101; c. Take 1 μl of the correctly constructed recombinant plasmid and add it to 50 μl of competent medium. Mix by gently pipetting to avoid bubbles. d. Pre-cool the washed and dried electric rotating cup in ice, and then add the above mixture to the electric rotating cup; e. Adjust the electroporator to 1800 V; f. Take the electroporation cup out of the ice and clean the outer wall of the electroporation cup with absorbent paper; g. Place the electric rotating cup into the instrument and press the "push" button twice in succession. If you hear a "beep" sound after a few seconds, it is successful. h. Then add 400 μl of antibody-free LB to the electroporation cup, pipette a few times, and transfer to a sterile centrifuge tube; i. Resuscitate at 28℃ for about 2 hours, spread 100 μl of bacterial solution on solid LB medium containing resistance, seal with sealing film, invert and culture in a 28-degree incubator for 2 days, and detect by spot picking.

[0024] (7) Agrobacterium colony detection Select colonies and place them in liquid LB containing resistance, culture them at 28°C for 2 hours, take an appropriate amount of bacterial solution for PCR detection, and save the positive Agrobacterium bacterial solution.

[0025] Example 2 Genetic transformation experiment (1) Genetic transformation of rapeseed For the constructed BnaBAN-CRISPR vector for genetic transformation of rapeseed, using Agrobacterium-mediated genetic transformation method. The receptor used for rapeseed transformation in the present invention is Brassica napus Westar. For details of the specific operation process, please refer to the reference: Dai, C., Li, Y., Li, L. et al. An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus. MolBreeding 40, 96 (2020). https: / / doi.org / 10.1007 / s11032-020-01174-0. (2) Identification of CRISPR-transformed strains The obtained rapeseed CRISPR transformed individual plants were sequenced to screen rapeseed mutants. First, the Cas9 protein was identified using primers Cas9-570-F (5'-AGACCGTGAAGGTTGTGGAC-3') and Cas9-570-R (5'-TAGTGATCTGCCGTGTCTC-G-3'), and the target gene was specifically amplified and sequenced for the Cas9 protein-positive individual plants. According to the genomic reference sequence, specific primers were designed on both sides of the target site for the four homologous genes. The specific amplification method of the target gene was: specific amplification was performed using primers BnaA01.BAN-CR-F (5'-AAGAAACATTTCCAGCTGG-3') and BnaA01.BAN-CR-R (5'-AATATTTGCAATTTATATGGAGAT-3') BnaA01.BAN ; BnaA03.BAN-CR-F (5'-TGCTTTTTATATAAACATTTTGAAT-3') and BnaA03.BAN-CR-R (5'-CTGTGGGGAGATAGATATGCT-3') specific amplification BnaA03.BAN ; BnaC01.BAN-CR-F (5'-CCAAGATCCCGAGGTCTGT-3') and BnaC01.BAN-CR-R (5'-TGTCTGTGAAACTTTAACAGAAGG-3') specific amplification BnaC01.BAN ; BnaC04.BAN-CR-F (5'-TATTTTGAAATTGCAAAATTGCA-3') and BnaC04.BAN-CR-R (5'-TTTCCTTGAGACCGCTCAGAT-3') specific amplification BnaC04.BAN , the amplification method is as follows: The PCR system was as follows: 2×Taq Master Mix 20 μL, DNA template 2 μL, F primer 1.6 μL, R primer 1.6 μL, supplemented with ddH2O to 40 μL. PCR conditions: 94℃ total denaturation for 5 min; 94℃ denaturation for 30 sec, 51℃ annealing for 30 sec, 72℃ extension for 1 min, 32 circles; 72℃ total extension for 5 min.

[0026] The amplified target fragments were sequenced, and the sequencing results were analyzed using the DSDecode online website (http: / / skl.scau.edu.cn / dsdecode / ) to analyze the editing of the target site. The sequencing results showed that BnaBAN Two independent mutant lines in which all four homologous genes were edited ( ban-1 and ban-2 ; Figure 1 ).

[0027] Example 3 Phenotypic analysis of mutant materials 1. Gas chromatography was used to determine the fatty acid composition and oil content of seeds (Guo Ning 2021). The specific steps are as follows: (1) Weigh about 15 mg of mature rapeseed seeds and record their weight. Place the seeds in a glass fat extraction tube. (2) Add 4 ml of extraction solution (5% concentrated sulfuric acid, 95% methanol, containing 0.01% BHT) to the fat extraction tube; (3) Use a glass rod to gently crush the seeds to expose the embryo; (4) Use a glass needle to add 100 µl of internal standard heptadecanoic acid (16.2 μmol / ml) and tighten the cap of the lipid extraction tube; (5) Place the sample in a water bath at 85°C for 2 hours to allow the fatty acids to undergo methyl esterification. (6) Remove the sample from the water bath, wait for it to cool to room temperature, add 3.0 ml of n-hexane and 3.0 ml of H2O, and vortex to mix; (7) Centrifuge at 1000 r / min for 10 minutes and use a rubber-tipped pipette to transfer 1.5 ml of the supernatant to a sample injection bottle; (8) Gas chromatography was equipped with a hydrogen flame ionization detector and a capillary RESTEK Rtx®-wax column (0.25 mm × 30 m), with a helium carrier at 20 ml / min. The process parameters are described as follows: injection 1 μl, split ratio 20:1. The oven temperature was maintained at 170 °C for 1 min and then gradually increased to 210 °C at a rate of 3 °C / min; (9) GC-MS automatic sampling analysis; (10) Finally, the fatty acid types were identified based on the retention time characteristics and peak patterns of different fatty acid components, and the peak area data corresponding to each fatty acid component were sorted out. The fatty acid ratio was calculated in nmol% using the internal standard 17:0 as a reference, and the mass of each component was calculated based on the molecular weight of each fatty acid component. Combined with the weight of the seed, the percentage of oil content in dry weight was finally calculated.

[0028] 2. Analysis of oil content and fatty acid content The results showed that the oil content of the receptor material Westar was 41.3±0.1%, and the mutant material ban-1 and ban-2 The oil contents of the two mutants were 44.3±0.7% and 44.7±0.6%, respectively. Statistical analysis showed that the oil contents of the two mutants were significantly increased compared with the wild type ( P <0.01) ( Figure 2 A).

[0029] The content of oleic acid (18:1) in mature seeds of the receptor material Westar was 71.0±1.4%, while that in the mutant material ban-1 and ban-2 The oleic acid content of the two mutants was 64.7±2.1% and 64.8±1.1%, respectively. Statistical analysis showed that the oleic acid content of the two mutants was significantly lower than that of the wild type. The linoleic acid (18:2) content in the mature seeds of the receptor material Westar was 15.3±1.0%, while that of the mutant material ban-1 and ban-2 The linoleic acid content of the two mutants was 18.9±1.6% and 18.7±1.0%, respectively. Statistical analysis showed that the linoleic acid content of the two mutants was significantly increased compared with the wild type. The linolenic acid (18:3) content in the mature seeds of the recipient material Westar was 5.0±0.5%, while that of the mutant material ban-1 and ban-2 The linolenic acid content of the two mutants was 7.8±0.8% and 7.7±0.3%, respectively. Statistical analysis showed that the linolenic acid content of the two mutants was significantly increased compared with the wild type. The erucic acid (22:1) content in the mature seeds of the recipient material Westar was 0.36±0.02%, while that of the mutant material ban-1 and ban-2 The erucic acid contents of the two mutants were 0.28±0.04% and 0.26±0.02%, respectively. Statistical analysis showed that the erucic acid contents of the two mutants were significantly lower than those of the wild type ( Figure 2 B). Therefore, BnaBAN The mutation resulted in a significant decrease in the content of two monounsaturated fatty acids (oleic acid and erucic acid) in rapeseed seeds, while a significant increase in the content of polyunsaturated fatty acids (linoleic acid and linolenic acid).

[0030] In summary, genes BnaBANIt plays an important role in regulating the oil content and fatty acid composition of rapeseed seeds.

[0031] Description of sequence listing: SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 are genes cloned from Brassica napus Westar BnaA01.BAN (BnaA01G0200200WE), BnaA03.BAN (BnaA03G0587200WE), BnaC01.BAN (BnaC01G0281700WE) and BnaC04.BAN The nucleotide sequences of (BnaC04G0232100WE) are 1017 bp, 1038 bp, 846 bp and 1029 bp in length, respectively.

[0032] SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 are genes isolated from Brassica napus Westar BnaA01.BAN (BnaA01G0200200WE), BnaA03.BAN (BnaA03G0587200WE), BnaC01.BAN (BnaC01G0281700WE) and BnaC04.BAN The protein sequences encoded by (BnaC04G0232100WE) encode 338, 345, 281 and 342 amino acids, respectively.

[0033] SEQ ID NO.9 and SEQ ID NO.10 are based on BnaBAN Two gene editing targets designed for the gene and its homologous genes.

[0034] SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14 are primer sequences used for four-primer PCR amplification.

Claims

1. Rapeseed anthocyanin reductase BnaBAN Application of a gene or a protein encoded by the gene in regulating the oil content and unsaturated fatty acid composition of rapeseed, the BnaBAN The nucleotide sequence of the gene is as shown in SEQ ID NO.1, or a homologous gene in which one or more nucleotides are replaced and / or deleted and / or one or more nucleotides are added to the sequence shown in SEQ ID NO.1 and expresses a protein with the same function.

2. A method for increasing the oil content and polyunsaturated fatty acid content of rapeseed, characterized in that: The method of genetic transformation mediated by Agrobacterium is used to transform the BnaBAN The CRISPR / Cas9 gene editing vector of the gene was transformed into the rapeseed genome, and the CRISPR / Cas9 gene editing technology was used to obtain BnaBAN Rapeseed varieties with missing gene functions.

3. The method for increasing the oil content and polyunsaturated fatty acid content of rapeseed according to claim 2, characterized in that: Said BnaBAN The method for constructing a CRISPR / Cas9 gene editing vector for a gene includes the following steps: 1) According to BnaBAN Screen gene editing targets and design primers using gene and homologous gene sequences; 2) Using the pCBC-DT1T2 plasmid as a template, perform PCR amplification using the designed primers; 3) Ligate the PCR amplification product with the pKSE401 plasmid by restriction digestion; 4) Transform competent E. coli, screen positive clones and sequence them. The vector with the correct sequence is BnaBAN CRISPR / Cas9 gene editing vector for genes.

4. The method for increasing the oil content and polyunsaturated fatty acid content of rapeseed as claimed in claim 3, characterized in that: The sequences of the gene editing target are: sgRNA1: TACACTTCTTCAGCTGCTG; sgRNA2: AGAGAGATAAACTGCTCGG.

5. The method for increasing the oil content and polyunsaturated fatty acid content of rapeseed according to claim 4, characterized in that: The primer sequences are: DT1-BsF: ATATATGGTCTCGATTGTACACTTCTTCAGCTGCTGGTT DT1-F0: TGTACACTTCTTCAGCTGCTGGTTTTAGAGCTAGAAATAGC DT2-R0: AACCCGAGCAGTTTATCTCTCTCAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAACCCGAGCAGTTTATCTCCTCAA.

6. The method for increasing the oil content and polyunsaturated fatty acid content of rapeseed according to claim 5, characterized in that: The reaction system of the PCR amplification is: 2×I-5™ 2×High-Fidelity Master Mix: 25 μL DT1-BsF (10 μmol / L): 2 μL DT2-BsR (10 μmol / L): 2 μL DT1-F0 (0.5 μmol / L): 2 μL DT2-R0 (0.5 μmol / L): 2 μL pCBC-DT1T2 plasmid: 3 μL ddHO: 14 μL.

7. The method for increasing the oil content and polyunsaturated fatty acid content of rapeseed as claimed in claim 2, characterized in that: The polyunsaturated fatty acids are linoleic acid and linolenic acid.

Images